| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Medicine,*
Northwestern
University, Chicago; the Department of Basic and Health
Sciences,
Illinois College of Optometry,
Chicago; and the Veteran’s Administration Chicago Health Care
System,
Lakeside Division, Chicago, Illinois
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The chemokines are mainly homologous 8- to 10-kd proteins that are
subdivided into four families (C, CC, CXC, and
CX3C) on the basis of the relative position of
the cysteine residues in the mature protein.7,8
Although
the chemokines are generally thought to function as leukocyte
attractants, we have previously identified the CXC chemokine, IL-8, as
a mediator of angiogenesis.6
Further studies have shown
that the CXC chemokines containing the ELR motif, consisting of
glutamic acid-leucine-arginine preceding the CXC sequence are not only
chemotactic for neutrophils but are angiogenic.9
The CC
chemokine monocyte chemotactic protein-1 (MCP-1) has recently been
identified as an inducer of endothelial cell (EC) chemotaxis in
vitro10
and as a mediator of inflammatory
angiogenesis in vivo.11
Viral CC chemokine-like
proteins vMIP-I and vMIP-II, but not their cellular counterpart
macrophage inflammatory protein-1
(MIP-1), have also been shown
to induce angiogenesis in vivo.12
We have previously described fractalkine (fkn), the sole member of the CX3C chemokine family, as a mediator of inflammation in RA.13 As many inflammatory mediators are also angiogenic mediators in RA synovial tissues (STs) and synovial fluids (SFs) we investigated the angiogenic properties of fkn. In this report we define fkn as a potent angiogenic mediator in RA. Fkn was named for its fractal geometry and is distinct from other chemokines in that it contains the CX3C motif with three amino acids between the two terminal cysteines.14 Fkn also is unique in that it is a transmembrane protein displaying its chemokine domain perched on a long (241 amino acid) negatively charged mucin-like stalk that extends away from the cell surface. In addition, fkn is much larger than any other chemokine consisting of 373 amino acids and can be cleaved via a syndecan-like cleavage motif proximal to the membrane resulting in a soluble 95-kd glycoprotein.14,15
Soluble fkn is a monomer that like other chemokines functions as a
chemoattractant for natural killer cells, T lymphocytes, and
monocytes.14,16-19
Unlike other chemokines,
membrane-bound fkn can directly mediate firm cell adhesion, and
initiate leukocyte capture.14,17,20
Specifically,
membrane-bound fkn has been shown to be involved in adhesion of
monocytes, T lymphocytes, and natural killer cells to ECs in
vitro.14,20,21
Fkn expression on human ECs is induced
by the inflammatory cytokines IL-1 or tumor necrosis
factor-.14
The mouse homologue of fkn, neurotactin, is
up-regulated on ECs in inflamed brain in allergic
encephalomyelitis.22
Thus, in inflammation fkn can
function both as a chemoattractant for leukocytes and as an EC adhesion
molecule.
We show fkn to induce both EC migration and tube formation in vitro, to induce angiogenesis in vivo and to function as an angiogenic mediator present in RA SF and ST. Thus, in addition to being an adhesion molecule and chemoattractant for leukocytes, fkn functions as an angiogenic mediator.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human recombinant fkn, IL-8, epithelial neutrophil-activating protein-78 (ENA-78), basic fibroblast growth factor (bFGF), bovine acidic fibroblast growth factor (aFGF), goat polyclonal antibody (pAb) anti-human fkn, and control goat IgG were purchased from R&D Systems (Minneapolis, MN). Rabbit purified pAb anti-CX3CR1 was purchased from Imgenex (San Diego, CA). Dimethyl sulfoxide and phorbol 12-myristate 13-acetate (PMA) were purchased from Sigma (St. Louis, MO). Matrigel was purchased from Becton Dickinson (Bedford, MA). Enhanced chemiluminescence Western blotting detection reagents and goat horseradish peroxidase-conjugated antibody were obtained from Amersham Life Sciences (Arlington Heights, IL).
Cells
Human dermal microvascular endothelial cells (HMVECs) were purchased from BioWhittaker (San Diego, CA) and grown in EC growth medium (BioWhittaker) with 10% fetal bovine serum (FBS). Cell assays were performed in endothelial basal medium (BioWhittaker) supplemented with the appropriate amount of FBS for the assay and 0.1% gentamicin. THP-1 cells were purchased from the American Type Culture Collection (Manassas, VA) and grown in RPMI with 10% FBS.
EC Chemotaxis
HMVECs were cultured in endothelial cell growth medium containing 10% FBS. Chemotaxis was performed in 48-well blind-well chemotaxis chambers using gelatin-coated polycarbonate membranes with an 8-µm pore size (Neuroprobe, Cabin John, MD).4,23 HMVECs (2.5 x 104 cells in 25 µl of endothelial basal medium containing 0.1% FBS) were added to the bottom wells. The chambers were inverted and incubated for 2 hours at 37°C allowing HMVEC attachment to the membrane. Fkn (10-12 to 102 nmol/L), phosphate-buffered saline (PBS), or positive control bFGF (60 nmol/L) were added to the top wells and the chambers incubated for 2 hours at 37°C. The membranes were removed, fixed in methanol, and stained with Diff-Quik (Baxter Scientific, Deerfield, IL). The number of cells that had migrated through the pores in the filter was counted per three high-power fields and each test group was assayed in quadruplicate. Checkerboard analyses were performed in a similar manner to chemotaxis assays except that the concentrations of fkn were varied in the upper and lower chambers.
Immunodepletion of Fkn in HMVEC Chemotaxis Assays
Fkn (101 nmol/L and 10-3 nmol/L) or PMA (60 nmol/L) were incubated with 10 to 25 µg/ml of either pAb anti-fkn or control goat IgG for 1 hour at 37°C. On completion of this neutralization period, the fkn/Ab and PMA/Ab combinations were assayed in the HMVEC chemotaxis assay as described above.
Immunodepletion of Fkn in RA SFs for HMVEC Chemotaxis Assays
SFs were isolated from six patients with RA during therapeutic arthrocentesis with Institutional Review Board approval. RA SF was diluted 1 to 50 with PBS and preincubated with 25 µg/ml of pAb anti-fkn or goat IgG control for 1 hour at 37°C. On completion of this neutralization period, the RA SF/Ab combination was assayed in the HMVEC chemotaxis assay as described above.
Formation of EC Tubes on Matrigel in Vitro
Matrigel was thawed on ice to prevent premature polymerization; 125 µl were plated into individual wells of eight-well chamber slides (Falcon, Bedford, MA) and allowed to polymerize at 37°C for 30 to 60 minutes. HMVECs were removed from culture by trypsinization and resuspended at 4 x 104 cells/ml in Medium 199 (Life Technologies, Inc., Grand Island, NY) containing 2% FBS and 200 µg/ml EC growth supplement.24 Four hundred µl of cell suspension containing fkn, 50 nmol/L PMA, or vehicle control (PBS for fkn, PBS and dimethyl sulfoxide for PMA) were plated in each well and plates incubated for 16 to 18 hours at 37°C in a 5% CO2 humidified atmosphere.25 Culture medium was aspirated off and cells were fixed with Diff-Quik Fixative and stained with Diff-Quik Solution II. Each chamber was photographed using a Polaroid Microcam camera at a final magnification of x22. The number of tube branches was quantitated by a blinded observer.26 Each concentration of control or test substance was assayed in triplicate.
HMVEC Proliferation Assay
HMVEC proliferation was quantified using a CellTiter 96 Aqueous assay (Promega, Madison, WI).4,23 HMVECs in endothelial basal medium, 2% FBS, and 0.1% gentamicin were plated in 96-well plates (2500 cells/well) for 4 hours, allowing cells to adhere to the plates. The test substances, diluted in medium, were added to the appropriate wells and incubated according to the manufacturer’s suggested conditions of 37°C and 5% CO2 for 72 hours. After the incubation, viable cells were detected by their reduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) into a formazan. The number of living cells in culture is directly proportional to the quantity of formazan product as measured at a wavelength of 490 nm. These absorbance values were compared to a positive control, bFGF, and a negative control, medium alone.
Reverse Transcriptase-Polymerase Chain Reaction (PCR) Amplification of HMVEC CX3CR1
HMVECs were cultured in endothelial cell growth medium (BioWhittaker) containing 10% FBS. Total RNA (1 µg) was prepared from HMVECs and first-strand cDNAs were synthesized using an oligo dT primer and AMV RT (Promega, Madison, WI). Subsequent amplification of CX3CR1 from HMVEC cDNA was performed using specific 5' and 3' primers: forward primer 5'CTCTATGACTTCTTTCCCAGTTGT3'; reverse primer 5'AGACACAAGGCTTTGGGATTC3'.27 PCR cycling conditions were 95°C for 5 minutes followed by 30 cycles of 95°C for 1 minute, 52°C for 1 minute, and 72°C for 1 minute, and ended by 10 minutes at 72°C. Amplification products were characterized by size fractionation on 1% agarose gels.
Western Blot Analysis
HMVECs were cultured in endothelial cell growth medium (BioWhittaker) containing 10% FBS. THP-1 cells were cultured in RPMI containing 10% FBS. Cells were lysed in extraction buffer containing 10 mmol/L Tris, pH 7.4, 100 mmol/L NaCl, 1 mmol/L ethylenediaminetetraacetic acid, 1 mmol/L ethyleneglycoltetraacetic acid, 1 mmol/L NaF, 20 mmol/L NaP2O4, 2 mmol/L Na3VO4, 1% Triton X-100, 10% glycerol, 0.1% sodium dodecyl sulfate, 0.5% deoxycholate, 1 mmol/L phenylmethyl sulfonyl fluoride, and protease inhibitors (1 tablet/10 ml, Proteinase inhibitor cocktail tablets; Boehringer Mannheim, Mannheim, Germany). Cell lysates were mixed 1:1 with Laemmli’s sample buffer and boiled for 5 minutes. Equal amounts of sample were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Separated proteins were electrophoretically transferred from the gel onto nitrocellulose membranes using a Tris-glycine buffer. To block nonspecific binding, membranes were incubated with 5% milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1 hour at room temperature. The blots were incubated with anti-human CX3CR1 Ab (Imgenex) diluted 1:500 in TBST and 5% milk at 4°C overnight. After washing with TBST, the blots were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (diluted 1:10,000) for 45 minutes at room temperature. An enhanced chemiluminescence detection system (ECL+, Amersham) was used to detect the CX3CR1 band.
Matrigel Plug Assay for Angiogenesis in Vivo
Female 8- to 12-week-old C57BL/6 mice (Charles River Laboratories, Wilmington, MA) were each injected subcutaneously near their abdominal midline using a 30-gauge needle with 0.5 ml of Matrigel combined with either PBS, fkn (100 nmol/L), IL-8 (100 nmol/L), ENA-78 (100 nmol/L), or positive control bovine aFGF (63 pmol/L).28,29 Seven to 10 days later, the mice were sacrificed and the Matrigel plugs were removed, weighed, and processed for histology or hemoglobin concentration determination. For histological analysis plugs were formalin-fixed, paraffin-embedded, cut into 4-µm sections, and Masson trichrome-stained. For hemoglobin determination, which correlates with the number of blood vessels, plugs were homogenized in 1 ml of distilled water. Hemoglobin concentration was determined either by the Drabkin method using a Drabkin’s reagent kit (Sigma) or using 3,3',5,5'-tetramethylbenzidine liquid substrate system (Sigma).
Immunodepletion of Fkn in RA SFs for Matrigel Plug Angiogenesis Assays
SFs were isolated from six patients with RA during therapeutic arthrocentesis with Institutional Review Board approval. RA SFs were pooled and diluted 1 to 10 with PBS and preincubated with 25 µg/ml of pAb anti-fkn or goat IgG control for 1 hour at 37°C. On completion of this neutralization period, the RA SF/Ab combination was diluted again 1 to 10 with Matrigel and assayed in the in vivo Matrigel plug angiogenesis assay as described above.
Immunodepletion of Fkn in RA STs for Matrigel Plug Angiogenesis Assays
STs were obtained from five patients undergoing total joint replacement who met the American College of Rheumatology criteria for RA.30-32 RA STs were homogenized in 1 ml of an anti-protease buffer as described.33 Samples were sonicated, centrifuged at 900 x g for 15 minutes and filtered through a 1.2-µm pore size sterile Acrodisk (Gelman Sciences, Ann Arbor, MI), and frozen at -80°C until thawed for assay. ST homogenates were thawed, normalized, pooled, and preincubated with 25 µg/ml of pAb anti-fkn or goat IgG control for 1 hour at 37°C. On completion of this neutralization period, the RA ST homogenates/Ab combination was diluted 1 to 25 with Matrigel and assayed in the in vivo Matrigel plug angiogenesis assay as described above.
Statistical Analysis
Data were analyzed using Student’s t-test. P values <0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fkn was assayed for its ability to induce HMVEC chemotaxis
in vitro. Results of a representative experiment of four are
shown in Figure 1
. Fkn induced chemotaxis
in a concentration-dependent manner in the pmol/L and nmol/L
concentration range. Fkn (10-1 pmol/L to
102
nmol/L) significantly increased EC chemotaxis
over negative control PBS (P < 0.05).
Checkerboard analysis was performed to determine whether fkn was
chemotactic and/or chemokinetic for ECs. Representative results
of four checkerboard assays showing fkn as both chemotactic and
chemokinetic for HMVECs are shown in Table 1
.
|
|
We next determined whether the chemokine domain of fkn was
responsible for the EC chemotactic ability of fkn. Fkn was incubated
with 25 µg/ml of an antibody specific for the
CX3C chemokine domain of fkn and then assayed for
HMVEC chemotaxis ability. Figure 2A
shows
that at concentrations from 1 pmol/L to 10 nmol/L of fkn, the
anti-CX3C domain antibody completely inhibited
fkn-induced HMVEC migration (P < 0.05). This
inhibition of migration by anti-CX3C domain
antibody was specific for fkn-induced HMVEC migration as bFGF-induced
migration was not affected by incubation with this antibody (Figure 2B)
.
|
We next assessed the ability of fkn to act as a mitogen for ECs
in vitro. When assayed in concentrations of
10-10 to 102
nmol/L, fkn
did not induce a mitogenic response, in contrast to 60 nmol/L of bFGF
that induced potent EC proliferation. We have shown previously that
angiogenic soluble adhesion molecules such as soluble VCAM-1 (sVCAM-1)
or sE-selectin did not induce EC mitogenesis in vitro
although they were potently angiogenic in
vivo.4
Results of a representative experiment of four
experiments is shown in Figure 3
.
|
Tube formation, one facet of the angiogenic response, can be
assayed for in vitro by testing the ability of HMVECs plated
on Matrigel to form tubes. We investigated the ability of fkn to induce
tube formation on Matrigel in eight-well chamber slides. The results of
a representative experiment of four experiments is shown in Figure 4
. Figure 4A
shows a photomicrograph of
tube formation induced by fkn. In contrast, PBS did not induce EC tube
formation. To quantify tube formation in the Matrigel matrices, a
blinded observer counted EC tubes in each experimental well. Figure 4B
shows EC tube counts for fkn-induced tube formation along with tube
counts induced by positive control PMA and the vehicle controls
dimethyl sulfoxide and PBS. Fkn induced significantly more EC tube
formation than negative control PBS (152 ± 11.7 versus
90 ± 10.7 tubes/well; P < 0.05,
n = 4). We have also used this technique to test the
ability of the angiogenic chemokines, IL-8 and ENA-78, to induce EC
tube formation. Both IL-8 and ENA-78 induced EC tube formation greater
than PBS controls (data not shown). Next, to help discern whether
fkn-induced tube formation was because of the chemokine domain or to
the mucin stalk, we incubated fkn with an
anti-CX3C domain antibody. Anti-fkn significantly
inhibited fkn-induced tube formation over isotype control antibody
(P < 0.05, n = 3) (Figure 4C)
.
This inhibition of tube formation by anti-fkn was specific to
fkn-induced formation as PMA-induced tube formation was not affected by
incubation with the antibody (Figure 4C)
.
|
To better understand how fkn may interact with ECs to induce
migration (chemotaxis and chemokinesis) and tube formation, we tested
whether the only known fkn receptor, CX3CR1, was
expressed by ECs. Previous reports have identified endothelial
expression of fkn but did not examine expression of its receptor
CX3CR1. Reverse transcriptase-PCR was performed
on HMVEC cDNAs along with cDNAs from THP-1 cells, a myeloid cell line
previously reported to express high amounts of
CX3CR1 mRNA.34
PCR products were
synthesized using specific human CX3CR1 primers
that amplify a 320-bp fragment. As shown in Figure 5A, a
320-bp PCR product was amplified
from both HMVEC cDNAs as well as the positive control, THP-1 cDNAs,
indicating EC expression of CX3CR1. Next, Western
blot analysis was performed to demonstrate endothelial
CX3CR1 protein expression. Cell lysates were
prepared from both HMVECs and THP-1 cells and subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to
nitrocellulose. Western blotting, performed with a IgG-purified pAb
specific for human CX3CR1, revealed a band of the
correct size (50 kd) in both the EC and positive control, THP-1 cell,
lanes (Figure 5B)
.35
|
To determine whether fkn functions as an angiogenic mediator
in vivo, we used the mouse Matrigel plug assay. Matrigel
plugs containing negative control PBS, fkn, angiogenic chemokines IL-8
and ENA-78, or positive control aFGF were implanted subcutaneously into
the abdomen of mice. A representative photomicrograph of a plug fixed
and Masson trichrome-stained is shown in Figure 6A
. In fkn-containing plugs marked new
blood vessel growth can be seen. In contrast, minimal blood vessel
growth was induced by negative control PBS. Figure 6B
shows the
hemoglobin content normalized to the weight of the Matrigel plugs. The
hemoglobin content correlates with the number of blood vessels in the
plugs. By this method, fkn induced significantly more blood vessels in
the Matrigel plugs than did negative control PBS (0.77 ± 0.15
versus 0.33 ± 0.08 g/dl of hemoglobin/mg of plug
weight, respectively; n = 18, P <
0.05). To compare the relative angiogenic potency of fkn to other known
angiogenic chemokines, IL-8 and ENA-78 were also tested in the Matrigel
plug model. The relative angiogenic potencies for fkn, IL-8, and ENA-78
as a percentage of the angiogenic potency of the positive control,
aFGF, are shown in Figure 6C
. Fkn exhibited 78% of the angiogenic
potency of aFGF, whereas IL-8 and ENA-78 exhibited 65% and 44%,
respectively (n = 7 to 9).
|
To determine whether fkn has biological relevance in a disease
characterized by angiogenesis, SFs from six patients with RA were
immunodepleted of fkn and assayed for their HMVEC chemotactic activity.
Results of immunodepletion experiments are shown in Table 2
. Although RA SF was potently
chemotactic for HMVECs, immunodepletion of fkn resulted in
significantly decreased (56.1 ± 2.4%, mean ± SE)
chemotactic ability for HMVECs relative to immunodepletion with isotype
control antibody (P < 0.05).
|
To determine whether fkn is responsible for a portion of the
angiogenic properties of RA SF, SFs from six RA patients were pooled,
immunodepleted of fkn, and assayed for angiogenic activity in
vivo. Fkn-immunodepleted SFs were diluted in Matrigel and injected
subcutaneously into mice. Results of these immunodepletion experiments
are shown in Figure 7
. The angiogenesis
induced by the pooled SFs was significantly decreased by
immunodepleting fkn compared to sham immunodepletion (0.028 ±
0.02 versus 1.38 ± 0.57 g/dl of hemoglobin/mg of plug
weight, n = 12, respectively, P <
0.05).
|
To determine whether fkn is responsible for a portion of the
angiogenic properties of RA ST homogenates, ST homogenates from five RA
patients were pooled, immunodepleted of fkn, and assayed for in
vivo angiogenic activity. Representative photomicrographs of these
Matrigel plugs fixed and Masson trichrome-stained are shown in Figure 8A
. Matrigel plugs containing pooled RA
ST homogenates have significant new blood vessel growth, whereas
Matrigel plugs containing RA ST homogenate immunodepleted with anti-fkn
have minimal blood vessel growth. Figure 8B
shows the hemoglobin
content normalized to the weight of the Matrigel plugs. The
angiogenesis induced by the pooled ST homogenates was significantly
decreased by immunodepleting fkn compared to sham immunodepletion
(0.09 ± 0.08 versus 0.66 ± 0.12 g/dl of
hemoglobin/mg of plug weight, n = 12, respectively,
P < 0.05).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. In Table 1
, a checkerboard assay shows fkn
to induce EC migration both when it is added directly to the cells and
when it is added to the chamber on the other side of the membrane,
indicating that in addition to inducing directional migration
(chemotaxis), fkn stimulates ECs to randomly migrate (chemokinesis).
Fkn (100 nmol/L) induced ECs to form tubes in Matrigel in
vitro at the same rate as the angiogenic chemokines, IL-8 and
ENA-78 (10 µmol/L) (data not shown), and PMA (50 µmol/L), a strong
inducer of EC differentiation and EC tube formation (Figure 4B)
.25
We also show the angiogenic properties of fkn
in vivo, as fkn induced angiogenesis in Matrigel plugs
inserted in mice comparable in potency to the known angiogenic
chemokines IL-8 and ENA-78 (Figure 6)
. Thus, fkn is the first
CX3C chemokine shown to function as an inducer of
EC migration and angiogenesis.
Because fkn contains both a chemokine domain and a mucin stalk
resembling an adhesion molecule, we questioned which domain was
responsible for its EC migration and tube-forming properties. We found
that the chemokine domain of fkn is necessary and that the mucin domain
is not sufficient for inducing EC migration and tube formation on
Matrigel, as an antibody specific for the chemokine domain completely
inhibited fkn-induced HMVEC migration and tube formation (Figure 2
and
Figure 4C
). Because fkn does not contain an ELR motif, the mechanism by
which fkn induces EC migration seems unique from that of the other
angiogenic chemokines.
Chemokines have been shown to induce EC chemotaxis through binding
their EC chemokine receptors. Moore and co-workers36,37
showed that angiogenesis induced by the CXC chemokines, IL-8, KC,
MIP-2, and ENA-78 was mediated through the EC chemokine receptor
CXCR2. Fiel and Augustin38
showed that SDF-1-CXCR4
interactions are involved in bovine aortic EC chemotaxis. Weber and
co-workers10
inhibited MCP-1-induced EC chemotaxis with a
CCR2, the MCP-1 receptor, antagonist. Here we demonstrate
CX3CR1 mRNA and protein expression in HMVECs in
culture (Figure 5)
. We have also demonstrated by immunohistochemistry
EC expression of CX3CR1 in ST in adjuvant-induced
arthritic rats.13
Thus, it is possible that fkn-induced EC
migration is mediated through interaction of fkn with its EC receptor
CX3CR1.
The angiogenic properties of fkn are similar in potency to other
angiogenic mediators. Fkn induced a doubling in the amount of EC
migration, a technical indicator of potent migration, at 1 nmol/L and
reached statistical significance at concentrations as low as
10-6 nmol/L. Fkn induced angiogenesis in
vivo at 100 nmol/L. These concentrations of fkn are comparable to
concentrations of the CXC chemokines, IL-8, ENA-78, and growth-related
oncogene- (GRO-), shown to induce EC chemotaxis and angiogenesis.
We previously showed IL-8 to induce a doubling in human umbilical vein
EC chemotaxis at 1.25 nmol/L and to induce angiogenesis at 10
nmol/L.6
ENA-78 induced bovine adrenal gland capillary EC
chemotaxis at as low as 5 nmol/L and ENA-78 and GRO- induced
angiogenesis in the rat cornea neovascularization assay at 10
nmol/L.9
Thus, fkn is a powerful chemoattractant for ECs
and is angiogenic in vivo in the nmol/L range, similar to
other angiogenic CXC chemokines.
Angiogenic factors function to form intact microvessels by inducing EC
migration, proliferation, elongation, orientation, and differentiation
resulting in lumen formation, re-establishment of the basement membrane
and anastomosis with other vessels. We and others have reported ELR
motif-containing CXC chemokines such as IL-8 and GRO- to induce both
EC chemotaxis and proliferation.6,39
We also have recently
shown the cytokine IL-13 to be chemotactic for ECs but not to induce EC
proliferation.23
Here we show that fkn induces EC
migration (chemotaxis and chemokinesis), but not proliferation. In this
way, fkn acts in the same manner as other angiogenic mediators by
inducing some facets of the angiogenic process while having no effect
on others. In this work, we also demonstrated that fkn can induce ECs
to form tubes on Matrigel in vitro and to form functional
blood vessels in Matrigel plugs in vivo, thus establishing
its angiogenic properties.
RA ST is replete with newly formed blood vessels in response to the
increased demand for nutrients and oxygen by the proliferating pannus
tissue.1-3
The level of RA ST vascularity correlates with
more severe clinical and inflammatory scores and is greater than
degrees of vascularity seen in osteoarthritis ST.1,40,41
RA SF and ST homogenates are potent EC chemotactic agents and contain
several mediators that are chemotactic for ECs including the
chemokines, IL-8, ENA-78, and GRO-.4,42-47
In
another report, we have shown RA SF and ST contain greater levels of
antigenic fkn than SF and ST from patients with osteoarthritis or other
forms of arthritis.13
We report here that RA SF
immunodepleted of fkn has significantly reduced chemotactic activity
for ECs and that RA SF and ST homogenates immunodepleted of fkn have
significantly reduced angiogenic activity. The complete nature of the
reduction in RA SF- and ST-induced migration and angiogenesis with
anti-fkn treatment is possibly because of the complex sharing of
chemokine receptors and signaling molecules between different
chemokines or possibly synergy between the different angiogenic
mediators. In this manner, immunodepletion of an individual factor may
have a profound impact on the total angiogenic response, because of the
unique dynamics of stimulating cells with intricate biological tissues.
Our findings suggest an important role for fkn in inducing EC migration
(chemotaxis and chemokinesis) and angiogenesis in RA and identify a new
potential target for treating the disease.
In summary, fkn, the sole member of the CX3C
chemokine family, induces EC migration (chemotaxis and chemokinesis),
EC tube formation, and blood vessel formation in vivo. RA SF
and ST homogenates’ angiogenic activities are in part because of fkn.
We hypothesize that in a disease state such as RA, fkn may act in an
autocrine manner. Specifically, two prominent proinflammatory cytokines
in RA, IL-1ß, and tumor necrosis factor-, activate ECs to produce
fkn on their surface. Next, EC surface fkn is released by enzymatic
cleavage and the resulting soluble fkn binds EC
CX3CR1 inducing EC migration and synovial
angiogenesis.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the National Institute of Health (grants AR30692, HL-58695, AI40987), the Chicago Chapter of the Arthritis Foundation, the Gallagher Professorship for Arthritis Research, and funds from the Veteran’s Administration Research Service.
M. V. V. and J. M. W. both contributed equally to the work reported in this article.
Accepted for publication June 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  T. ODAI, M. MATSUNAWA, R. TAKAHASHI, K. WAKABAYASHI, T. ISOZAKI, N. YAJIMA, Y. MIWA, and T. KASAMA Correlation of CX3CL1 and CX3CR1 Levels with Response to Infliximab Therapy in Patients with Rheumatoid Arthritis J Rheumatol, June 1, 2009; 36(6): 1158 - 1165. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, Y. Lu, J. Wang, A. E. Koch, J. Zhang, and R. S. Taichman CXCR6 Induces Prostate Cancer Progression by the AKT/Mammalian Target of Rapamycin Signaling Pathway Cancer Res., December 15, 2008; 68(24): 10367 - 10377. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Murphy, N. Caplice, and M. Molloy Fractalkine in rheumatoid arthritis: a review to date Rheumatology, October 1, 2008; 47(10): 1446 - 1451. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ryu, C.-W. Lee, K.-H. Hong, J.-A. Shin, S.-H. Lim, C.-S. Park, J. Shim, K. B. Nam, K.-J. Choi, Y.-H. Kim, et al. Activation of fractalkine/CX3CR1 by vascular endothelial cells induces angiogenesis through VEGF-A/KDR and reverses hindlimb ischaemia Cardiovasc Res, May 1, 2008; 78(2): 333 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. H. Lu, D.-J. Oh, B. Dursun, Z. He, T. S. Hoke, S. Faubel, and C. L. Edelstein Increased Macrophage Infiltration and Fractalkine Expression in Cisplatin-Induced Acute Renal Failure in Mice J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 111 - 117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ishida, J.-L. Gao, and P. M. Murphy Chemokine Receptor CX3CR1 Mediates Skin Wound Healing by Promoting Macrophage and Fibroblast Accumulation and Function J. Immunol., January 1, 2008; 180(1): 569 - 579. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D.-J. Oh, B. Dursun, Z. He, L. Lu, T. S. Hoke, D. Ljubanovic, S. Faubel, and C. L. Edelstein Fractalkine receptor (CX3CR1) inhibition is protective against ischemic acute renal failure in mice Am J Physiol Renal Physiol, January 1, 2008; 294(1): F264 - F271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mizutani, T. Sakurai, T. Shibata, K. Uchida, J. Fujita, R. Kawashima, Y. I. Kawamura, N. Toyama-Sorimachi, T. Imai, and T. Dohi Dose-Dependent Differential Regulation of Cytokine Secretion from Macrophages by Fractalkine J. Immunol., December 1, 2007; 179(11): 7478 - 7487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-J. You, C.-H. Yang, J.-S. Huang, M.-S. Chen, and C.-M. Yang Fractalkine, a CX3C Chemokine, as a Mediator of Ocular Angiogenesis Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5290 - 5298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Lee, S. Namkoong, Y.-M. Kim, C.-K. Kim, H. Lee, K.-S. Ha, H.-T. Chung, Y.-G. Kwon, and Y.-M. Kim Fractalkine stimulates angiogenesis by activating the Raf-1/MEK/ERK- and PI3K/Akt/eNOS-dependent signal pathways Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2836 - H2846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Zhu, M. A. Amin, Y. Zha, L. A. Harlow, and A. E. Koch Mechanism by which H-2g, a glucose analog of blood group H antigen, mediates angiogenesis Blood, March 15, 2005; 105(6): 2343 - 2349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Hasegawa, S Sato, T Echigo, Y Hamaguchi, M Yasui, and K Takehara Up regulated expression of fractalkine/CX3CL1 and CX3CR1 in patients with systemic sclerosis Ann Rheum Dis, January 1, 2005; 64(1): 21 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Bonnet and D. A. Walsh Osteoarthritis, angiogenesis and inflammation Rheumatology, January 1, 2005; 44(1): 7 - 16. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J J Haringman, J Ludikhuize, and P P Tak Chemokines in joint disease: the key to inflammation? Ann Rheum Dis, October 1, 2004; 63(10): 1186 - 1194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Umehara, E. T. Bloom, T. Okazaki, Y. Nagano, O. Yoshie, and T. Imai Fractalkine in Vascular Biology: From Basic Research to Clinical Disease Arterioscler. Thromb. Vasc. Biol., January 1, 2004; 24(1): 34 - 40. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strasly, G. Doronzo, P. Capello, D. Valdembri, M. Arese, S. Mitola, P. Moore, G. Alessandri, M. Giovarelli, and F. Bussolino CCL16 activates an angiogenic program in vascular endothelial cells Blood, January 1, 2004; 103(1): 40 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chazaud, C. Sonnet, P. Lafuste, G. Bassez, A.-C. Rimaniol, F. Poron, F.-J. Authier, P. A. Dreyfus, and R. K. Gherardi Satellite cells attract monocytes and use macrophages as a support to escape apoptosis and enhance muscle growth J. Cell Biol., December 8, 2003; 163(5): 1133 - 1143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Lavergne, B. Combadiere, O. Bonduelle, M. Iga, J.-L. Gao, M. Maho, A. Boissonnas, P. M. Murphy, P. Debre, and C. Combadiere Fractalkine Mediates Natural Killer-Dependent Antitumor Responses in Vivo Cancer Res., November 1, 2003; 63(21): 7468 - 7474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A E Koch Angiogenesis as a target in rheumatoid arthritis Ann Rheum Dis, November 1, 2003; 62(90002): ii60 - 67. [Full Text] [PDF]
|
|
|
|
|
|
C. Hundhausen, D. Misztela, T. A. Berkhout, N. Broadway, P. Saftig, K. Reiss, D. Hartmann, F. Fahrenholz, R. Postina, V. Matthews, et al. The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion Blood, August 15, 2003; 102(4): 1186 - 1195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-Q. Gao, Y. Tsuda, K. Katayama, T. Nakayama, Y. Hatanaka, Y. Tani, H. Mizuguchi, T. Hayakawa, O. Yoshie, Y. Tsutsumi, et al. Antitumor Effect by Interleukin-11 Receptor {alpha}-Locus Chemokine/CCL27, Introduced into Tumor Cells through a Recombinant Adenovirus Vector Cancer Res., August 1, 2003; 63(15): 4420 - 4425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Silverman, D. O. Zamora, Y. Pan, P. V. Texeira, S.-H. Baek, S. R. Planck, and J. T. Rosenbaum Constitutive and Inflammatory Mediator-Regulated Fractalkine Expression in Human Ocular Tissues and Cultured Cells Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1608 - 1615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Pablos, B. Santiago, M. Galindo, C. Torres, M. T. Brehmer, F. J. Blanco, and F. J. Garcia-Lazaro Synoviocyte-Derived CXCL12 Is Displayed on Endothelium and Induces Angiogenesis in Rheumatoid Arthritis J. Immunol., February 15, 2003; 170(4): 2147 - 2152. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
