| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology,*
the Department of
Biochemistry,
the Department of
Anatomy
, the Department of Internal
Medicine,
and the Department of Dental
Pharmacology,¶
Okayama University Graduate School
of Medicine and Dentistry, Okayama; and the First Department of
Medicine,||
Niigata University, School of Medicine,
Niigata, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Completion of the genome sequences of model organisms and humans will provide us with complete blueprints of these genomes. The study of gene expression on a genomic scale is the most obvious opportunity made possible by complete genome sequences, and the most experimentally straightforward. cDNA microarrays make it easy to measure the transcripts for every gene at once.8-11 Due to the tight connection between the function of a gene product and its expression pattern, each gene is expressed in specific cells and under specific conditions. Promoters of genes function as transducers, responding to input information about the identities, environment, and internal state of a cell by changing the level of transcription of specific genes. The group of genes expressed in a cell determines what the cell is made of, what biochemical and regulatory systems are operative, how the cell is built, and what it can and cannot do. Many genes and signal transduction pathways that control cellular proliferation, differentiation and programmed cell death, as well as genomic integrity, are also involved in cancer development. cDNA microarrays have enabled measurement of the expression of thousands of genes in a single experiment for the systematic and comprehensive exploration of genome-wide alterations in cancer cells.8-10 Recently, distinct types of diffuse large B cell lymphoma (DLL), which show markedly different clinical courses and treatment responses apparently reflecting the variation in tumor proliferation rate, host response, and differentiation state of tumor, have been identified and diagnosed by gene expression profiling with cDNA microarrays.10 However, analysis of hundreds of specimens from patients from different stages is essential to establish the diagnostic, prognostic, and therapeutic importance of each of the many oncogene or anti-oncogene candidates. To overcome this difficulty, an array-based high-throughput tissue microarray technique has been established to facilitate analysis of gene expression and DNA copy number of large numbers of tumors.12-14 We developed this technique independently, modified it, and here apply the modified method to lymphoma analysis in combination with a cDNA expression array.
In the present investigation, we analyzed the expression profiles of human NK cell lines compared to normal NK cells or peripheral blood mononuclear cells (PBMCs) to elucidate the mechanism of NK/T lymphomagenesis. We found strong suppression of SHP1 gene expression in the various types of lymphomas/leukemias as well as in NK/T cell lymphomas, suggesting that SHP1 is one of the key molecules for the malignant transformation of lymphomas/leukemias.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human NK cell lines, NK-YS15 and NK-TY2 (in preparation for publication), were maintained in Iscove’s modified Dulbecco’s medium (IMDM; GIBCO, Grand Island, NY) supplemented with 10% fetal calf serum [(FCS) Sankou Junyaku, Chiba, Japan], 100 U/ml recombinant human interlekin-2 (Strathman Biotech GMBH, Hannover, Germany), 100 U/ml kanamycin (Meiji, Tokyo, Japan), and 100 µg/ml streptomycin (LIFE Technologies, Rockville, MD). Other cell lines were maintained in RPMI-1640 supplemented with 10% FCS, 100 U/ml of kanamycin, and 100 µg/ml streptomycin. PBMCs were isolated by the Ficoll-Hypaque method from healthy volunteer blood donors. Fresh normal NK cell fraction was further purified by the magnetic beads method with anti-CD56 monoclonal antibody (PerSeptive Biosystems, Tokyo, Japan). The purity of this NK cell-enriched fraction was about 60% to 70%. PBMCs were incubated in RPMI 1640 containing 10% FCS with or without 0.1% pokeweed mitogen (PWM) (GIBCO BRL, Rockville, MD) or 5 µg/ml phytohemagglutinin-P (PHA-P) (Sigma, St. Louis, MO) for 72 hours at 37°C in a CO2 incubator and used as the source of lymphoblasts. Cells were also treated with 20 ng/ml PMA (TPA; phorbol ester; Sigma, St. Louis, MO) for 72 hours at 37°C in a CO2 incubator. The KCA cell line was obtained from Dr. E.C. Butcher (Department of Pathology, Stanford University, Stanford, CA). HairM, MOLP2, L428, SKW3, SU-DHL4, RPMI8226, HDLM2, EDS, and HUT102 were from Dr. Y. Matsuo (Fujisaki Cell Center, Hayashibara Biomedical Laboratories, Okayama, Japan).
cDNA Expression Array Analysis
Total RNA of freshly isolated PBMCs from two healthy volunteers were mixed and used as a pooled reference RNA. Each RNA, extracted from NK/T cell lines (NK-YS, NK-TY2), Jurkat cells, purified fresh normal NK cells, or fresh normal PBMCs was 32P-labeled and used to synthesize probes using the Atlas Pure Total RNA Labeling System (K1038–1; Clontech Laboratories Inc., Palo Alto, CA). Hybridization of the ATLAS Human Cancer 1.2 Array (Clontech Laboratories, Inc., Palo Alto, CA) was performed according to the instruction manual. The results were analyzed on a Fujifilm BAS3000 system using Array Gauge Computer software (Fujifilm Co., Tokyo, Japan). After normalization of the total amounts of gene expression, gene expressions were compared among the NK-YS, NK-TY2, Jurkat cell lines, normal PBMCs, and fresh normal human NK cells.
Analysis of mRNA Expression by RT-PCR
A 2 µg aliquot of DNase-I treated total cellular RNA was reverse-transcribed with SuperScript II reverse transcriptase (Life Technologies, Rockville, MD) in 20 µl of 20 mmol/L Tris-HCl (pH 8.3) containing 50 mmol/L KCl, 1.25 mmol/L MgCl2, 5 mmol/L dithiothreitol, 500 µmol/L dNTP, and 1 µmol/L oligo(dT)12–18 primer. The reaction proceeded at 42°C for 50 minutes and was terminated at 70°C for 15 minutes followed by treatment of RNase H at 37°C for 20 minutes. Portions (0.5 µl) of single-stranded cDNA were amplified by polymerase chain reaction (PCR) using SHP1 specific primer pairs, the sequences of which were obtained from Clontech Laboratories, Inc. The PCR reaction was performed using Platinum PCR Super Mix (Life Technologies, Rockville, MD). The amplification condition consisted of 2 minutes of pretreatment at 94°C, followed by 30 cycles of denaturation (94°C, 30 seconds), annealing (59°C, 30 seconds), and extension (72°C, 1 minute 30 seconds) and treatment (72°C, 10 minutes).
Tissue Microarray Analysis
We developed independently and modified the method to make tissue microarray without film, which is used in the original method to prevent peel-off of the mounted microtissue specimen.12 We overcame this difficulty with the fine adjustment of the donor punched out block to recipient pored block. It can be treated as if it is one standard paraffin block. A total of 207 paraffin embedded tissue samples consisting 197 cases of primary malignant lymphomas of 22 different histological categories and 10 cases of normal reactive lymphoid hyperplasia (RLH) samples were used for the malignant lymphoma tissue microarray. Core tissue biopsies (diameter, 0.8 mm) were taken from selected regions of individual paraffin-embedded malignant lymphoma specimens (donor block) and precisely arrayed into a new recipient paraffin block (50 mm x 23 mm) using a custom-built instrument. After the block construction was completed, 5 µm sections of the resulting malignant lymphoma tissue microarray block were cut with a microtome. These specimens were used for hematoxylin-eosin staining, immunostaining, and in situ hybridization.
In Situ Hybridization
EBV-encoded small RNA-1 (EBER1) expression was detected by RNA in situ hybridization using a single-stranded 30-base FITC-labeled oligonucleotide complementary (antisense probe) or anticomplementary (sense; negative control probe) to a portion of the EBER1 gene. The sequence of the anti-sense probe was 5'AGACACCGTCCTCACCACCCGGGACTTGTA3'.16 The in situ hybridization was performed on routinely processed sections of the paraffin-embedded tumor tissues or tissue microarray using a DAKO in situ hybridization kit (DAKO Japan, Kyoto, Japan) as described previously.17 Briefly, after proteinase K digestion, the sections were post-fixed with 4% paraformaldehyde and acetylated with triethanolamine and acetic anhydride to reduce nonspecific electrostatic hybridization. The hybridization was carried out at 37°C overnight. The substrate reaction was developed using an in situ detection kit (DAKO, K046) according to the manufacturer’s instructions. Paraffin-embedded pellets of an EBV-infected cell line (B95–8) and EBV-positive non-Hodgkin’s lymphoma tissues were used as the positive controls. Pellets of an non-EBV-infected T cell line (Jurkat) and reactive-non-neoplastic lymph nodes served as the negative controls. For the analysis of SHP1 mRNA in situ hybridization, we used digoxygenin-labeled sense and antisense SHP1 riboprobes, which were synthesized with T7 RNA polymerase using a labeling kit (Boehringer, Germany), and were hybridized without alkaline hydrolysis. In situ hybridization was performed at 50°C according to the method by Meyer et al.18
Western Blot Analysis
Western blot analysis was performed according to the method of Towbin et al.19 After 12.5% polyacrylamide gel electrophoresis of cellular protein lysate from 7.5 x 104 cells of each culture, banded proteins were electrophoretically transferred to polyvinylidene difluoride membrane (Immobilon; Millipore, Ltd., Bedford, MA) and then reacted with the antibody to SH-PTP1 (D11; mouse monoclonal antibody against the C-terminal of SHP1, C-19; rabbit polyclonal antibody against whole SHP1 protein, Santa Cruz Biotechnology Inc., Santa Cruz, CA) and monoclonal anti-ß-actin (Sigma, St. Louis, MO). The immunoreactive bands were visualized with peroxidase-labeled goat anti-mouse or anti-rabbit immunoglobulin (Ig) (Amersham Co., Ltd., Tokyo, Japan) followed by reactions with the substrate of the enhanced chemiluminescence (ECL)-SuperSignal Western blotting system (Pierce, Rockford, IL) and exposed to x-ray film. The intensity of the spots was measured using Image Gauge Computer Software (Fujifilm Co., Tokyo, Japan).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Table 1
). This decreased value of SHP1 gene
expression (ratio: 0.0077) was highly significant, because the density
of SHP1 spots in fresh NK cells, which was very strong and clearly
higher than the background level, dropped down to almost the background
level in NK-YS cells. Similar results were obtained with another NK/T
lymphoma cell line (NK-TY2). The green spots in Figure 1
(d), (e), and
(h), which were indicated by arrows, showing that the significant
reduced expression of SHP1 gene in NK-TY2 cells compared with fresh NK
cells (d), PBMCs (e), and Jurkat cells (h). It is similar to the
results of green spots in Figure 1
(a), (b), and (g), showing the
reduction of SHP1 gene expression in NK-YS cells compared with fresh NK
cells (a), PBMCs (b), and Jurkat cells (g). On the other hand, SHP1
gene expression of fresh NK cells (c) and Jurkat cells (i) were
comparable to that of normal human PBMCs, showing yellow spots
indicated by arrows in Figure 1, c and i
. No significant expression of
SHP1 gene in NK-TY2 cells is comparable to that of SHP1 gene in NK-YS
cells, which was shown as a black spot in Figure 1f
indicated by an
arrow. This was confirmed by RT-PCR analysis: a clear band
corresponding to SHP1 mRNA was detected in the Jurkat, KCA, SP53,
BALL1, EDS, and ATL1K cell lines, as well as in normal human PBMCs and
fresh human NK cells. On the other hand, no SHP1 mRNA band was detected
in the NK-YS cell line, and only a faint band could be recognized in
the K562 cell line (Figure 2)
.
|
|
|
. All NK/T cell lymphoma specimens were
clearly negative for the expression of SHP1 protein. In reactive
lymphoid hyperplasia (RLH), nearly all mantle-zone B cells and a part
of interfollicular lymphoid cells expressed SHP1. In contrast, germinal
center cells were only faintly immunostained (Figure 3
, Table 2
). As for immunoreactivity with
malignant lymphomas, more than 95% of malignant lymphoma/leukemia
specimens, including those of diffuse large B cell lymphoma
(DLL), follicular lymphoma (FL), Hodgkin’s disease (HD), mantle cell
lymphoma (MCL), peripheral T cell lymphoma (PT), adult T cell
lymphoma/leukemia (ATLL) and plasmacytoma were negative in SHP1
immunohistochemistry. About 60% of marginal zone B cell lymphoma (MZL)
and MALToma specimens were also negative for SHP1 immunostaining. To
confirm these immunohistochemical data, SHP1 mRNA in situ
hybridization was performed, showing the same the results as the
immunohistochemistry. (Figure 3, e and f)
Epstein-Barr virus infections
were detected by in situ hybridization of EBER1 mRNA in
91.1% of NK/T cell lymphoma, 50.0% of Hodgkin’s disease,
18.2% of DLL and 7.7% of plasmacytoma specimens. These results were
further confirmed by standard full-tissue immunostaining. The tissue
microarray and standard immunostaining data are summarized in Table 2
.
|
|
. Like
NK-YS cells, another NK/T cell lymphoma cell line NK-TY2 also showed no
expression of SHP1 protein. SHP1 protein was not detected in ATLL tumor
cell lines: EDS and ATLIK cells. This finding was in obvious contrast
to the strong positive SHP1 protein band in the IWA1 cell line, which
was a virus producing cell line freshly immortalized in
vitro by co-cultivation with an HTLV-I producer cell line and
carrying the normal human karyotype. Cell lines of T cell chronic
lymphocytic leukemia (T-CLL) and Sézary syndrome (SS) were
negative for SHP1. Two-thirds of the cell lines of Hodgkin’s disease
and multiple myeloma and both of the two Burkitt’s lymphoma cell lines
were also negative for SHP1.
|
. Burkitt’s lymphoma cell
lines Daudi and Ramos could be induced SHP1 expression by TPA treatment
from no expression of SHP1 protein in the standard culture condition.
KG1 cells, which showed weak but stable expression of SHP1, were
strongly induced to express SHP1 by TPA. On the other hand, NK-YS,
NK-TY2, and K562 were completely negative for the SHP1 expression both
under the control culture and TPA stimulation condition. Normal human
PBMCs that were stimulated by TPA showed a transient increase in SHP1
protein expression followed by a decrease during cultivation. Mitogens
such as PHA-P or PWM also showed the same effect on PBMCs (data not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. In
addition, SHP1 immunohistochemical staining of several cases of
reactive lymphoid hyperplasia using tissue microarray and standard
tissue specimens revealed that most of the mantle zone and some
interfollicular zone lymphocytes in reactive lymphoid hyperplasia
showed strongly positive staining of SHP1 antigen, indicating that
resting B cells highly express SHP1 protein. This is in line with the
present result that freshly isolated resting PBMCs robustly express
SHP1. On the other hand, germinal center lymphocytes showed decreased
staining of SHP1, which may be characteristic for centroblast cells.
Western blotting using rabbit polyclonal anti- SHP1 antibody in Figure 4
, shows that polyclonal antibody also detected essentially the same
results of decreased expression of SHP1 protein in malignant
lymphoma/leukemia cells as the results obtained with D11 monoclonal
anti-SHP1 antibody. It clearly eliminates the possibility that the
failure to detect SHP-1 expression in the lymphomas/leukemias
represents augmented modification of C-terminal region of SHP1 and may
therefore mask the D11 monoclonal antibody epitope in these samples.
Those findings are consistent with the previous observation that SHP1
expression was down-regulated in Burkitt’s lymphomas and germinal
center B lymphocytes.20
As germinal center B cells have
developmentally regulated low thresholds for cellular activation, there
is a possibility that the observed low level or lack of SHP1 expression
in the malignant lymphomas/leukemias might have resulted from
physiological regulation associated with the immaturity of the
neoplastic cells. Another possibility is that the low level or lack of
SHP1 expression in malignant lymphomas/leukemias is associated with
tumorigenesis itself rather than the associated immature phenotype of
neoplastic cells. Present observation that a wide range of malignant
lymphomas/leukemias, including well differentiated tumors such as
plasmacytoma, consistently showed the decreased expression of SHP1 with
the clear contrast of high expression in normal reactive lymphocyte
hyperplasia, supports the latter possibility. However, it remains to be
elucidated with further experiments.
SHP1, which is also called HCP, SHPTP1, and PTP1C, is a 68-kd,
non-transmembrane protein-tyrosine phosphatase (PTP) containing two
tandem Src homology (SH2) domains, a catalytic domain, and a C-terminal
tail of about 100 amino acid residues. SHP1 is expressed primarily in
hematopoietic cells and usually functions as a negative regulator in
signal transduction. The consensus sequence (S/L/I/V)XYXX(L/V), based
on sequences originally deduced from several receptors known to bind to
the C-terminal SH2 domain of SHP1, defines all immuno-receptor
tyrosine-based inhibitory motifs (ITIMs), including NK cell, B cell,
and monocyte and dendritic cell inhibitory
receptors.21-24
SHP1 is known to associate with multiple
signaling molecules, including ZAP70,25
CD3
,25,26
CD526
and
interleukin-2R27
in T cells; interleukin-3 receptor ß
chain28,29
and erythropoietin receptor30
in
hematopoietic cells; CD22,31,32
B cell
receptor,33
SLP7634,35
and
CD7236,37
in B cells; and the killer cell inhibitory
receptor38,39
in natural killer cells. These interactions
appear to exert primarily inhibitory effects on their signaling
cascades. Motheaten mice (me/me) and viable motheaten mice
(mev/mev) are natural
genetic models of mammals lacking the expression of functional SHP1.
Motheaten mice display an increase in the phosphorylation state of Src
family protein tyrosine kinases on T cell receptor (TCR) stimulation in
T cells.40
Transducing polypeptides bearing immunoreceptor
tyrosine-based activation motifs (ITAMs) such as CD3 
and CD3, are
also hyperphosphorylated in motheaten mice. Similarly, the adapter
protein linker for activation of T cells (LAT) is hyperphosphorylated
in motheaten mice, and can be directly dephosphorylated by SHP-1
in vitro. This dephosphorylation induces the dissociation of
LAT and PLC
in NK cells in vivo.41
Besides,
the SLP-76 adapter protein is also a target of SHP1 in T and NK cells.
Moreover, SHP1 can dephosphorylate ZAP70 and Syk.42
All
this evidence suggests that, in T and NK cells, inhibitory killer cell
immunoglobulin (Ig)-like receptors (KIRs) recruit SHP1 which, in turn,
may dephosphorylate ITAM polypeptides, Src family kinases, ZAP-70/Syk,
and adapter proteins responsible for the recruitment of downstream
signaling molecules such as LAT and SLP76.43
Therefore,
SHP1 might be capable of terminating activating signals by
dephosphorylating molecules involved early in signal transduction.
These molecular events may cause motheaten phenotypes such as suffering
from chronic macrophage and neutrophil activation, abnormal B-cell
development, T- and B-cell depletion and dysfunction, and marked B cell
enhancement in the induction of proliferation, intracellular calcium
mobilization, and antigen activated protein kinase activation following
B cell receptor ligation.44,45
Present observation that
SHP1 expression in centroblast cells are down-regulated in the germinal
center of reactive lymphoid hyperplasia, are possibly reflecting a
requirement at this stage of B cells for a lower threshold for
signaling through certain cytokine receptors and membrane
immunoglobulin. Low SHP1 expression may facilitate the signal
transduction required for germinal center clonal expansion, isotype
switching, hypermutation, and selection for high affinity memory B
cells. SHP1 expression in freshly isolated normal PBMCs decreased
gradually in the standard culture condition and reached a steady low
state (Figure 5)
, suggesting that this behavior may be a physiological
response after removal of growth inhibitory soluble factors in the
serum and the expression of inhibitory signaling molecule: SHP1 was
down-regulated.
The present finding that a wide range of malignant lymphomas/leukemias, including NK/T cell lymphoma, diffuse large cell lymphoma (DLL), follicle center lymphoma (FL), Hodgkin’s disease (HD), mantle cell lymphoma (MCL), peripheral T cell lymphoma (PL), adult T cell lymphoma/leukemia (ATLL), and plasmacytoma showed a reduction in SHP1 protein expression in more than 93% of cases suggests that SHP1 plays an important role in the molecular pathogenesis of these lymphomas. In particular, such highly aggressive lymphomas as NK/T, ATLL, and Burkitt’s lymphoma were completely negative for SHP1 protein expression. On the other hand, low-grade malignant lymphomas such as MZL and MALToma showed a low percentage of negativity in SHP1 expression, suggesting that there is some correlation between loss of SHP1 expression and aggressiveness. As SHP1 is one of a key molecule in the hematopoietic cell signal transduction, genetic defects in functional domain of SHP1 gene or continuous suppression of SHP1 gene expression may cause a failure in termination of activating signals by dephosphorylating molecules early involved in signal transduction. This loss of SHP1 expression may have contributed to the abnormal cell growth and viability of these malignant cells as a result of abrogation of the inhibitory signaling function of SHP1 on both cell growth and apoptosis.46 These results coincide well with the previous observation that mice heterozygous for the me or mev mutations, which are loss of function mutations in the SHP1 gene, are unusually susceptible to B-cell lymphomas.47
Interestingly, freshly immortalized human T cell lines with HTLV-I:
IWA-I strongly expressed SHP1, which is in evident contrast to the lack
of SHP1 expression in ATLL tumor cell lines, EDS, and ATL1K, implying
that SHP1 may be related to the progression of malignant transformation
from the virus carrier state to the lymphoma/leukemia stage. EBV
infection had no correlation to the loss of SHP1 expression, judging
from the evidence that 96.2% of diffuse large lymphomas (DLL) were
negative for SHP1 protein immunostaining, whereas 18.2% of DLL carried
EBV. The observation that both terminally differentiated plasmacytoma
and immature type lymphoma showed negative expression of SHP1 indicates
that extinction of SHP1 protein in various types of lymphoma is
independent of the differentiation state. Evidence that both NK/T cell
lymphoma cell lines failed to induce SHP1 expression with TPA treatment
suggests that the regulatory region of the SHP1 gene, including the
enhancer and promoter region, may have genetic defects such as
mutation, deletion, or some kind of DNA modification. Genomic Southern
hybridization of the entire region of the SHP1 gene showed no gross
changes in NK/T cell lines (data not shown). This result indicates that
NK/T lymphoma cells may be carrying some minor, if any, genetic
changes, such as point mutations or small deletions, or some other
genetic modification in the SHP1 gene locus, such as methylation. The
percentage of SHP1 protein negative cell lines was lower than that of
lymphoma patient specimens (Table 2
and Figure 4
), suggesting that
suppression of SHP1 is more likely to be induced by genetic
modification such as methylation rather than genetic changes. Recently,
Zhang et al reported that lack of SHP1 expression in malignant T cell
lymphoma was induced by methylation of the SHP1 promoter
region.48
In the present cases of other malignant
lymphomas/leukemias it is possible that methylation of SHP1
promoter/enhancer region caused reduced or lack of SHP1 gene
expression, which should be elucidated by further analysis. This
evidence strongly suggests that the SHP1 gene plays an important role
in multistep tumorigenesis not only in NK/T cell lymphomas but also in
a wide range of lymphomas/leukemias and other hematopoietic
malignancies, possibly as an anti-oncogene molecule.
The large-scale cDNA microarray or DNA chip methods are tremendously powerful and promising for the systematic and comprehensive analysis of gene expression profiles of known and unknown genes, genetic linkage studies with single nucleotide polymorphism (SNP), mutation detection and analysis with oligo arrays, analysis of disease genes and so on, if the problem of high cost could be overcome. At this moment, combination of the low-cost middle-scale cDNA macroarray and tissue microarray is more realistic and also useful and informative. This strategy may have a great advantage especially in rapid and easy identification of the disease-responsible or closely related genes among known genes with quick screening of multiple genes and multiple tumor types in the same condition, thereby leading to a more unbiased reliable analysis. This strategy may be very useful for identification of genes from various types of diseases where a particular molecular alteration is very important.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by grant 12670161 from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
Accepted for publication July 12, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  W.-y. Au, D. D. Weisenburger, T. Intragumtornchai, S. Nakamura, W.-S. Kim, I. Sng, J. Vose, J. O. Armitage, R. Liang, and for the International Peripheral T-Cell Lymphoma P Clinical differences between nasal and extranasal natural killer/T-cell lymphoma: a study of 136 cases from the International Peripheral T-Cell Lymphoma Project Blood, April 23, 2009; 113(17): 3931 - 3937. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Nakase, J. Cheng, Q. Zhu, and W. A. Marasco Mechanisms of SHP-1 P2 promoter regulation in hematopoietic cells and its silencing in HTLV-1-transformed T cells J. Leukoc. Biol., January 1, 2009; 85(1): 165 - 174. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Simoneau, J. Boulanger, G. Coulombe, M.-A. Renaud, C. Duchesne, and N. Rivard Activation of Cdk2 Stimulates Proteasome-dependent Truncation of Tyrosine Phosphatase SHP-1 in Human Proliferating Intestinal Epithelial Cells J. Biol. Chem., September 12, 2008; 283(37): 25544 - 25556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. M. Amin and R. Lai Pathobiology of ALK+ anaplastic large-cell lymphoma Blood, October 1, 2007; 110(7): 2259 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cheng, A. R. Kydd, K. Nakase, K. M. Noonan, A. Murakami, H. Tao, M. Dwyer, C. Xu, Q. Zhu, and W. A. Marasco Negative regulation of the SH2-homology containing protein-tyrosine phosphatase-1 (SHP-1) P2 promoter by the HTLV-1 Tax oncoprotein Blood, September 15, 2007; 110(6): 2110 - 2120. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Han, H. M. Amin, B. Franko, C. Frantz, X. Shi, and R. Lai Loss of SHP1 enhances JAK3/STAT3 signaling and decreases proteosome degradation of JAK3 and NPM-ALK in ALK+ anaplastic large-cell lymphoma Blood, October 15, 2006; 108(8): 2796 - 2803. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Wang, Z. Li, R. Ding, G. D. Frank, T. Senbonmatsu, E. J. Landon, T. Inagami, and Z. J. Zhao Antagonism or Synergism: ROLE OF TYROSINE PHOSPHATASES SHP-1 AND SHP-2 IN GROWTH FACTOR SIGNALING J. Biol. Chem., August 4, 2006; 281(31): 21878 - 21883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-F. Honorat, A. Ragab, L. Lamant, G. Delsol, and J. Ragab-Thomas SHP1 tyrosine phosphatase negatively regulates NPM-ALK tyrosine kinase signaling Blood, May 15, 2006; 107(10): 4130 - 4138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Chen, M. Levis, P. Brown, K.-T. Kim, J. Allebach, and D. Small FLT3/ITD Mutation Signaling Includes Suppression of SHP-1 J. Biol. Chem., February 18, 2005; 280(7): 5361 - 5369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Ebert and T. R. Golub Genomic approaches to hematologic malignancies Blood, August 15, 2004; 104(4): 923 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Guiter, I. Dusanter-Fourt, C. Copie-Bergman, M.-L. Boulland, S. le Gouvello, P. Gaulard, K. Leroy, and F. Castellano Constitutive STAT6 activation in primary mediastinal large B-cell lymphoma Blood, July 15, 2004; 104(2): 543 - 549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Oka, M. Ouchida, M. Koyama, Y. Ogama, S. Takada, Y. Nakatani, T. Tanaka, T. Yoshino, K. Hayashi, N. Ohara, et al. Gene Silencing of the Tyrosine Phosphatase SHP1 Gene by Aberrant Methylation in Leukemias/Lymphomas Cancer Res., November 15, 2002; 62(22): 6390 - 6394. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, TPA-treated; 
, control culture.