| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Anatomic Pathology, Sunnybrook and Women’s College Health Sciences Centre, University of Toronto, Toronto, Ontario, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The telomerase holoenzyme is composed of the single-strand telomere-binding protein telomerase reverse transcriptase (hTERT),12 telomerase-associated protein (TEP1),13 and hnRNP A1.14 The de novo transcription of the hTERT gene is considered the dominant, rate-limiting step in telomerase activation whereas the expression of hTEP1 and hTR is constitutive.13,15 HTERT is only expressed in cells and tissues positive for telomerase activity, and is not detected in normal somatic cells that lack telomerase activity.12,16
Regulation of telomerase activity is complex and involves control at the level of gene transcription, posttranslational protein-protein interactions, and protein phosphorylation. Proto-oncogenes and tumor suppressor genes have been implicated in the regulation of telomerase activity, both directly and indirectly including C-MYC,17 BCL-2,18 p21/Waf1,19 pRB,20 p53,21 protein kinase C,22 Akt/PKB,23 and protein phosphatase 2A.24 Evidence indicates that telomerase is reversibly regulated. Sun exposure to normal human skin results in telomerase activation whereas the process of terminal differentiation of various cells is associated with its down-regulation.25-27 In vitro studies on human breast cancer cell lines showed that anti-neoplastic agents such as doxorubicin, cisplatinum, and tomozolomide decreased telomerase activity in a dose- and time-dependent manner.28 HeLa cervical cancer cells and colorectal cancer cells also show down-regulated telomerase activity after exposure to ionizing radiation.29 Cells resistant to these agents showed no decline in telomerase activity and cell growth.29 These data suggest that telomerase activity may be used as a potential marker for assessing the efficacy of anti-neoplastic agents and test their potential for modulating telomerase activity.
Within the hematopoietic system peripheral blood lymphocytes have low to undetectable levels of telomerase activity whereas early progenitor stems cells in the bone marrow and thymocytes exhibit high activity.30,31 On activation through T- or B-cell antigen receptors or phorbol myristate acetate (PMA) stimulation, a non-cell cycle-restricted induction of telomerase activity has been observed32-35 High telomerase activity was also noted in non-Hodgkin’s lymphomas and cell lines compared with reactive lymph nodes.36
In the current study, we investigated the effect of anti-neoplastic
agents (
-irradiation, cisplatin, VP-16, and vincristine) on
telomerase activity using a sensitive biochemical method termed
telomeric repeat amplification protocol (TRAP) modified for
enzyme-linked immunosorbent assay (ELISA). The results were correlated
with cell viability, cell cycle parameters, and levels of
hTERT mRNA and protein. We show that various
chemotherapeutic agents and radiation result in significant inhibition
of telomerase activity in cell lines derived from T lymphoblastic
lymphoma and Burkitt (B-lineage) lymphoma. Furthermore, an induction of
hTERT transcript and protein was seen in response to these agents. In
addition, we show that p27/Kip1 may be involved in the G2/M
growth arrest induced by the anti-neoplastic agents.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The cell lines used were the human T-cell leukemia Jurkat, human T-cell lymphoma CEM-6, and the human Burkitt lymphoma Raji. These cell lines were maintained in RPMI 1640 (Gibco Life Technologies, Inc.) supplemented with 10% heat-inactivated fetal calf serum, 2 mmol/L L-glutamine, and 100 U/ml of penicillin-streptomycin mixture (Gibco Life Technologies, Inc.).
For drugs or irradiation experiments, cells at late exponential growth
phase were collected by centrifuging at 1200 rpm and resuspended in
fresh medium with 5 x 105
cells per ml.
Cells were incubated at 37°C in 5% CO2 with
anti-tumor drugs or -ray irradiated. Cells were then collected at
different time points for viability assay, proliferation assay, protein
analysis (including Western and telomerase activity assays), and RNA
analysis (RT-PCR). Control cells were not exposed to chemotherapeutic
agents or radiation and otherwise maintained under the same conditions
as the treated cells.
Cell Viability and Proliferation
Viable cell counts were performed using trypan blue solution (Sigma) as described by the manufacturer. Cells (Sigma Chemicals, St. Louis, MO) were counted by using the hemocytometer. Cell proliferation was evaluated by [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay] MTT assay as described previously.28 Briefly, 0.1 ml cell cultures (0.5 x 105 cells) per well were seeded in the 96-well plate. MTT (10 mg/ml, 10 µl/well; Sigma) was added to each well and incubated at 37°C for 3 hours. Cells were then lysed by adding 0.1 ml per well of lysis solution (20% sodium dodecyl sulfate, 50% N,N-dimethyl formamide, pH 4.7). Absorbance was measured at 540 nm using an ELISA reader after overnight incubation of the mixture.
Telomerase Activity Assay
Telomerase activity was determined using the TRAP ELISA kit (Boehringer Mannheim, Mannheim, Germany). Briefly, cells were lysed in lysis buffer by incubating the cell suspensions on ice for 30 minutes. Samples were microcentrifuged at 15,000 rpm for 15 minutes at 4°C. Protein concentrations of cell extracts were measured using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Unless specified otherwise, 0.03 µg of protein taken from the cell extracts was incubated at 25°C in the presence of biotin-labeled primers. The telomeric repeats were added onto the ends of the synthetic primers by the active telomerase present in the cell extracts. The synthetic products were further amplified by PCR. The denatured products were allowed to bind to a streptavidin-coated 96-well plate and hybridized to a digoxigenin-labeled, telomeric repeat-specific probe. The biotin-labeled PCR products were detected using peroxidase-conjugated antibodies against digoxigenin and subsequently visualized by adding Tris borate-ethylenediaminetetraacetic acid as the substrates of the peroxidase. The amount of the colored products representing the telomerase activity was measured at 450 nm using an ELISA reader. Telomerase activity was determined in triplicate. Negative controls were prepared by inactivating the telomerase activity present in the cell extracts with high temperature (95°C for 10 minutes) before the incubation step at 25°C.
Cell Cycle and Apoptosis Analysis
Cell cycle distribution was determined by staining with propidium iodide (Sigma) as previously described.37 Briefly, 1 x 106 control or treated cells were pelleted and resuspended in 1.2 ml of propidium iodide solution (50 µg/ml in 0.1% sodium citrate plus 0.1% Triton X-100 (Sigma). All profiles were generated using Becton Dickinson FACScan flow cytometer (Becton Dickinson, San Diego, CA) using Cell Quest software.
Immunoblot Analysis
Cell extracts were prepared as described in the Telomerase Assay section. To each lane, 15 µg proteins were resolved in a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel using a BioRad minigel system. Separated proteins were subsequently transferred onto a nitrocellulose film using a semidry transfer apparatus (BioRad). The following antibodies were used for immunoblot analysis: rabbit polyclonal antibody against hTERT (Santa Cruz Biotechnology, Santa Cruz, CA), mouse monoclonal antibody against p27/Kip1 (Transduction Laboratories, Lexington, KY), mouse monoclonal antibody against p53 or p21/Waf1 (Calbiochem, La Jolla, CA) and rabbit polyclonal antibody against BCL-2 (Santa Cruz Biotechnology). Protein bands were visualized using the ECL kit (Amersham, Arlington Heights, IL).
RT-PCR
Total RNA was extracted using Trizol Reagent (Gibco Life Technologies, Inc.) following the manufacturer’s instructions. First-strand cDNA was synthesized from 2 µg of RNA in 20 µl of reaction solution using a random primer and Superscript II reverse transcriptase reagent (Gibco Life Technologies, Inc.) according to the manufacturer’s instructions.
The hTERT (human telomerase reverse transcriptase) cDNA was amplified using oligonucleotide primers LT5 and LT6.12 The p27 cDNA was amplified using the hp27-7F (AACGTGCGAGTGTCTAACG) and HP27-234R (CTCTTGCCACTCGTACTTG) primers. The GAPDH cDNA was amplified using a forward primer (CGGAGTCAACGGATTTGGTCG) and a reverse primer (AGCCTTCTCCATGGTGGTGAAGAC) and used as a control. The thermal cycling condition for all PCR was: 94°C for 5 minutes, followed by 30 cycles of 94°C for 50 seconds, 59°C for 50 seconds, and 72°C for 90 seconds. The PCR products were resolved on a 2% agarose gel, stained with ethidium bromide (Sigma). Densitometry was performed using the Molecular Dynamics Imaging system and ImageQuant 3.3 software to quantitate relative amounts of protein detected on Western blots and ethidium bromide-stained gels.
Statistical Analyses
Descriptive statistics (fold increases and percentage) were used
to present the distribution of the measured parameters. The SDs of mean
values were used to measure the variability of the parameters. The
significance of changes in parameters between untreated and treated
samples were determined by the Wilcoxon matched-pairs test. A
two-tailed 
level of 0.05 was used as the criterion for statistical
significance.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To determine conditions under which the TRAP-PCR ELISA assay would
yield quantitative data, we used total protein lysates of peripheral
blood lymphocytes and three malignant lymphoma cell lines and
determined the range over which the telomerase assay products were
proportional to the protein concentration. Jurkat and CEM-6 are
T-lineage lymphoblastic lymphomas, whereas Raji is a B-lineage
malignancy derived from a Burkitt lymphoma. For all cell lines, cell
extracts at 0 to 0.05 µg protein per assay yielded a linear increase
in telomerase activity. Telomerase activity plateaued at protein levels
exceeding 0.05 µg per reaction (Figure 1)
. All subsequent assays therefore used
0.03 µg of protein to ensure quantitative measurement of telomerase
activity. Jurkat cells exhibited the highest level of telomerase
activity at 0.03 µg [absolute value of 1.22 ± 0.024 optical
density (OD) 450 nm] that was the protein concentration that yielded
75% of maximal telomerase activity. Raji cells expressed the lowest
telomerase activity with absolute OD 450 nm reading of 0.43 ±
0.013 whereas CEM-6 cells demonstrated an intermediate level of
telomerase activity (absolute OD 450 of 0.75 ± 0.015). Control
peripheral blood lymphocytes demonstrated a negligible level of
telomerase activity (absolute OD 450 of <0.1).
|
To determine whether the level of telomerase activity would be
modulated by radiation and chemotherapy and potentially useful in
monitoring residual cancer cell survival, we studied the effect of
137Cesium -rays and a variety of hematopoietic
anti-neoplastic agents on telomerase activity. Preliminary experiments
were performed to determine dosage and concentration of anti-neoplastic
agents that were effective cytotoxic agents based on previously
published studies.38
Cells growing at late-exponential
phase were exposed to 30 Gy of ionizing radiation and incubated at
37°C for up to 72 hours. Cells collected at different time points
after irradiation were examined for cell viability and telomerase
activity.
Analysis of telomerase activity by TRAP-PCR ELISA after exposure to
anti-neoplastic agents showed variable responses in different cell
lines. Raji cells demonstrated significant reduction of telomerase
activity after cisplatin, VP-16, and vincristine treatment. As early as
24 hours after treatment there was a 51% reduction in telomerase
activity after exposure to cisplatin compared to untreated cells
(P < 0.0001), a 44% reduction by VP-16
(P < 0.0001), and a 32% reduction by
vincristine (<0.001) (Figure 2)
. There
was sustained reduction of telomerase activity after vincristine
treatment in the Raji cells with maximal inhibition of 80% at 48 hours
(<0.0001) whereas other treatments showed transient inhibition with
subsequent increases seen at 48 hours. Jurkat and CEM-6 cells showed
significant and sustained reduction of telomerase activity after
vincristine (82%, P < 0.0001; 93%, P
< 0.0001, respectively) and -irradiation (82%, P
< 0.0001; 93%, P < 0.0001, respectively) at 48
hours. Telomerase activity decreased only minimally by cisplatin and
VP-16 in the T lymphoblastic cells. No treatments resulted in an
increase in telomerase activity.
|
. The relationship between viability and
decrease in telomerase activity was also variable between cells and
specific anti-neoplastic agents. Jurkat and CEM-6 cells that are
high-grade T-precursor lymphoblastic lymphoma cells were most sensitive
to the effects of vincristine and -irradiation. Growth impairments
induced by these agents paralleled their effect on suppression of
telomerase activity except for CEM-6 cells treated with radiation.
Cisplatin and VP-16 had minimal effects on the viability of both Jurkat
and CEM-6 cells and had parallel effects on telomerase activity. In
contrast, Raji, a B-lineage Burkitt lymphoma cell line was resistant to
all agents with no impairment of cell growth at 48 hours (Figure 2C; a,
b, c, and d
) and had no effects even at 96 hours after treatment (data
not shown). In contrast to the responses of the Jurkat and CEM-6 cells,
there was a dramatic decrease in the telomerase activity by all
treatments that was not paralleled with growth impairment. Effect of Chemotherapeutic Agents and Radiation Treatment on Cell-Cycle Distribution and Apoptosis
The decrease in telomerase activity paralleled cell growth
impairment evaluated by trypan blue dye exclusion or by measurement of
cell ability to convert tetrazolium salt to colored formazan
[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay]
(MTT) in the T-lymphoblastic lymphoma cells Jurkat and CEM-6. To
determine the relationship between the reduction in telomerase activity
and cell cycle distribution we performed cell cycle analysis on CEM-6
cells that had been exposed to 30 Gy of irradiation and to cisplatin,
vincristine, and VP-16. Figure 3
and
Figure 4
show the cell cycle distribution
at 0 hours, 24 hours, and 72 hours after exposure to anti-neoplastic
agents. Cells undergoing apoptosis are identified by the subdiploid
peak on staining with propidium iodide. This is attributed to the loss
of oligonucleotide size DNA fragments by DNase digestion in the early
stages of programmed cell death. Flow cytometric analysis of propidium
iodide-stained cells is a well-accepted method for quantitative
assessment of apoptosis.39
As shown in Figure 3A
untreated
control cells were composed of 50.6% cells in
G0/G1, 16.5% cells in S,
and 28% cells in G2/M, whereas only 2.5% of
cells are in the subdiploid apoptotic population. Treatment of CEM-6
cells with cisplatin, VP-16, and vincristine resulted in a
G2/M arrest followed by apoptosis (Figure 3; B,
C, and D
). Irradiation however resulted in rapid increase of apoptotic
cells with >50% cells in the subdiploid peak at 24 hours (Figure 3E)
.
CEM-6 cells were most susceptible to vincristine and radiation-mediated
apoptosis (Figure 3, D and E)
whereas VP-16 and cisplatin did not
significantly increase the number of apoptotic cells even at 72 hours
(1.5- and 3.1-fold, respectively).
|
|
Reverse transcriptase (RT)-PCR and Western blot analyses were used
to determine whether the decrease in telomerase activity correlated
with the expression of the hTERT mRNA and its protein
product. Surprisingly, all anti-neoplastic agents consistently induced
the expression of hTERT protein in all cell lines despite inhibition of
telomerase activity. Figure 5
shows that
the level of hTERT protein induction is both cell-type-dependent and
time-dependent. All treatments resulted in significant induction of
hTERT protein expression in Jurkat cells. The relative density of hTERT
protein compared to control untreated cells was induced 4.3-fold by
cisplatin, 4.1-fold by VP-16, 5.6-fold by vincristine, and 5.8-fold by
radiation at 72 hours. Significant induction of hTERT protein
expression was seen in CEM-6 cells by vincristine (5.1-fold) and
radiation (3.6-fold) at 72 hours whereas cisplatin and VP-16 failed to
induce its expression (1.6-fold and 1.2-fold, respectively).
Vincristine and radiation also induced hTERT protein expression by 4.8-
and 3.7-fold in Raji cells at 72 hours whereas cisplatin and VP-16 had
minimal effects (1.7- and 2.3-fold respectively). Furthermore, RT-PCR
analysis of hTERT transcript demonstrated that the induction of hTERT
protein observed for the CEM-6 cells correlated with the induction of
hTERT mRNA expression by threefold to fourfold by cisplatin and VP16
(Figure 6, A and B)
. By contrast, RT-PCR
analysis of p27/Kip1 mRNA expression showed absence of induction in
response to these agents. Thus, the inhibition of telomerase activity
was seen concurrent with the induction of hTERT mRNA and protein
expression.
|
|
Expression of cell cycle-associated proteins was performed
by Western blot analysis of cell lysates after treatment with radiation
and chemotherapy. Significant induction of p27/Kip1 protein was seen in
cells treated with chemotherapeutic and radiation (Figure 5)
that was
detectable as early as 24 hours. Even in Jurkat cells with high basal
levels of p27/Kip1 protein there was a 2.8-fold to 4-fold induction by
vincristine and cisplatin (Figure 5)
. In contrast to hTERT, RT-PCR
analysis of the p27/Kip1 transcript revealed no significant differences
in expression in treated cell lines (Figure 6, A and B)
. This is
consistent with the notion that p27/Kip1 is regulated at the
posttranslational levels by phosphorylation and
ubiquitination.40-42
Induction of p21/Waf 1 was
inconsistent except for Raji cells exposed to vincristine (3.9-fold at
24 hours). In all cell lines p53 protein levels were induced most
significantly by radiation treatment. As the expression of p53 is
regulated predominantly at the posttranslational
level,43,44
levels of mRNA were not determined. Western
blotting for BCL-2 demonstrated up-regulation by cisplatin in Jurkat
cells and by vincristine in CEM-6 cells (data not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To test whether DNA damaging agents that block cells at specific
checkpoints of the cell cycle would have an effect on modulating
telomerase activity we studied the effect of these agents and
-irradiation in three aggressive lymphoma cell lines of both B-cell
(Raji) and T-cell (Jurkat and CEM-6) lineage. We found that there was
significant reduction of telomerase activity in lymphoma cells exposed
to chemotherapeutic agents and radiation. The reduction was
demonstrable as early as 24 hours after treatment and was sustained to
beyond 72 hours. The down-regulation of telomerase activity in
T-lymphoblastic lymphoma cells was specific to vincristine and
radiation with no effect with cisplatin and VP-16. In addition, the
decrease in telomerase activity was not attributed to decreased numbers
of cells as the percentage of viable cells did not decrease with time
for most treatment except for CEM-6 cells treated with vincristine and
radiation in which the decrease in telomerase activity was directly
proportional to effect on cell viability. The cell-type-specific
reduction suggests that regulation of telomerase activity in
T-lymphoblastic lymphomas may be different from that of Burkitt
lymphomas. This may be attributed to additional genetic alterations
such as c-myc overexpression secondary to the t(8;14)
translocation and/or the oncogenic properties of Epstein-Barr virus
that may render these cells more resistant to cytotoxic agents. These
results are similar to those reported in HeLa cells, colorectal
carcinoma cells, and ataxia-telangiectasia cells29
where a
dose-dependent decrease in telomerase activity was observed in
proportion to cell kill and tumor regression after ionizing radiation
treatment. Specific cellular context may be important in regulating the
telomerase activity in response to irradiation as contradictory data
were reported in which low doses of radiation (2 to 10 Gy) resulted in
an increase in telomerase activity in certain lymphoma and myeloma cell
lines.45
This therefore may highlight the
lymphoma-specific regulation of telomerase activity. Alternatively,
lower doses of radiation may induce a different cellular response.
Telomerase activity may also be an indicator of responsiveness to cytotoxic agents. Inhibition of telomerase activity with an anti-sense telomerase expression vector has been shown to not only decrease telomerase activity but also increase susceptibility to cisplatin-induced apoptotic cell death in cisplatin-sensitive malignant glioblastoma cells. Others have shown that cells with higher telomerase activity tended to be more sensitive to 5-FU and cisplatin in human esophageal cancer cells.46 Our data supports this notion because Jurkat and CEM-6 exhibited a higher basal level of telomerase activity compared to Raji cells. These two cells were more sensitive to vincristine and radiation than Raji cells. These findings suggest a correlation between basal level of telomerase activity and response to anti-neoplastic agents in lymphoma cells. A close link between telomerase activity and factors that regulate cell apoptosis and survival may yet exist.
Telomerase holoenzyme is composed of hTERT, the catalytic subunit of telomerase that is concomitantly expressed with the activation of telomerase during cellular immortalization and tumor progression,47 and is the rate-limiting enzyme in telomerase activity. In vitro reconstitution of telomerase also shows that hTERT and the telomerase RNA subunit constitute a minimum core structure of telomerase.48 A positive correlation between telomerase activity and telomere length and a negative relationship between telomerase activity and hTERT expression has been reported.49 Our data show that telomerase activity is negatively correlated with the hTERT mRNA and protein expression. This is consistent with observations made in human esophageal cancer cells46 as well as human lymphocytes.49 Possible explanations for this include presence of hTERT splice variants and inhibitors of telomerase activity that were excluded by Liu and colleagues.49 We can further speculate that the transcriptional regulation of hTERT may not be sufficient to account for telomerase activity and may include other posttranscriptional factors in the control of the holoenzyme. Time-course analysis of telomerase activity and hTERT protein expression after exposure to chemotherapeutic agents and radiation indicate that whereas significant inhibition of telomerase activity was evident by 24 hours, the induction in hTERT protein expression was not seen until 48 hours. This suggests the possible existence of a feedback mechanism whereby a decrease in telomerase activity results in the induction of telomerase protein. RT-PCR analysis shows that increased hTERT transcript is detectable at 24 hours consistent with the notion that there is transcriptional up-regulation of hTERT in response to chemotherapeutics and radiation treatment. It is accepted that de novo activation of hTERT gene expression is a first rate-limiting step in telomerase activation in cancer. The induction of hTERT mRNA and protein expression seen in our data also suggests the possibility of residual viable cells that are resistant to the cytotoxic agents. Moreover these results suggest that up-regulation of hTERT expression may be a marker of resistance.
We hypothesized that the down-regulation of telomerase activity by DNA-damaging agents may be mediated by cyclin-dependent kinase inhibitors (CDKI) that are induced during cell cycle arrest in G2/M. Our current study shows that the G2/M arrest observed in CEM-6 cells in response to cisplatin, VP-16, and vincristine correlated with the induction of p27/Kip1 protein expression but not p21/Waf1. These data suggest that p21/Waf1 and p27/Kip1 CDK inhibitors are discoordinately regulated in these cells. Although p21/Waf1 and p27/Kip1 share a similar domain involved in cyclin binding and mediate growth arrest when overexpressed,50 others have shown that there is lack of coordination in the expression and function of CDKIs. There was differential induction of p27/Kip1 protein in a cell type-dependent and in a time-dependent manner. The constitutive expression of p27/Kip1 mRNA as determined by RT-PCR is consistent with the previously established posttranscriptional mode of regulation of this gene.51 These results suggest that heterogeneity in chemotherapy and radiation-mediated growth effects may be attributed to differential induction of p27/Kip1 expression. Although p21/Waf1 has been implicated in regulation of telomerase activity19 a similar role for p27/Kip1 has not been reported. Although the up-regulation of p27/Kip1 may reflect an indirect effect of radiation and chemotherapeutic agents on telomerase activity, the role of p27/Kip1 as a modulator of telomerase expression remains to be determined.
p27/Kip1 has been shown to be induced by a number of agents that induce
G1 growth arrest including
lovastatin,52
transforming growth
factor-ß1,53
after cell-to-cell contact inhibition,
rapamycin, and by agents that induce cAMP-mediated growth
arrest.54,55
This is the first report of p27/Kip1
up-regulation in response to -irradiation and chemotherapeutic
agents. These findings provide support for the central role of p27/Kip1
in mediating growth arrest and apoptosis in lymphoma cells.
Some investigators have reported an inverse relationship between p53 expression and telomerase activity. Induced expression of wild-type p53 in immortalized fibroblasts resulted in the down-regulation of telomerase activity.56 Adenovirus-mediated p53 gene transduction has also been shown to result in down-regulation of telomerase activity in human pancreatic cancer cells57 with concomitant G1 cell cycle arrest and apoptosis. In vitro studies have provided evidence for direct molecular interactions between telomerase associated protein 1 (TEP1) and p53.21 All of the three cell lines in our study express mutant p53 protein.58-61 Although the induction of p53 protein in response to chemotherapeutic and radiation exposure is correlated with down-regulation of telomerase activity consistent with previously reported observations,62 there is no conclusive evidence that mutant p53 can regulate telomerase activity.
These data suggest that telomerase activity not only varies among different telomerase-positive cell lines, but also responses to chemotherapeutic agents and radiation exposure vary. The reduction in telomerase activity observed in our in vitro experiments paralleled cell kill by some agents whereas in others it was independent of cytotoxic effect. Determination of telomerase activity during or after treatment with anti-neoplastic agents might be a useful indicator of tumor regression. Our data also suggests the potential relationship between p27/Kip1 and telomerase activity. Whether telomerase activity is regulated by p27/Kip1 as has been suggested for p21/Waf119 remains to be determined.
|
Footnotes |
|---|
Supported by a grant from the Sunnybrook Trust for Research.
Current address of Zhaosheng Lin: ARUP Laboratories, 500 Chipeta Way, Salt Lake City, UT 84108.
Accepted for publication April 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  R. J. Ward and C. Autexier Pharmacological Telomerase Inhibition Can Sensitize Drug-Resistant and Drug-Sensitive Cells to Chemotherapeutic Treatment Mol. Pharmacol., September 1, 2005; 68(3): 779 - 786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Lin, D. K. Crockett, S. D. Jenson, M. S. Lim, and K. S. J. Elenitoba-Johnson Quantitative Proteomic and Transcriptional Analysis of the Response to the p38 Mitogen-activated Protein Kinase Inhibitor SB203580 in Transformed Follicular Lymphoma Cells Mol. Cell. Proteomics, August 1, 2004; 3(8): 820 - 833. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. J. Elenitoba-Johnson, S. D. Jenson, R. T. Abbott, R. A. Palais, S. D. Bohling, Z. Lin, S. Tripp, P. J. Shami, L. Y. Wang, R. W. Coupland, et al. Involvement of multiple signaling pathways in follicular lymphoma transformation: p38-mitogen-activated protein kinase as a target for therapy PNAS, June 10, 2003; 100(12): 7259 - 7264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Buttitta, C. Pellegrini, A. Marchetti, A. Gadducci, S. Cosio, L. Felicioni, F. Barassi, S. Salvatore, C. Martella, G. Coggi, et al. Human Telomerase Reverse Transcriptase mRNA Expression Assessed by Real-Time Reverse Transcription Polymerase Chain Reaction Predicts Chemosensitivity in Patients With Ovarian Carcinoma J. Clin. Oncol., April 1, 2003; 21(7): 1320 - 1325. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson Natural and pharmacological regulation of telomerase Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. J. Elenitoba-Johnson Complex Regulation of Telomerase Activity : Implications for Cancer Therapy Am. J. Pathol., August 1, 2001; 159(2): 405 - 410. [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
