(American Journal of Pathology. 2001;159:1495-1505.)
© 2001 American Society for Investigative Pathology
Reduction of Hematopoietic Cell-Specific Tyrosine Phosphatase SHP-1 Gene Expression in Natural Killer Cell Lymphoma and Various Types of Lymphomas/Leukemias
Combination Analysis with cDNA Expression Array and Tissue Microarray
Takashi Oka*,
Tadashi Yoshino*,
Kazuhiko Hayashi*,
Nobuya Ohara*,
Tohru Nakanishi
,
Yuichiro Yamaai
,
Akio Hiraki
,
Chiharu Aoki Sogawa¶,
Eisaku Kondo*,
Norihiro Teramoto*,
Kiyoshi Takahashi*,
Junjiro Tsuchiyama|| and
Tadaatsu Akagi*
From the Department of Pathology,*
the Department of
Biochemistry,
the Department of
Anatomy
, the Department of Internal
Medicine,
and the Department of Dental
Pharmacology,¶
Okayama University Graduate School
of Medicine and Dentistry, Okayama; and the First Department of
Medicine,||
Niigata University, School of Medicine,
Niigata, Japan
 |
Abstract
|
|---|
To investigate the lymphomagenesis of NK/T lymphoma, we
comprehensively and systematically analyzed the expression pattern of
the human NK/T cell line (NK-YS) genome by cDNA expression array and
tissue microarray. We detected significant changes in the gene
expression of NK-YS cell line: an increase in 18 and a decrease in 20
genes compared to normal NK cells or peripheral blood mononuclear
cells. Among these genes, we found a strong decrease in
hematopoietic cell specific protein-tyrosine-phosphatase SH-PTP1 (SHP1)
mRNA by cDNA expression array and reverse transcriptase-polymerase
chain reaction. Further analysis with standard immunohistochemistry and
tissue microarray, which used 207 paraffin-embedded specimens
of various kinds of malignant lymphomas, showed that 100% of
NK/T lymphoma specimens and more than 95% of various types of
malignant lymphoma were negative for SHP1 protein expression. On the
other hand, SHP1 protein was strongly expressed in the mantle
zone and interfollicular zone lymphocytes in reactive lymphoid
hyperplasia specimens. In addition, various kinds of
hematopoietic cell lines, particularly the highly aggressive
lymphoma/leukemia lines, lacked SHP1 expression in
vitro, suggesting that loss of SHP1 expression may be
related to not only malignant transformation, but also tumor
cell aggressiveness. SHP1 expression could not be induced in either of
two NK/T cell lines by phorbol ester, suggesting that genetic
impairment or modification with methylation of SHP1 DNA could be one of
the critical events in the pathogenesis of NK/T lymphoma. This evidence
strongly suggests that loss of SHP1 gene expression plays an important
role in multistep tumorigenesis, possibly as an anti-oncogene
in the wide range of lymphomas/leukemias as well as NK/T
lymphomas.
 |
Introduction
|
|---|
Nasal/nasopharyngeal NK/T cell
lymphoma, currently referred to as an angiocentric lymphoma in the REAL
classification,1
is now recognized as a distinctive
clinicopathological entity. Frequent cases of this lymphoma have been
reported in Asian and South American countries; these were
characterized as polymorphous pleomorphic morphologies with azurophilic
granules, the immunophenotypic profile of CD2+,
CD3-, CD56+, lack of
rearranged T cell receptor genes, and association with the Epstein-Barr
virus (EBV).2
These tumors are regarded as one of the most
aggressive lymphoma types currently known because of their strong
resistance against third generation combination chemotherapy and their
rapid, unfavorable clinical course. As a consequence of their genetic
instability or spontaneous mutation, malignant cells accumulate an
increasing number of genetic aberrations during the course of tumor
progression, such as chromosomal rearrangements, deletions of
anti-oncogenes, amplification or activation of oncogenes and various
epigenetic changes, that result in altered gene expression. Somatic
mutations of the genes for the variable region genes of B- and
T-lymphocyte antigens have been shown to be a hallmark of lymphomas and
leukemia, including germinal center B cells and their descendants. For
several types of B-cell lymphomas, chromosomal translocations into
immunoglobulin heavy chain switch regions have been described, such as
translocation of c-myc in Burkitts
lymphomas,3
Bcl-6 in diffuse large cell
lymphomas,4
Bcl-2 in follicular lymphomas,5
Bcl-1 in mantle-zone lymphomas,6
and fibroblast growth
factor receptor-3 in multiple myeloma.7
Such kinds of
conserved genetic changes for these own lineage have been revealed,
however universally conserved genetic changes and gene expression
alterations on malignant lymphoma/leukemia have not been identified
yet.
Completion of the genome sequences of model organisms and humans will
provide us with complete blueprints of these genomes. The study of gene
expression on a genomic scale is the most obvious opportunity made
possible by complete genome sequences, and the most experimentally
straightforward. cDNA microarrays make it easy to measure the
transcripts for every gene at once.8-11
Due to the tight
connection between the function of a gene product and its expression
pattern, each gene is expressed in specific cells and under specific
conditions. Promoters of genes function as transducers, responding to
input information about the identities, environment, and internal state
of a cell by changing the level of transcription of specific genes. The
group of genes expressed in a cell determines what the cell is made of,
what biochemical and regulatory systems are operative, how the cell is
built, and what it can and cannot do. Many genes and signal
transduction pathways that control cellular proliferation,
differentiation and programmed cell death, as well as genomic
integrity, are also involved in cancer development. cDNA microarrays
have enabled measurement of the expression of thousands of genes in a
single experiment for the systematic and comprehensive exploration of
genome-wide alterations in cancer cells.8-10
Recently,
distinct types of diffuse large B cell lymphoma (DLL), which show
markedly different clinical courses and treatment responses apparently
reflecting the variation in tumor proliferation rate, host response,
and differentiation state of tumor, have been identified and diagnosed
by gene expression profiling with cDNA microarrays.10
However, analysis of hundreds of specimens from patients from different
stages is essential to establish the diagnostic, prognostic, and
therapeutic importance of each of the many oncogene or anti-oncogene
candidates. To overcome this difficulty, an array-based high-throughput
tissue microarray technique has been established to facilitate analysis
of gene expression and DNA copy number of large numbers of
tumors.12-14
We developed this technique independently,
modified it, and here apply the modified method to lymphoma analysis in
combination with a cDNA expression array.
In the present investigation, we analyzed the expression profiles of
human NK cell lines compared to normal NK cells or peripheral blood
mononuclear cells (PBMCs) to elucidate the mechanism of NK/T
lymphomagenesis. We found strong suppression of SHP1 gene expression in
the various types of lymphomas/leukemias as well as in NK/T cell
lymphomas, suggesting that SHP1 is one of the key molecules for the
malignant transformation of lymphomas/leukemias.
 |
Materials and Methods
|
|---|
Cell Culture
Human NK cell lines, NK-YS15
and NK-TY2 (in
preparation for publication), were maintained in Iscoves modified
Dulbeccos medium (IMDM; GIBCO, Grand Island, NY) supplemented with
10% fetal calf serum [(FCS) Sankou Junyaku, Chiba, Japan],
100 U/ml recombinant human interlekin-2 (Strathman Biotech GMBH,
Hannover, Germany), 100 U/ml kanamycin (Meiji, Tokyo, Japan), and 100
µg/ml streptomycin (LIFE Technologies, Rockville, MD). Other cell
lines were maintained in RPMI-1640 supplemented with 10% FCS, 100 U/ml
of kanamycin, and 100 µg/ml streptomycin. PBMCs were isolated by the
Ficoll-Hypaque method from healthy volunteer blood donors. Fresh normal
NK cell fraction was further purified by the magnetic beads method with
anti-CD56 monoclonal antibody (PerSeptive Biosystems, Tokyo, Japan).
The purity of this NK cell-enriched fraction was about 60% to 70%.
PBMCs were incubated in RPMI 1640 containing 10% FCS with or without
0.1% pokeweed mitogen (PWM) (GIBCO BRL, Rockville, MD) or 5 µg/ml
phytohemagglutinin-P (PHA-P) (Sigma, St. Louis, MO) for 72 hours at
37°C in a CO2 incubator and used as the source
of lymphoblasts. Cells were also treated with 20 ng/ml PMA (TPA;
phorbol ester; Sigma, St. Louis, MO) for 72 hours at 37°C in a
CO2 incubator. The KCA cell line was obtained
from Dr. E.C. Butcher (Department of Pathology, Stanford University,
Stanford, CA). HairM, MOLP2, L428, SKW3, SU-DHL4, RPMI8226, HDLM2, EDS,
and HUT102 were from Dr. Y. Matsuo (Fujisaki Cell Center, Hayashibara
Biomedical Laboratories, Okayama, Japan).
cDNA Expression Array Analysis
Total RNA of freshly isolated PBMCs from two healthy volunteers
were mixed and used as a pooled reference RNA. Each RNA, extracted from
NK/T cell lines (NK-YS, NK-TY2), Jurkat cells, purified fresh normal NK
cells, or fresh normal PBMCs was 32P-labeled and
used to synthesize probes using the Atlas Pure Total RNA Labeling
System (K10381; Clontech Laboratories Inc., Palo Alto, CA).
Hybridization of the ATLAS Human Cancer 1.2 Array (Clontech
Laboratories, Inc., Palo Alto, CA) was performed according to the
instruction manual. The results were analyzed on a Fujifilm BAS3000
system using Array Gauge Computer software (Fujifilm Co., Tokyo,
Japan). After normalization of the total amounts of gene expression,
gene expressions were compared among the NK-YS, NK-TY2, Jurkat cell
lines, normal PBMCs, and fresh normal human NK cells.
Analysis of mRNA Expression by RT-PCR
A 2 µg aliquot of DNase-I treated total cellular RNA was
reverse-transcribed with SuperScript II reverse transcriptase (Life
Technologies, Rockville, MD) in 20 µl of 20 mmol/L Tris-HCl (pH 8.3)
containing 50 mmol/L KCl, 1.25 mmol/L MgCl2, 5
mmol/L dithiothreitol, 500 µmol/L dNTP, and 1 µmol/L
oligo(dT)1218 primer. The reaction proceeded at
42°C for 50 minutes and was terminated at 70°C for 15 minutes
followed by treatment of RNase H at 37°C for 20 minutes. Portions
(0.5 µl) of single-stranded cDNA were amplified by polymerase chain
reaction (PCR) using SHP1 specific primer pairs, the sequences of which
were obtained from Clontech Laboratories, Inc. The PCR reaction was
performed using Platinum PCR Super Mix (Life Technologies, Rockville,
MD). The amplification condition consisted of 2 minutes of pretreatment
at 94°C, followed by 30 cycles of denaturation (94°C, 30 seconds),
annealing (59°C, 30 seconds), and extension (72°C, 1 minute 30
seconds) and treatment (72°C, 10 minutes).
Tissue Microarray Analysis
We developed independently and modified the method to make tissue
microarray without film, which is used in the original method to
prevent peel-off of the mounted microtissue specimen.12
We
overcame this difficulty with the fine adjustment of the donor punched
out block to recipient pored block. It can be treated as if it is one
standard paraffin block. A total of 207 paraffin embedded tissue
samples consisting 197 cases of primary malignant lymphomas of 22
different histological categories and 10 cases of normal reactive
lymphoid hyperplasia (RLH) samples were used for the malignant lymphoma
tissue microarray. Core tissue biopsies (diameter, 0.8 mm) were taken
from selected regions of individual paraffin-embedded malignant
lymphoma specimens (donor block) and precisely arrayed into a new
recipient paraffin block (50 mm x 23 mm) using a custom-built
instrument. After the block construction was completed, 5 µm sections
of the resulting malignant lymphoma tissue microarray block were cut
with a microtome. These specimens were used for hematoxylin-eosin
staining, immunostaining, and in situ hybridization.
In Situ Hybridization
EBV-encoded small RNA-1 (EBER1) expression was detected by RNA
in situ hybridization using a single-stranded 30-base
FITC-labeled oligonucleotide complementary (antisense probe) or
anticomplementary (sense; negative control probe) to a portion of the
EBER1 gene. The sequence of the anti-sense probe was
5'AGACACCGTCCTCACCACCCGGGACTTGTA3'.16
The in
situ hybridization was performed on routinely processed sections
of the paraffin-embedded tumor tissues or tissue microarray using a
DAKO in situ hybridization kit (DAKO Japan, Kyoto, Japan) as
described previously.17
Briefly, after proteinase K
digestion, the sections were post-fixed with 4% paraformaldehyde and
acetylated with triethanolamine and acetic anhydride to reduce
nonspecific electrostatic hybridization. The hybridization was carried
out at 37°C overnight. The substrate reaction was developed using an
in situ detection kit (DAKO, K046) according to the
manufacturers instructions. Paraffin-embedded pellets of an
EBV-infected cell line (B958) and EBV-positive non-Hodgkins
lymphoma tissues were used as the positive controls. Pellets of an
non-EBV-infected T cell line (Jurkat) and reactive-non-neoplastic lymph
nodes served as the negative controls. For the analysis of SHP1 mRNA
in situ hybridization, we used digoxygenin-labeled sense and
antisense SHP1 riboprobes, which were synthesized with T7 RNA
polymerase using a labeling kit (Boehringer, Germany), and were
hybridized without alkaline hydrolysis. In situ
hybridization was performed at 50°C according to the method by Meyer
et al.18
Western Blot Analysis
Western blot analysis was performed according to the method of
Towbin et al.19
After 12.5% polyacrylamide gel
electrophoresis of cellular protein lysate from 7.5 x
104
cells of each culture, banded proteins were
electrophoretically transferred to polyvinylidene difluoride membrane
(Immobilon; Millipore, Ltd., Bedford, MA) and then reacted with the
antibody to SH-PTP1 (D11; mouse monoclonal antibody against the
C-terminal of SHP1, C-19; rabbit polyclonal antibody against whole SHP1
protein, Santa Cruz Biotechnology Inc., Santa Cruz, CA) and monoclonal
anti-ß-actin (Sigma, St. Louis, MO). The immunoreactive bands were
visualized with peroxidase-labeled goat anti-mouse or anti-rabbit
immunoglobulin (Ig) (Amersham Co., Ltd., Tokyo, Japan) followed by
reactions with the substrate of the enhanced chemiluminescence
(ECL)-SuperSignal Western blotting system (Pierce, Rockford, IL) and
exposed to x-ray film. The intensity of the spots was measured using
Image Gauge Computer Software (Fujifilm Co., Tokyo, Japan).
 |
Results
|
|---|
To investigate the molecular pathological mechanism of NK/T cell
lymphoma, we comprehensively and systematically analyzed the expression
profile of the human NK/T cell lines (NK-YS and NK-TY2) genome by means
of a cDNA expression array (ATLAS Human Cancer 1.2 Array containing
1176 genes). The resulting profiles were compared to those of Jurkat
cells, fresh human peripheral blood mononuclear cells (PBMCs), and
fresh NK cells, which were enriched by the magnetic beads method using
anti-CD56 antibody from PBMCs. We detected increased expression of CD56
in purified normal NK cells compared to PBMCs in cDNA expression array,
indicating that cDNA expression array is working well and also
purification of normal NK cell is successful. We detected significant
changes in the gene expression of the NK-YS cell line: an increase in
18 genes and a decrease in 20 genes compared to normal NK cells. These
genes were included transcription factors, membrane-bound surface
molecules or receptors and signal transducer proteins. Among 18 genes,
which showed increasing expression in NK-YS cell line compared with
normal NK cells, the expression of thirteen genes significantly
increased in NK-YS cells than that in normal NK cells. However, no
difference was detected in the gene expression level of these thirteen
genes between NK-YS cells and PBMCs. The expression of five genes among
these 18 genes increased in NK-YS cells compared with that in normal NK
cells and PBMCs. Among 20 genes which showed reducing expression in
NK-YS cells with the control of normal NK cells, the expression of four
genes were significantly reduced in NK-YS cells than that in normal NK
cells. On the other hand, a large difference was not detected in the
expression of these four genes between NK-YS cells and PBMCs. The
expression of 16 genes among these 20 genes were reduced in NK-YS cells
compared with that in normal NK cells and PBMCs. Only SH-PTP1 (SHP1)
gene among various kinds of phosphatase genes, decreased dramatically
in NK-YS cells of which expression was less than one-hundredth of that
in normal NK cells (Figure 1
and Table 1
). This decreased value of SHP1 gene
expression (ratio: 0.0077) was highly significant, because the density
of SHP1 spots in fresh NK cells, which was very strong and clearly
higher than the background level, dropped down to almost the background
level in NK-YS cells. Similar results were obtained with another NK/T
lymphoma cell line (NK-TY2). The green spots in Figure 1
(d), (e), and
(h), which were indicated by arrows, showing that the significant
reduced expression of SHP1 gene in NK-TY2 cells compared with fresh NK
cells (d), PBMCs (e), and Jurkat cells (h). It is similar to the
results of green spots in Figure 1
(a), (b), and (g), showing the
reduction of SHP1 gene expression in NK-YS cells compared with fresh NK
cells (a), PBMCs (b), and Jurkat cells (g). On the other hand, SHP1
gene expression of fresh NK cells (c) and Jurkat cells (i) were
comparable to that of normal human PBMCs, showing yellow spots
indicated by arrows in Figure 1, c and i
. No significant expression of
SHP1 gene in NK-TY2 cells is comparable to that of SHP1 gene in NK-YS
cells, which was shown as a black spot in Figure 1f
indicated by an
arrow. This was confirmed by RT-PCR analysis: a clear band
corresponding to SHP1 mRNA was detected in the Jurkat, KCA, SP53,
BALL1, EDS, and ATL1K cell lines, as well as in normal human PBMCs and
fresh human NK cells. On the other hand, no SHP1 mRNA band was detected
in the NK-YS cell line, and only a faint band could be recognized in
the K562 cell line (Figure 2)
.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 1. cDNA expression array analysis of NK-YS, NK-TY2, Jurkat, freshly
isolated human PBMCs, and human NK cells. Expression profile of NK-YS
cells compared to that of fresh normal human NK cells
(a), normal
human PBMCs
(b), and
Jurkat cells
(g). cDNA
expression array profile of NK-TY2 were shown as the control of fresh
normal human NK cells
(d), PBMCs
(e) NK-YS
cells (f), and
Jurkat cells
(h).
Expression profile of fresh NK cells compared to that of normal human
PBMCs (c).
Expression profile of Jurkat cells was shown as the control of PBMCs
(i).
Arrows indicate the green spots in a,
b, and g, showing that SHP1 gene expression of
NK-YS cells decreased compared with fresh NK cells
(a), PBMCs
(b), and
Jurkat cells
(g).
Arrows indicate green spots in d, e,
and h showing the reduced expression of SHP1 gene in NK-TY2
cells compared with fresh NK cells
(d), PBMCs
(e), and
Jurkat cells
(h). Yellow
spots indicated by arrows in c and i,
showing that SHP1 gene expression of fresh NK cells
(c) and Jurkat
cells (i) were
comparable to that of normal human PBMCs. Black spot in f
indicated by an arrow, shows that no expression of SHP1 gene
in NK-TY2 cells is comparable to no expression of SHP1 gene in NK-YS
cells.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Comparison of Phosphatase Gene Expression between NK-YS and Normal
Fresh NK Cells Revealed by cDNA Macroarray
|
|

View larger version (52K):
[in this window]
[in a new window]
|
Figure 2. RT-PCR analysis of SHP1 gene in hematopoietic cells. cDNAs of SHP1 and
ß-actin in freshly isolated human NK cells and PBMCs in addition to
several cell lines were amplified by hot start RT-PCR, then separated
by 1.2% agarose gel electrophoresis. NC indicates the controls, which
did not contain cDNA.
|
|
To clarify whether the decreased mRNA expression of SHP1 in NK/T
cell lymphoma cell lines in vitro is also observed in NK/T
cell lymphoma patient specimens and to determine whether this
phenomenon is specific to NK/T cell lymphoma or common among various
types of lymphomas, we analyzed the protein expression of SHP1 in about
200 lymphoma specimens using the tissue microarray method (Figure 3)
. All NK/T cell lymphoma specimens were
clearly negative for the expression of SHP1 protein. In reactive
lymphoid hyperplasia (RLH), nearly all mantle-zone B cells and a part
of interfollicular lymphoid cells expressed SHP1. In contrast, germinal
center cells were only faintly immunostained (Figure 3
, Table 2
). As for immunoreactivity with
malignant lymphomas, more than 95% of malignant lymphoma/leukemia
specimens, including those of diffuse large B cell lymphoma
(DLL), follicular lymphoma (FL), Hodgkins disease (HD), mantle cell
lymphoma (MCL), peripheral T cell lymphoma (PT), adult T cell
lymphoma/leukemia (ATLL) and plasmacytoma were negative in SHP1
immunohistochemistry. About 60% of marginal zone B cell lymphoma (MZL)
and MALToma specimens were also negative for SHP1 immunostaining. To
confirm these immunohistochemical data, SHP1 mRNA in situ
hybridization was performed, showing the same the results as the
immunohistochemistry. (Figure 3, e and f)
Epstein-Barr virus infections
were detected by in situ hybridization of EBER1 mRNA in
91.1% of NK/T cell lymphoma, 50.0% of Hodgkins disease,
18.2% of DLL and 7.7% of plasmacytoma specimens. These results were
further confirmed by standard full-tissue immunostaining. The tissue
microarray and standard immunostaining data are summarized in Table 2
.

View larger version (96K):
[in this window]
[in a new window]
|
Figure 3. Tissue microarray analysis of SHP1 immunostaining and SHP1 mRNA
in situ hybridization. A: Hematoxylin-eosin
(HE) staining and EBER1
mRNA in situ hybridization. An overview of a tissue
microarray section containing 207 tissue samples
(a); HE
staining of tissue microarray in higher magnification
(b, c); EBER1
mRNA in situ hybridization showing positive
(left) and negative
(right) reaction
(d); higher
magnification of EBER1-positive sample
(e).
B: Immunohistochemistry of SHP1 protein, showing reactive
lymphocyte hyperplasia
(RLH)
(a); NK/T cell
lymphoma (b);
Hodgkins disease
(c) and mantle
cell lymphoma
(d). SHP1 gene
mRNA in situ hybridization of reactive lymphocyte
hyperplasia
(e) and NK/T
lymphoma
(f).
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Expression of SHP1 Protein and EBER1 mRNA in Various Malignant
Lymphomas Analyzed by Tissue Microarray and Standard
Immunohistochemistry
|
|
We next investigated the expression of SHP1 protein in various types of
hematopoietic cell lines by Western blotting using both monoclonal and
polyclonal antibodies (Figure 4)
. Like
NK-YS cells, another NK/T cell lymphoma cell line NK-TY2 also showed no
expression of SHP1 protein. SHP1 protein was not detected in ATLL tumor
cell lines: EDS and ATLIK cells. This finding was in obvious contrast
to the strong positive SHP1 protein band in the IWA1 cell line, which
was a virus producing cell line freshly immortalized in
vitro by co-cultivation with an HTLV-I producer cell line and
carrying the normal human karyotype. Cell lines of T cell chronic
lymphocytic leukemia (T-CLL) and Sézary syndrome (SS) were
negative for SHP1. Two-thirds of the cell lines of Hodgkins disease
and multiple myeloma and both of the two Burkitts lymphoma cell lines
were also negative for SHP1.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 4. Western blot analysis of SHP1 protein expression in various
hematopoietic cell lines. Cell lysates, which were extracted from the
105
cells in the standard culture condition, were loaded to
the SDS-PAGE and blotted membranes were probed with anti-SHP1
(D11; mouse monoclonal antibody against
C-terminal of SHP1, C19; rabbit polyclonal against whole
SHP1)or anti-ß actin antibodies. Results of
Western blotting of SHP1 protein were summarized in the Table
of this
figure. The strength of the SHP1 bands was indicated according
to the intensity from +++, ++ to +. -: completely negative for SHP1
band.
|
|
To investigate whether there exists a genetic disorder or modification
that related to lack of expression of SHP1 protein in NK/T cell lines,
we examined the ability to induce SHP1 expression by TPA treatment
(Figure 5)
. Burkitts lymphoma cell
lines Daudi and Ramos could be induced SHP1 expression by TPA treatment
from no expression of SHP1 protein in the standard culture condition.
KG1 cells, which showed weak but stable expression of SHP1, were
strongly induced to express SHP1 by TPA. On the other hand, NK-YS,
NK-TY2, and K562 were completely negative for the SHP1 expression both
under the control culture and TPA stimulation condition. Normal human
PBMCs that were stimulated by TPA showed a transient increase in SHP1
protein expression followed by a decrease during cultivation. Mitogens
such as PHA-P or PWM also showed the same effect on PBMCs (data not
shown).
 |
Discussion
|
|---|
We previously established the first cell line of NK cell lymphoma
cells, NK-YS, from a typical case of EBV-associated nasal angiocentric
NK cell leukemia/lymphoma.15
In the present investigation
we analyzed the genes involved in NK cell lymphomagenesis. We detected
several specific gene expression changes in NK-YS and NK-TY2 cells
compared with normal PBMCs, normal human NK cells, or Jurkat cells
using the cDNA expression array method. Among these genes, we found a
strong decrease in hematopoietic cell specific protein tyrosine
phosphatase SH-PTP1(SHP1) mRNA by cDNA-expression array and RT-PCR.
Among various kinds of phosphatase genes, only SHP1 gene exhibited
prominent and specific decrease of mRNA expression (Table 1)
. In
addition, SHP1 immunohistochemical staining of several cases of
reactive lymphoid hyperplasia using tissue microarray and standard
tissue specimens revealed that most of the mantle zone and some
interfollicular zone lymphocytes in reactive lymphoid hyperplasia
showed strongly positive staining of SHP1 antigen, indicating that
resting B cells highly express SHP1 protein. This is in line with the
present result that freshly isolated resting PBMCs robustly express
SHP1. On the other hand, germinal center lymphocytes showed decreased
staining of SHP1, which may be characteristic for centroblast cells.
Western blotting using rabbit polyclonal anti- SHP1 antibody in Figure 4
, shows that polyclonal antibody also detected essentially the same
results of decreased expression of SHP1 protein in malignant
lymphoma/leukemia cells as the results obtained with D11 monoclonal
anti-SHP1 antibody. It clearly eliminates the possibility that the
failure to detect SHP-1 expression in the lymphomas/leukemias
represents augmented modification of C-terminal region of SHP1 and may
therefore mask the D11 monoclonal antibody epitope in these samples.
Those findings are consistent with the previous observation that SHP1
expression was down-regulated in Burkitts lymphomas and germinal
center B lymphocytes.20
As germinal center B cells have
developmentally regulated low thresholds for cellular activation, there
is a possibility that the observed low level or lack of SHP1 expression
in the malignant lymphomas/leukemias might have resulted from
physiological regulation associated with the immaturity of the
neoplastic cells. Another possibility is that the low level or lack of
SHP1 expression in malignant lymphomas/leukemias is associated with
tumorigenesis itself rather than the associated immature phenotype of
neoplastic cells. Present observation that a wide range of malignant
lymphomas/leukemias, including well differentiated tumors such as
plasmacytoma, consistently showed the decreased expression of SHP1 with
the clear contrast of high expression in normal reactive lymphocyte
hyperplasia, supports the latter possibility. However, it remains to be
elucidated with further experiments.
SHP1, which is also called HCP, SHPTP1, and PTP1C, is a 68-kd,
non-transmembrane protein-tyrosine phosphatase (PTP) containing two
tandem Src homology (SH2) domains, a catalytic domain, and a C-terminal
tail of about 100 amino acid residues. SHP1 is expressed primarily in
hematopoietic cells and usually functions as a negative regulator in
signal transduction. The consensus sequence (S/L/I/V)XYXX(L/V), based
on sequences originally deduced from several receptors known to bind to
the C-terminal SH2 domain of SHP1, defines all immuno-receptor
tyrosine-based inhibitory motifs (ITIMs), including NK cell, B cell,
and monocyte and dendritic cell inhibitory
receptors.21-24
SHP1 is known to associate with multiple
signaling molecules, including ZAP70,25
CD3
,25,26
CD526
and
interleukin-2R27
in T cells; interleukin-3 receptor ß
chain28,29
and erythropoietin receptor30
in
hematopoietic cells; CD22,31,32
B cell
receptor,33
SLP7634,35
and
CD7236,37
in B cells; and the killer cell inhibitory
receptor38,39
in natural killer cells. These interactions
appear to exert primarily inhibitory effects on their signaling
cascades. Motheaten mice (me/me) and viable motheaten mice
(mev/mev) are natural
genetic models of mammals lacking the expression of functional SHP1.
Motheaten mice display an increase in the phosphorylation state of Src
family protein tyrosine kinases on T cell receptor (TCR) stimulation in
T cells.40
Transducing polypeptides bearing immunoreceptor
tyrosine-based activation motifs (ITAMs) such as CD3
and CD3, are
also hyperphosphorylated in motheaten mice. Similarly, the adapter
protein linker for activation of T cells (LAT) is hyperphosphorylated
in motheaten mice, and can be directly dephosphorylated by SHP-1
in vitro. This dephosphorylation induces the dissociation of
LAT and PLC
in NK cells in vivo.41
Besides,
the SLP-76 adapter protein is also a target of SHP1 in T and NK cells.
Moreover, SHP1 can dephosphorylate ZAP70 and Syk.42
All
this evidence suggests that, in T and NK cells, inhibitory killer cell
immunoglobulin (Ig)-like receptors (KIRs) recruit SHP1 which, in turn,
may dephosphorylate ITAM polypeptides, Src family kinases, ZAP-70/Syk,
and adapter proteins responsible for the recruitment of downstream
signaling molecules such as LAT and SLP76.43
Therefore,
SHP1 might be capable of terminating activating signals by
dephosphorylating molecules involved early in signal transduction.
These molecular events may cause motheaten phenotypes such as suffering
from chronic macrophage and neutrophil activation, abnormal B-cell
development, T- and B-cell depletion and dysfunction, and marked B cell
enhancement in the induction of proliferation, intracellular calcium
mobilization, and antigen activated protein kinase activation following
B cell receptor ligation.44,45
Present observation that
SHP1 expression in centroblast cells are down-regulated in the germinal
center of reactive lymphoid hyperplasia, are possibly reflecting a
requirement at this stage of B cells for a lower threshold for
signaling through certain cytokine receptors and membrane
immunoglobulin. Low SHP1 expression may facilitate the signal
transduction required for germinal center clonal expansion, isotype
switching, hypermutation, and selection for high affinity memory B
cells. SHP1 expression in freshly isolated normal PBMCs decreased
gradually in the standard culture condition and reached a steady low
state (Figure 5)
, suggesting that this behavior may be a physiological
response after removal of growth inhibitory soluble factors in the
serum and the expression of inhibitory signaling molecule: SHP1 was
down-regulated.
The present finding that a wide range of malignant lymphomas/leukemias,
including NK/T cell lymphoma, diffuse large cell lymphoma (DLL),
follicle center lymphoma (FL), Hodgkins disease (HD), mantle cell
lymphoma (MCL), peripheral T cell lymphoma (PL), adult T cell
lymphoma/leukemia (ATLL), and plasmacytoma showed a reduction in SHP1
protein expression in more than 93% of cases suggests that SHP1 plays
an important role in the molecular pathogenesis of these lymphomas. In
particular, such highly aggressive lymphomas as NK/T, ATLL, and
Burkitts lymphoma were completely negative for SHP1 protein
expression. On the other hand, low-grade malignant lymphomas such as
MZL and MALToma showed a low percentage of negativity in SHP1
expression, suggesting that there is some correlation between loss of
SHP1 expression and aggressiveness. As SHP1 is one of a key molecule in
the hematopoietic cell signal transduction, genetic defects in
functional domain of SHP1 gene or continuous suppression of SHP1 gene
expression may cause a failure in termination of activating signals by
dephosphorylating molecules early involved in signal transduction. This
loss of SHP1 expression may have contributed to the abnormal cell
growth and viability of these malignant cells as a result of abrogation
of the inhibitory signaling function of SHP1 on both cell growth and
apoptosis.46
These results coincide well with the previous
observation that mice heterozygous for the me or
mev mutations, which are loss of function
mutations in the SHP1 gene, are unusually susceptible to B-cell
lymphomas.47
Interestingly, freshly immortalized human T cell lines with HTLV-I:
IWA-I strongly expressed SHP1, which is in evident contrast to the lack
of SHP1 expression in ATLL tumor cell lines, EDS, and ATL1K, implying
that SHP1 may be related to the progression of malignant transformation
from the virus carrier state to the lymphoma/leukemia stage. EBV
infection had no correlation to the loss of SHP1 expression, judging
from the evidence that 96.2% of diffuse large lymphomas (DLL) were
negative for SHP1 protein immunostaining, whereas 18.2% of DLL carried
EBV. The observation that both terminally differentiated plasmacytoma
and immature type lymphoma showed negative expression of SHP1 indicates
that extinction of SHP1 protein in various types of lymphoma is
independent of the differentiation state. Evidence that both NK/T cell
lymphoma cell lines failed to induce SHP1 expression with TPA treatment
suggests that the regulatory region of the SHP1 gene, including the
enhancer and promoter region, may have genetic defects such as
mutation, deletion, or some kind of DNA modification. Genomic Southern
hybridization of the entire region of the SHP1 gene showed no gross
changes in NK/T cell lines (data not shown). This result indicates that
NK/T lymphoma cells may be carrying some minor, if any, genetic
changes, such as point mutations or small deletions, or some other
genetic modification in the SHP1 gene locus, such as methylation. The
percentage of SHP1 protein negative cell lines was lower than that of
lymphoma patient specimens (Table 2
and Figure 4
), suggesting that
suppression of SHP1 is more likely to be induced by genetic
modification such as methylation rather than genetic changes. Recently,
Zhang et al reported that lack of SHP1 expression in malignant T cell
lymphoma was induced by methylation of the SHP1 promoter
region.48
In the present cases of other malignant
lymphomas/leukemias it is possible that methylation of SHP1
promoter/enhancer region caused reduced or lack of SHP1 gene
expression, which should be elucidated by further analysis. This
evidence strongly suggests that the SHP1 gene plays an important role
in multistep tumorigenesis not only in NK/T cell lymphomas but also in
a wide range of lymphomas/leukemias and other hematopoietic
malignancies, possibly as an anti-oncogene molecule.
The large-scale cDNA microarray or DNA chip methods are tremendously
powerful and promising for the systematic and comprehensive analysis of
gene expression profiles of known and unknown genes, genetic linkage
studies with single nucleotide polymorphism (SNP), mutation detection
and analysis with oligo arrays, analysis of disease genes and so on, if
the problem of high cost could be overcome. At this moment, combination
of the low-cost middle-scale cDNA macroarray and tissue microarray is
more realistic and also useful and informative. This strategy may have
a great advantage especially in rapid and easy identification of the
disease-responsible or closely related genes among known genes with
quick screening of multiple genes and multiple tumor types in the same
condition, thereby leading to a more unbiased reliable analysis. This
strategy may be very useful for identification of genes from various
types of diseases where a particular molecular alteration is very
important.
 |
Acknowledgements
|
|---|
We gratefully acknowledge Dr. Yoshinobu Matsuo, Fujisaki Cell
Center, Hayashibara Biochemical Labs, Inc., Okayama, Japan for his kind
provision of the HairM, MOLP2, L428, SKW3, SU-DHL4, RPMI8226, HDLM2,
EDS, and HUT102 cell lines, and Dr. E.C. Butcher (Department of
Pathology, Stanford University, Stanford, CA) for provision of the KCA
cell line. The authors also acknowledge Mutumi Okabe, Yoshiko Sakamoto,
Hiromi Nakamura, Rika Hayashi, Yuki Onoda, Reiko Endo, and Miyuki
Shiotani from the Department of Pathology, Okayama University Medical
School, and Yukinari Isomoto, Hiroshi Okamoto, and Chizuru Motochika
from the Central Research Laboratory, Okayama University Medical
School, for their excellent technical assistance.
 |
Footnotes
|
|---|
Address reprint requests to Takashi Oka, Ph.D., DMSc., Department of Pathology, Okayama University Graduate School of Medicine and Dentistry, 25-1 Shikata-chou, Okayama 700-8558, Japan. E-mail:
oka{at}md.okayama-u.ac.jp
Supported by grant 12670161 from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
Accepted for publication July 12, 2001.
 |
References
|
|---|
-
Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf-Peeters C, Falini B, Gatter KC: A revised European-American classification of lymphoid neoplasm: a proposal from the International Lymphoma Study Group. Blood 1994, 84:1361-1392[Free Full Text]
-
Jaffe ES, Chan JKC, Su IJ, Firizzera G, Mori S, Feller AC, Ho EC: Report of the workshop on the nasal and related extranodal angiocentric T/natural killer cell lymphoma. Am J Surg Pathol 1996, 20:103-111[Medline]
-
Magrath I: The pathogenesis of Burkitts lymphoma. Adv Cancer Res 1990, 55:133-270[Medline]
-
Ye BH, Chaganti S, Chang CC, Niu H, Corradini P, Chaganti RS, Dalla-Favera R: Chromosomal translocations cause deregulated BCL6 expression by promoter substitution in B cell lymphoma. EMBO J 1995, 14:6209-6217[Medline]
-
Poetsh M, Weber-Matthiesen K, Plendl HJ, Grote W, Schlegelberger B: Detection of the t(14;18) chromosomal translocation by interphase cytogenetics with yeast-artificial-chromosome probes on follicular lymphoma and nonneoplastic lymphoproliferation. J Clin Oncol 1996, 14:963-969[Abstract/Free Full Text]
-
Komatsu H, Yoshida K, Seto M, Iida S, Aikawa T, Ueda R, Mikuni C: Overexpression of PRAD1 in a mantle zone lymphoma patient with a t(11;22)(q13;q11) translocation. Br J Haematol 1993, 85:2:427-429
-
Chesi M, Nardini E, Brents LA, Schrock E, Ried T, Kuehl WM, Bergsagel PL: Frequent translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fibroblast growth factor receptor 3. Nat Genet 1997, 16:260-264[Medline]
-
Zhang L, Zhou W, Velculescu VE, Kern SE, Hruban RH, Hamilton SR, Vogelstein B, Kinzler KW: Gene expression profiles in normal and cancer cells. Science 1997, 276:1268-1272[Abstract/Free Full Text]
-
Wang K, Gan L, Jeffery E, Gayle M, Gown AM, Skelly M, Nelson PS, Ng WV, Schummer M: Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray. Gene 1999, 229:101-108[Medline]
-
Alizadeh AA, Eisen MB, Izidore DR, Lossos S, Rosenwald A, Boldrick JC, Sabet H, Tran T, Yu X, Powell JI, Yang L, Marti GE, Moore T, Hudson J, Lu L, Lewis DB, Tibshirani R, Sherlock G, Chan WC, Greiner TC, Weisenburger DD, Armitage JO, Warnke R, Levy R, Wilson W, Grever MR, Byrd JC, Botstein D, Brown PO, Staudt LM: Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 2000, 403:503-511[Medline]
-
Duggan DJ, Bittner M, Chen Y, Meltzer P, Trent JM: Expression profiling using cDNA microarrays. Nat Genet 1999, 21:10-14[Medline]
-
Kononen J, Bubendorf L, Kllioniemi A, Barlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ, Sauter G: Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med 1998, 4:844-847[Medline]
-
Schraml P, Kononen J, Burbendorf L, Moch H, Bissig H, Nocito A, Mihatsch MJ, Kallioniemi OP, Sauter G: Tissue microarrays for gene amplification surveys in many different tumor types. Clin Cancer Res 1999, 5:1966-1975[Abstract/Free Full Text]
-
Moch H, Schraml P, Burbendorf L, Mirlacher M, Kononen J, Gasser T, Mihatsch MJ, Kallioniemi OP, Sauter G: High-throughput tissue microarray analysis to evaluate genes uncovered by cDNA microarray screening in renal cell carcinoma. Am J Pathol 1999, 154:981-986[Abstract/Free Full Text]
-
Tsuchiyama J, Yoshino T, Mori M, Kondoh E, Oka T, Akagi T, Hiraki A, Nakayama H, Shibuya A, Ma Y, Kawabata T, Okada S, Harada M: Characterization of a novel natural killer-cell line (NK-YS) established from natural killer cell lymphoma/leukemia associated with Epstein-Barr virus infection. Blood 1998, 92:1374-1383[Abstract/Free Full Text]
-
Chang KL, Chen YY, Shibata D, Weiss LM: Description of an in situ hybridization methodology for detection of Epstein-Barr virus RNA in paraffin-embedded tissues with a survey of normal and neoplastic tissues. Diagn Mol Pathol 1998, 1:246-255
-
Hayashi K, Koirala T, Ino H, Chen HL, Ohara N, Teramoto N, Yoshino T, Takahashi K, Yamada M, Nii S, Miyamoto K, Fujimoto K, Yoshikawa Y, Akagi T: Malignant lymphoma induction in rabbits by intravenous inoculation of Epstein-Barr-virus related herpesvirus from HTLV-II-transformed cynomolgus leukocyte cell line (Si-IIA). Int J Cancer 1995, 63:872-880[Medline]
-
Meyer D, Yamaai T, Garratt A, Sonnenberg-Riethmacher E, Kramer R, Theil LE, Birchimeier C: Isoform-specific expression and function of neuregulin. Development 1997, 124:3575-3586[Abstract]
-
Towbin H, Staehelin T, Gordon J: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979, 76:4350-4354[Abstract/Free Full Text]
-
Delibrias CC, Floettmann JE, Rowe M, Fearon DT: Downregulated expression of SHP-1 in Burkitt lymphomas and germinal center B lymphocytes. J Exp Med 1997, 186:1575-1583[Abstract/Free Full Text]
-
Long EO, Burshtyn DN, Clark WP, Peruzzi M, Rajagopalan S, Rojo S, Wagtmann N, Winter CC: Killer cell inhibitory receptors: diversity, specificity, and function. Immunol Rev 1997, 155:135-144[Medline]
-
Siminovitch KA, Neel BG: Regulation of B cell signal transduction by SH2-containing protein-tyrosine phosphatase. Semin Immunol 1998, 10:329-347[Medline]
-
Healy JI, Goodnow CC: Positive versus negative signaling by lymphocyte antigen receptors. Annu Rev Immunol 1998, 16:645-670[Medline]
-
Long EO: Regulation of immune responses through inhibitory receptors. Annu Rev Immunol 1999, 17:875-904[Medline]
-
Brockdorff J, Williams S, Couture C, Mustelin T: Dephosphorylation of ZAP70 and inhibition of T cell activation by activated SHP1. Eur J Immunol 1999, 29:2539-2550[Medline]
-
Pani G, Fischer KD, Mlinaric-Rascan I, Siminovitch KA: Signaling capacity of the T cell antigen receptor is negatively regulated by the PTP1C tyrosine phosphatase. J Exp Med 1996, 184:839-852[Abstract/Free Full Text]
-
Migone TS, Cacalano NA, Taylor N, Yi T, Waldmann TA, Johnston JA: Recruitment of SH2-containing protein tyrosine phosphatase SHP-1 to the interleukin 2 receptor: loss of SHP-1 expression in human T-lymphotropic virus type I-transformed T cells. Proc Natl Acad Sci USA 1998, 95:3845-3850[Abstract/Free Full Text]
-
Yang W, Tabrizi M, Berrada K, Yi T: SHP-1 phosphatase C-terminus interacts with novel substrates p32/p30 during erythropoietin and interleukin-3 mitogenic responses. Blood 1998, 91:3746-3755[Abstract/Free Full Text]
-
Bone H, Dechert U, Jirik F, Schrader JW, Welham MJ: SHP1 and SHP2 protein-tyrosine phosphatases associate with betac after interleukin-3-induced receptor tyrosine phosphorylation: identification of potential binding sites and substrates. J Biol Chem 1997, 272:14470-14476[Abstract/Free Full Text]
-
Bittorf T, Seiler J, Zhang Z, Jaster R, Brock J: SHP1 protein tyrosine phosphatase negatively modulates erythroid differentiation and suppression of apoptosis in J2E erythroleukemic cells. Biol Chem 1999, 380:1201-1209[Medline]
-
Blasioli J, Paust S, Thomas ML: Definition of the sites of interaction between the protein tyrosine phosphatase SHP-1 and CD22. J Biol Chem 1999, 274:2303-2307[Abstract/Free Full Text]
-
Cornall RJ, Cyster JG, Hibbs ML, Dunn AR, Otipoby KL, Clark EA, Goodnow CC: Polygenic autoimmune traits: lyn, CD22, and SHP-1 are limiting elements of a biochemical pathway regulating BCR signaling and selection. Immunity 1998, 8:497-508[Medline]
-
Cornall RJ, Goodnow CC, Cyster JG: Regulation of B cell antigen receptor signaling by the Lyn/CD22/SHP1 pathway. Curr Top Microbiol Immunol 1999, 244:57-68[Medline]
-
Binstadt BA, Billadeau DD, Jevremovi D, Williams BL, Fang N, Yi T, Koretzky GA, Abraham RT, Leibson PJ: SLP-76 is a direct substrate of SHP-1 recruited to killer cell inhibitory receptors. J Biol Chem 1998, 273:27518-27523[Abstract/Free Full Text]
-
Mizuno K, Katagiri T, Hasegawa K, Ogimoto M, Yakura H: Hematopoietic cell phosphatase, SHP-1, is constitutively associated with the SH2 domain-containing leukocyte protein, SLP-76, in B cells. J Exp Med 1996, 184:457-463[Abstract/Free Full Text]
-
Wu Y, Nadler MJ, Brennan LA, Gish GD, Timms JF, Fusaki N, Jongstra Bilen J, Tada N, Pawson T, Wither J, Neel BG, Hozumi N: The B-cell transmembrane protein CD72 binds to and is an in vivo substrate of the protein tyrosine phosphatase SHP-1. Curr Biol 1998, 8:1009-1017[Medline]
-
Fusaki N, Tomita S, Wu Y, Okamoto N, Goitsuka R, Kitamura D, Hozumi N: BLNK is associated with the CD72/SHP-1/Grb2 complex in the WEHI231 cell line after membrane IgM cross-linking. Eur J Immunol 2000, 30:1326-1330[Medline]
-
Wang LL, Blasioli J, Plas DR, Thomas ML, Yokoyama WM: Specificity of the SH2 domains of SHP-1 in the interaction with the immunoreceptor tyrosine-based inhibitory motif-bearing receptor gp49B. J Immunol 1999, 162:1318-1322[Abstract/Free Full Text]
-
Lorenz U, Ravichandran KS, Burakoff SJ, Neel BG: Lack of SHPTP1 results in src-family kinase hyperactivation and thymocyte hyperresponsiveness. Proc Natl Acad Sci USA 1996, 93:9624-9629[Abstract/Free Full Text]
-
Pani G, Fischer KD, Mlinaric-Rascan I, Siminovitch KA: Signaling capacity of the T cell antigen receptor is negatively regulated by the PTP1C tyrosine phosphatase. J Exp Med 1996, 184:839-852
-
Valiante NM, Phillips JH, Lanier LL, Parham P: Killer cell inhibitory receptor recognition of human leukocyte antigen (HLA) class I blocks formation of a pp36/PLC-gamma signaling complex in human natural killer (NK) cells. J Exp Med 1996, 184:2243-2250[Abstract/Free Full Text]
-
Dustin LB, Plas DR, Wong J, Hu YT, Soto C, Chan AC, Thomas ML: Expression of dominant-negative src-homology domain 2-containing protein tyrosine phosphatase-1 results in increased Syk tyrosine kinase activity and B cell activation. J Immunol 1999, 162:2717-2724[Abstract/Free Full Text]
-
Blery M, Olcese L, Vivier E: Early signaling via inhibitory and activating NK receptors. Hum Immunol 2000, 61:51-64[Medline]
-
Shultz LD, Schweitzer PA, Rajan TV, Yi T, Ihle JN, Matthews RJ, Thomas ML, Beier DR: Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 1993, 73:1445-1454[Medline]
-
Bignon JS, Siminovitch KA: Identification of PTP1C mutation as the genetic defect in motheaten and viable motheaten mice: a step toward defining the roles of protein tyrosine phosphatases in the regulation of hemopoietic cell differentiation and function. Clin Immunol Immunopathol 1994, 73:168-179[Medline]
-
Bittorf T, Seiler J, Zhang Z, Jaster R, Brock J: SHP1 protein tyrosine phosphatase negatively modulates erythroid differentiation and suppression of apoptosis in J2E erythroleukemic cells. Biol Chem 1999, 380:1201-1209
-
Siminovitch KA, Lamhonwah AM, Somani AK, Cardiff R, Mills GB: Involvement of the SHP1 tyrosine phosphatase in regulating B lymphocyte antigen receptor signaling, proliferation, and transformation. Curr Top Microbial Immnol 1999, 246:291-297
-
Zhang Q, Raghunath PN, Vonderheid E, Odum N, Wasik MA: Lack of phosphotyrosine phosphatase SHP-1 expression in malignant T-cell lymphoma cells results from methylation of the SHP-1 promoter. Am J Pathol 2000, 157:1137-1146[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Simoneau, J. Boulanger, G. Coulombe, M.-A. Renaud, C. Duchesne, and N. Rivard
Activation of Cdk2 Stimulates Proteasome-dependent Truncation of Tyrosine Phosphatase SHP-1 in Human Proliferating Intestinal Epithelial Cells
J. Biol. Chem.,
September 12, 2008;
283(37):
25544 - 25556.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. M. Amin and R. Lai
Pathobiology of ALK+ anaplastic large-cell lymphoma
Blood,
October 1, 2007;
110(7):
2259 - 2267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Cheng, A. R. Kydd, K. Nakase, K. M. Noonan, A. Murakami, H. Tao, M. Dwyer, C. Xu, Q. Zhu, and W. A. Marasco
Negative regulation of the SH2-homology containing protein-tyrosine phosphatase-1 (SHP-1) P2 promoter by the HTLV-1 Tax oncoprotein
Blood,
September 15, 2007;
110(6):
2110 - 2120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Han, H. M. Amin, B. Franko, C. Frantz, X. Shi, and R. Lai
Loss of SHP1 enhances JAK3/STAT3 signaling and decreases proteosome degradation of JAK3 and NPM-ALK in ALK+ anaplastic large-cell lymphoma
Blood,
October 15, 2006;
108(8):
2796 - 2803.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Wang, Z. Li, R. Ding, G. D. Frank, T. Senbonmatsu, E. J. Landon, T. Inagami, and Z. J. Zhao
Antagonism or Synergism: ROLE OF TYROSINE PHOSPHATASES SHP-1 AND SHP-2 IN GROWTH FACTOR SIGNALING
J. Biol. Chem.,
August 4, 2006;
281(31):
21878 - 21883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-F. Honorat, A. Ragab, L. Lamant, G. Delsol, and J. Ragab-Thomas
SHP1 tyrosine phosphatase negatively regulates NPM-ALK tyrosine kinase signaling
Blood,
May 15, 2006;
107(10):
4130 - 4138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Chen, M. Levis, P. Brown, K.-T. Kim, J. Allebach, and D. Small
FLT3/ITD Mutation Signaling Includes Suppression of SHP-1
J. Biol. Chem.,
February 18, 2005;
280(7):
5361 - 5369.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. L. Ebert and T. R. Golub
Genomic approaches to hematologic malignancies
Blood,
August 15, 2004;
104(4):
923 - 932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Guiter, I. Dusanter-Fourt, C. Copie-Bergman, M.-L. Boulland, S. le Gouvello, P. Gaulard, K. Leroy, and F. Castellano
Constitutive STAT6 activation in primary mediastinal large B-cell lymphoma
Blood,
July 15, 2004;
104(2):
543 - 549.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oka, M. Ouchida, M. Koyama, Y. Ogama, S. Takada, Y. Nakatani, T. Tanaka, T. Yoshino, K. Hayashi, N. Ohara, et al.
Gene Silencing of the Tyrosine Phosphatase SHP1 Gene by Aberrant Methylation in Leukemias/Lymphomas
Cancer Res.,
November 15, 2002;
62(22):
6390 - 6394.
[Abstract]
[Full Text]
[PDF]
|
 |
|