(American Journal of Pathology. 2001;159:1603-1612.)
© 2001 American Society for Investigative Pathology
Myopodin, a Synaptopodin Homologue, Is Frequently Deleted in Invasive Prostate Cancers
Fan Lin*,
Yan-Ping Yu*,
Jeff Woods*,
Kathleen Cieply*,
Bill Gooding
,
Patricia Finkelstein*,
Rajiv Dhir*,
Diane Krill*,
Michael J. Becich*,
George Michalopoulos*,
Sydney Finkelstein* and
Jian-Hua Luo*
From the Department of Pathology,*
School of
Medicine, and the Biostatistic Center,
University of Pittsburgh Cancer Institute, University of Pittsburgh,
Pittsburgh, Pennsylvania
 |
Abstract
|
|---|
Prostate cancer is one of the leading causes of
cancer-related deaths for men in the United States. Like other
malignancies, prostate cancer is underscored by a variety of
aberrant genetic alterations during its development. Although loss of
heterozygosity or allelic loss is frequently identified among prostate
cancers, few genes have been identified thus far as critical to
the development of invasive prostate cancers. In this report,
we used the recently developed technology, the "differential
subtraction chain," to perform a genome-wide search for
sequences that are deleted in an aggressive prostate cancer. Among the
deleted sequences, we found that one sequence was deleted in
>50% of prostate cancers we tested. We mapped this sequence to
chromosome 4q25 by screening the Genebridge 4 hamster radiation panel
with primers specific to this probe, and subsequently identify
a 54-kb minimal common deletion region that contains the sequence
encoding myopodin. Sequence analysis indicates that myopodin shares
significant homology with synaptopodin, a protein closely
associated with podocyte and neuron differentiation. Further study
shows that frequent complete or partial deletions of the myopodin gene
occurred among invasive prostate cancer cases (25 of 31 cases,
or 80%). Statistical analysis indicates that deletion of myopodin is
highly correlated with the invasiveness of prostate cancers,
and thus may hold promise as an important prognostic marker for
prostate cancers.
|
Introduction
|
|---|
Prostate cancer remains one of the
most frequently diagnosed malignancies in American men. Approximately
37,000 men die from this disease annually.1
Despite the
recent advances in our understanding of the environmental, hormonal,
and nutritional parameters affecting the incidence of prostate cancers,
much remains to be learned about the pathogenesis of prostate cancer.
Epidemiological and laboratory studies indicate that genetic factors
are important in the pathogenesis of prostate cancers.2,3
For example, 9% of prostate cancer cases have a strong familial
component that is inherited as an autosomal dominant trait with high
penetrance. In addition, cytogenetic studies, fluorescent in
situ hybridization, comparative genomic hybridization, and
allelotype analyses have revealed numerous genetic abnormalities
associated with invasive prostatic carcinoma, including loss or gain of
regions of several chromosomes, presence of trisomies, amplification of
certain genes in X chromosome, loss of Y chromosome, and high frequency
of loss of heterozygosity in several hot spots. These aberrant genomic
alterations seem to accumulate with advancing stages of prostate
cancers. However, it is not clear what molecular events are responsible
for the progression of prostate cancer from a relatively indolent
disease to one that could be life threatening.
In this report, we applied a methodology previously developed from this
laboratory, namely, the "differential subtraction chain" (DSC) to
identify sequences that were deleted in prostate cancer genome. One of
the deleted sequences identified in an aggressive prostate cancer was
found similarly deleted in many other prostate cancer genomes. We
mapped out a common deletion region among the prostate cancers, and
identified a gene named "myopodin" that was within the minimal
common deletion region. Further study indicated that there were
widespread complete or partial deletions of the myopodin gene in
invasive type of prostate cancers.
|
Materials and Methods
|
|---|
Preparation of Tissue Material
Protocols for tissue procurement, specimen storage, and informed
consent were established in the Western Pennsylvania Tissue Bank, and
approved by the Institutional Review Board. Freshly frozen,
macrodissected tissue was used for DSC reaction. Samples of prostate
cancers were dissected and trimmed to obtain pure tumor (completely
free of normal prostate acinar cells). Sandwich frozen sections were
performed to examine the purity of the tumors. These tissues were then
homogenized. Matched frozen blood sample from the same individual was
used for preparing tester amplicons. Microdissected tumor cells were
used in subsequent validation analysis and survey studies. Five-µm
thin sections of selected prostate cancer frozen tissues were stained
with hematoxylin and eosin and visualized under the microscope. Laser
capture microdissection was performed to obtain pure tumor samples. The
genomic DNA was extracted and purified. The integrity of the DNA was
examined by polymerase chain reaction (PCR) with a set of primers
located away from chromosome 4. These DNA samples were then screened
for genomic deletion. Genomic DNA from tissue or blood samples was
extracted as previously described.4
Clinical follow-up
information of the specimen was obtained from the database of Western
Pennsylvania Tissue Bank. All information in the database was coded so
that the patient’s identification was protected. Investigator had no
access to the patient’s geographical or personal information.
Genomic Amplicon Generation
Procedure for genomic amplicon generation was described
previously.4
One µg of genomic DNA from the tumor or the
blood cells of the same individual was digested with 20 U of
EcoRI at 37°C for 5 hours. The digestion mixture was
purified by QiaQuick PCR purification kit (Qiagen, Valencia, CA), and
ligated with adapter sequences EcoIIa/IIb (tumor sample,
ACCGTATCCAAGGTCACGTACGAG/pAATTCTCGTACG) or EcoIa/Ib (blood sample,
GTCCAAGCAGTTCATAGTCAGCCG/pAATTCGGCTGAC) by T4 DNA ligase (New England
Biolabs, Beverly, MA) at 25°C for 6 to 16 hours. The ligation mixture
was purified, and amplified by PCR (94°C for 1 minute, then 94°C
for 30 seconds, 68°C for 3 minutes for 30 cycles).
DSC
One µg of blood amplicons (testers) was mixed with 10 µg of
tumor amplicons (drivers), which had been digested with
EcoRI to remove the attached adapter sequences, in a total
volume of 7 µl. One µl of 30x EE buffer (300 mmol/L
2-hydroxyethylpiperazine-N'-3-propanesulfonic acid (EPPS) and 30
mmol/L ethylenediaminetetraacetic acid, pH 8.0) was added. The mixture
was then heated to 98°C for 3 minutes, and 2 µl of 5 mol/L NaCl
were added to the reaction to give the final concentration of 1 mol/L
while maintaining the temperature at 98°C. The mixture was then
incubated at 98°C for an additional 2 minutes and hybridized at
67°C for 20 hours. The hybridization mixture was purified by sodium
acetate/ethanol precipitation. The pellet was then washed with 70%
ethanol. The dry pellet of the hybridization mixture was reconstituted
in 50 µl of 1x Mung bean nuclease buffer and digested with 10 U of
Mung bean nuclease at 30°C for 30 minutes. The digestion products
were treated with 0.5 µl of 10% sodium dodecyl sulfate and purified
with ethanol purification. The DNA was resuspended in 9 µl of 3x EE
buffer. One µl was removed for PCR (quality control). The remainder
of the sample was reheated to 98°C for rehybridization. This
procedure was repeated twice.
DSC Product Cloning, Colony Screening, and Sequencing
Round 2 and 3 DSC products were amplified by PCR (94°C for 1
minute, then 30 cycles of 94°C for 30 seconds, 68°C for 3 minutes).
The amplified products were visualized by agarose gel electrophoresis.
An aliquot of the amplified products was ligated with TOPO TA cloning
vector (Invitrogen, Carlsbad, CA) and transfected into
Escherichia coli. Three hundred four colonies were randomly
picked and grown overnight in LB broth with 100 µg/ml of ampicillin.
Aliquots of the bacterial culture were spotted onto colony screen
filter and hybridized with amplicons generated from blood or tumor
prostate tissues. To identify which DSC fragment was not present in the
tumor sample, only those colonies without hybridization signal for
tumor amplicons but positive for blood amplicons were selected. DNA was
extracted from the selected colonies and sequenced with M13 forward or
reverse primers using the thermocycle sequenase dideoxynucleotide
termination method (United States Biochemicals, Cleveland, OH).
Northern Blot Analysis
We analyzed myopodin expression by Northern blot analysis of 20
µg total RNA as described.5
The myopodin gene probe was
generated from a PCR product encompassing exon 2 of myopodin using
primers E1/E4 (GCATTGCCCT TCTTCTAACGGA/ATAGCAGATTGACAGTGACAGC).
PCR Mapping and Survey
The information of the primers specific for STS in chromosome 4q
are listed in Figure 2
. The PCR conditions and the physical map of
these STS were obtained through the website of Stanford Genome Center
(http://www-shgc.stanford.edu). The primers used for
screening partial deletion of myopodin were listed in Table 1
. The following PCR condition was used:
94°C for 1 minute, then 30 cycles of 94°C for 30 seconds, 59°C
for 1 minute, and 72°C for 2 minutes. Twenty-five to 50 ng of DNA
templates were used in each reaction. Genebridge 4 hamster radiation
hybrid panels were purchased from Research Genetics, Huntsville, AL.
PCR using primers specific to 12C was performed on the panel DNA. The
results were tabulated as positive or negative for each reaction, and
input into Genebridge 4 RH program of
http://www-genome.wi.mit.edu.
View larger version (34K):
[in this window]
[in a new window]
|
Figure 2. Genome deletion analysis of prostate cancer. A: Survey of
genomes of 18 primary prostate cancers and prostate cancer cell lines
by PCR using a pair of primers specific to DSC probe 12C. Fifty ng of
microdissected or cell line genomic DNA was used in the reaction. The
experiments were repeated twice. A pair of primers away from chromosome
4q were used as control (4E
AGTAGAGAGTGCTGGTCCACCTAG/AGGCATACTCTAGAAGACAGAGGC)
(bottom).
Primer sequences for 12C are
GTATTCTAGCAAACCTGCTTAGCC/GGGCAGGGCAGTACCAAGGATGGC. B:
Mapping the sizes of deletion in the genomes of prostate cancers.
Chromosome 4 STS markers adjacent to DSC probe 12C were used as primers
in PCR to map the sizes of the deletions. Twenty-five to 100 ng of
genomic DNA were used as templates in each reaction. DNA from the blood
of the same patients and microdissected normal donor DNA were used as a
control for each marker. The green line represents normal
human genome. The black lines next to each case represent
deletions. The line proportion of the map may not be interpreted as the
exact size of physical deletion. Probe 12C was located between markers
D4S832 and WI-11817.
|
|
In Situ Hybridization
5'-digoxigenin-labeled 24-mer oligonucleotides corresponding to
antisense or sense sequence (control) of myopodin were incubated with
pronase digested, prehybridized, 3-µm thin sections of prostate
tissue from paraffin-embedded tissue blocks at 37°C for 12 hours in
hybridization solution.6
The slides were washed twice with
2x standard saline citrate for 15 minutes, and then twice with 1x
standard saline citrate for 15 minutes. The slides were then incubated
with horseradish peroxidase-conjugated anti-digoxigenin antibody for 1
hour at 37°C. Chromogenic color was developed using the peroxidase
substrate diaminobenzidine. The sense probes were used as a negative
control.
Statistics
A permutation test7
with general scores was used to
detect a difference in binomial response rates with increasing
invasiveness. Equally weighted scores (equivalent to the exact
Mantel-Cox test8
) were used to test for trend.
|
Results and Discussion
|
|---|
Previously we developed the DSC, a methodology to identify the
sequences of the differences between two DNA samples.4
This method enriches unique tester sequences double-exponentially, and
efficiently isolates small representative sequences of large
differences. We hypothesize that prostate cancer cells contain
deletions that harbor genes important in cancer development. To
initiate the study, we chose to perform DSC on a case of aggressive
prostate cancer to examine the DNA sequences that were deleted from the
genome. We generated mixtures of DSC subtraction products using
BamHI and EcoRI genomic amplicons derived from
the prostate cancer (drivers) to subtract the counterparts from blood
cells (testers) of the same patients (Figure 1)
. These products were PCR-amplified,
ligated into TA cloning vector, and subsequently transfected into
competent E. coli. To select DSC products that represent
deletions in the cancer genome, 304 colonies were picked and screened
by hybridization with amplicon probes derived from cancer or blood
cells. Colonies were selected when they hybridized with amplicons from
blood cells but were negative with cancer. We sequenced DNA from the
colonies of interest, and synthesized primers corresponding to these
sequences. PCR was performed on the genomic DNA templates to determine
the presence of deletions. Although many of these probes represent loss
of heterozygosity or loss of alleles, seven were found to represent the
regions of homozygous deletion (Figure 1C)
.
View larger version (56K):
[in this window]
[in a new window]
|
Figure 1. DSC enrichment of amplicons that are deleted in prostate cancer.
A: Agarose electrophoresis of DSC products using blood
amplicons (EcoRI) as testers
and tumor amplicons (EcoRI) as
drivers, after round 0 (lane
1), round 1
(lane 2),
round 2 (lane
3), and round 3
(lane 4) of
subtraction. B: Screening of DSC products from round 2 and
round 3 DSC of A with 32P-labeled
tumor amplicons or blood amplicons. C: Electrophoresis of
PCR products from selected primers using microdissected genome
templates from tumor (lanes 2,
4, 6, 8, 10, 12,
14, and 16) and its
matched blood cells (lanes 1,
3, 5, 7, 9, 11,
13, and 15) with
primers11D (lanes 1 and
2), 12D
(lanes 3 and
4), 12C
(lanes 5 and
6), 1E
(lanes 7 and
8), 1F
(lanes 9 and
10), 5F
(lanes 11 and
12), 1G
(lanes 13 and
14), and 12G
(control primers, lanes 15 and
16).
|
|
To evaluate the frequency of genomic deletion in these regions among
prostate cancers, we used six pairs of primers specific to these
sequences to screen a panel of 18 cases of prostate cancer tissues and
cell lines. More than 50% (10 of 19, including the case used for DSC)
of the cases contained deletion in a specific (12C) sequence (Figure 2)
. Screening with other DSC probes
representing homozygous deletions of the initial case on the same
panel, however, revealed no additional deletion (data not shown),
suggesting that these homozygous deletions were only specific to the
initial case. These results probably reflect the heterogeneity of
prostate cancers.
To determine the chromosomal location of 12C, we screened the
Genebridge 4 hamster radiation hybrid panel using primers specific for
12C, and located this probe to the locus of 4q25-26. Because 12C is a
small sequence that represents larger deletions in the genomes,
deletion mapping by PCR using a panel of primers specific for markers
(25 pairs) adjacent to 12C were performed on the templates of the panel
cases. We identified various sizes of deletions, ranging from 500 kbp
to >23 mega-bp among the analyzed cases, and mapped a minimum common
deletion region of at least 54 kb (Figure 2)
.
To identify genes that might lie in the minimum common deletion region,
we used marker sequences within the region to perform a homology search
in the GenBank through the National Center for Biotechnology
Information (NCBI) BLAST program. One marker generated a
complete match with the myopodin coding sequence. The 4.2-kb mRNA
transcript encodes a 698-amino acid protein with a predicted molecular
weight of 83 kd (Figure 3A)
. The
C-terminus of myopodin shares significant homology with synatopodin
(Figure 3B)
,9,10
a protein that is expressed in neurons
and podocytes, and is involved in modulating actin-based shape and
forming synaptic contact. Its expression is closely correlated with
neuron or podocyte differentiation and stress.11,12
The
N-terminus of myopodin contains a stretch of acidic amino acids, and
shares homology with a group of nuclear localization proteins (Figure 3C)
.13-17
The physiological function of myopodin is not
entirely clear. However, based on its homology to synaptopodin, one can
hypothesize that the protein may play a role in maintaining cell shape
and initiate cell-cell contact. Because synaptopodin is a marker of
terminal differentiation, the expression of which is inactivated when
cells proliferate,9,10
it is possible that the expression
of myopodin is similarly related to differentiation and plays an
important role in maintaining cell shape that prevents mitosis.
View larger version (80K):
[in this window]
[in a new window]
|
Figure 3. Sequence of myopodin gene and its homology with synaptopodin and other
proteins. A: Nucleotide sequence and the predicted amino
acid sequence of myopodin. The open reading frame of myopodin predicts
a 698-amino acid protein. B: Amino acid sequence homology of
myopodin with synaptopodin. Significant homology between myopodin and
synaptopodin were found in six stretches of sequences of myopodin.
C: Homology of myopodin sequence with several other
proteins. An acidic amino acid-rich domain was found in the N-terminal
sequence of myopodin, and it shares significant homology with several
nuclear localization proteins.
|
|
Northern blot analysis indicated that myopodin was abundantly expressed
in skeletal muscle, but also expressed in organs such as prostate, and
small and large intestine (Figure 4A)
.
In situ hybridization suggested that myopodin was primarily
expressed in prostate epithelium with the strongest expression in the
acinar cell layer (Figure 4B)
.
View larger version (84K):
[in this window]
[in a new window]
|
Figure 4. Expression distribution of myopodin. A: Northern blot
analysis of myopodin expression in 23 organ tissues. Twenty µg of
total RNA of pancreas (lane
1), kidney
(lane 2),
skeletal muscle (lane
3), liver
(lane 4), lung
(lane 5),
placenta (lane
6), brain
(lane 7),
heart (lane
8), leukocytes
(lane 9),
testes (lane
10), colon
(lane 11),
ovary (lane
12), small intestine
(lane 13),
prostate (lane
14), thymus
(lane 15),
spleen (lane
16), stomach
(lane 17),
thyroid (lane
18), spinal cord
(lane 19),
lymph node (lane
20), trachea
(lane 21),
adrenal gland (lane
22), and bone marrow
(lane 23) were
electrophoresed, Northern transferred to nylon membranes, and
hybridized with a probe derived from exon 2 of myopodin. ß-actin was
used as the positive controls. B: In situ
hybridization of prostate tissues with myopodin gene. A case of
prostate cancer with deletion of myopodin gene was hybridized with a
cocktail of digoxigenin-labeled antisense oligonucleotides
corresponding to exon 2 of myopodin. H&E stain
(left) and
in situ hybridization
(right) of the
sections were shown for normal
(top) and
carcinoma
(bottom).
|
|
To determine whether partial deletions of myopodin gene are present in
prostate cancers, a panel (39 cases) of DNA templates from
microdissected prostate cancer samples was examined. PCR was performed
with a set of primers overlapping the sequences for entire exon 1 and
exon 2 of myopodin. More than 30% (12 of 39) of the cases were found
to contain partial deletions in the exon 2 of myopodin. These deletions
cover a range of sites within the gene. Most of the deletions (>90%),
however, involve sequences that contain homology with synaptopodin
(Figure 5)
. One case contained a small
deletion in the 3'-untranslated region, whereas two contained deletion
spanning the entire exon 2. Nine cases contain complete deletion of
myopodin. Interestingly, no partial deletion was identified in exon 1,
which contained the mRNA start site and some of the untranslated leader
sequence.
View larger version (15K):
[in this window]
[in a new window]
|
Figure 5. Partial deletion of myopodin gene in prostate cancers. A 2.4-kb intron
separates exon 1 and exon 2 of myopodin. The exon/intron boundary for
myopodin is identified by mapping the mRNA sequence of myopodin to
human genome draft through NCBI’s BLAST program. Nonshaded area
represents noncoding region, and green-shaded area represents coding
sequence.
represents acidic amino acid domain. The black stripes
represent sequences containing homology with synaptopodin. PCRs were
performed on genomic DNA of a panel of 39 cases of prostate cancers
using primers in Table 1
to determine the presence of partial deletion.
Deletions were further confirmed by sequencing on the PCR products.
|
|
To characterize the prostate cancers that contain myopodin deletion, we
categorized these cases by the invasiveness of the cancers, ie, 1)
minimally invasive, by lack of evidence of capsular penetration or
adjacent organ invasion, and by lack of disease progression and
cancer-related deaths after radical prostatectomy; 2) invasive, by
evidence of tumor penetration through the prostate capsule; 3) highly
invasive, by evidence of tumor invading into seminal vesicles or
adjacent organs; and 4) relapsing, by evidence of progression of the
disease or deaths due to prostate cancer after radical prostatectomy
regardless of evidence of cancer invasiveness at the time of surgery.
As demonstrated in Tables 2 and 3
, the majority of the prostate cancers
with myopodin deletion demonstrates a high level of invasion (>92%
was at least invasive). Seven of nine relapsing cases contained partial
or complete myopodin deletion. More than 84% of the cases with
capsular penetration contained myopodin deletion. Interestingly, three
cases were defined as organ-confined tumors at the time of radical
prostatectomy, but relapse of cancer identified later. Myopodin
deletions were identified in two of these three cases. Only 2 of 27
(7%) prostate cancers with myopodin deletion were identified as
minimally invasive. An exact Mantel-Cox Test for trend was tested for
myopodin deletion association with invasiveness and was found
significant (P = 0.0002). The myopodin deletion
rates were similar among invasive, highly invasive, and relapsing cases
and higher than for minimally invasive cancers. A permutation test with
general scores (1-3-3-3 for minimally invasive, invasive, highly
invasive, and relapsed, respectively) was significant
(P < 0.0001) indicating a significant increase
in myopodin gene deletion among cases with extracapsular penetration or
relapse. In contrast, Gleason grading produced a far less clear
conclusion, eg, 57% of the minimally invasive prostate cancer was
graded as poorly differentiated based on the Gleason grading (
7), and
54% of the invasive tumor was graded as well to moderately
differentiated carcinoma (Gleason 
6). The poorly differentiated
tumors represented only 56% (5 of 9) of the relapsing cases.
Approximately 66% of the well-differentiated to moderately
differentiated cancers were classified as invasive or higher compared
to 70% of the poorly differentiated cases. A Gleason score cut-off of
7 or higher was also tested for Mantel-Cox test for association with
invasiveness, and found to be independent of degree of invasiveness
(Mantel-Cox, P = 0.5909). Nevertheless, invasion of
seminal vesicles by prostate cancers was closely correlated with high
Gleason grades (>88%).
Two recent comparative genomic hybridization studies indicated that up
to 18% of sporadic prostate cancers contain abnormalities or deletions
in the chromosome 4q,18,19
representing one of the most
frequent deletion sites and suggested the presence of a tumor
suppressor gene in the locus. In this report, we have uncovered
myopodin that is frequently deleted in aggressive prostate cancers, and
interestingly, is similarly located in chromosome 4q. The homology of
myopodin with synaptopodin implies that myopodin may be one of the
terminal differentiation protein that interacts with actin and
maintains cell morphology and cell-cell contact. Our study indicates
that deletion of myopodin, either partial or complete, is closely
correlated with the invasiveness of prostate cancers. The high rate of
deletions of myopodin in invasive prostate cancers and myopodin’s
homology with synaptopodin suggest that myopodin may play a role in
maintaining normal cell-cell contact under physiological conditions.
Interestingly, deletion of myopodin seems to produce higher specific
rates in predicting the clinical outcome (relapse) or in reflecting the
cancer behavior (pathology defined invasion) than the morphological
grading system (Gleason grading) does. Thus, myopodin may hold promise
as an important prognostic marker for prostate cancers.
|
Acknowledgements
|
|---|
We thank Susan Leeds for the manuscript editing, Tracy Wagner and
Petrina DeFlavia for supplying the tissues, and Alan Wells for
constructive comment on the manuscript.
|
Footnotes
|
|---|
Address reprint requests to Jian-Hua Luo, Department of Pathology, University of Pittsburgh School of Medicine, Scaife Hall A-725, 3550 Terrace St., Pittsburgh, PA 15260. E-mail: luoj{at}msx.upmc.edu
Supported by a grant from National Cancer Institute (1UO1CA88110–01 to G. M.) and a grant from American Cancer Society (CRTG-00-139-01-CCE to J. H. L.).
F. L. and Y.-P. Y. both contributed equally to this work.
Accepted for publication July 27, 2001.
|
References
|
|---|
-
Greenlee RT, Murray T, Bolden S, Wingo PA: Cancer statistics, 2000. CA Cancer J Clin 2000, 50:7-33[Abstract]
-
Smith JR, Freije D, Carpten JD, Gronberg H, Xu J, Isaacs SD, Brownstein MJ, Bova GS, Guo H, Bujnovszky P, Nusskern DR, Damber JE, Bergh A, Emanuelsson M, Kallioniemi OP, Walker-Daniels J, Bailey-Wilson JE, Beaty TH, Meyers DA, Walsh PC, Collins FS, Trent JM, Isaacs WB: Major susceptibility locus for prostate cancer on chromosome 1 suggested by a genome-wide search. Science 1996, 274:1301-1304[Free Full Text]
-
Lalani EN, Stubbs A, Stamp GWH: Prostate cancer; the interface between pathology and basic scientific research. Semin Cancer Biol 1997, 8:53-59[Medline]
-
Luo JH, Puc JA, Slosberg ED, Yao Y, Bruce JN, Wright TC, Becich MJ, Parsons R: Differential subtraction chain, a method for identifying differences in genomic DNA and mRNA. Nucleic Acids Res 1999, 27:24e, i-viii
-
Porfiri E, Rubinfeld B, Albert I, Hovanes K, Waterman M, Polakis P: Induction of a ß-catenin-LEF-1 complex by wnt-1 and transforming mutants of ß-catenin. Oncogene 1997, 15:2833-2838[Medline]
-
Yu YP, Lin F, Bisceglia M, Krill D, Dhir R, Becich M, Luo J-H: Identification of a novel gene with increasing rate of suppression in high grade prostate cancers. Am J Pathol 2001, 58:19-24[Medline]
-
Good P: Permutation Tests. 1984:pp 90-93 Springer-Verlag, Edited by P Good. New York
-
Breslow N, Day N: The analysis of case control studies. Breslow N Day N eds. Statistical Methods in Cancer Research, volume I. 1980, :pp 148 France, IARC Scientific Publications No 32, Lyon
-
Mundel P, Heid HW, Mundel TM, Kruger M, Reiser J, Kriz W: Synaptopodin, an actin-associated protein in telencephalic dendrites and renal podocytes. J Cell Biol 1997, 139:193-204[Abstract/Free Full Text]
-
Deller T, Mundel P, Frotscher M: Potential role of synaptopodin in spine motility by coupling actin to the spine apparatus. Hippocampus 2000, 10:569-581[Medline]
-
Barisoni L, Mokrzycki M, Sablay L, Nagata M, Yamase H, Mundel P: Podocyte cell cycle regulation and proliferation in collapsing glomerulopathies. Kidney Int 2000, 58:137-143[Medline]
-
Barisoni L, Bruggeman LA, Mundel P, D’Agati VD, Klotman PE: HIV-1 induces renal epithelial dedifferentiation in a transgenic model of HIV-associated nephropathy. Kidney Int 2000, 58:173-181[Medline]
-
Stone BL, Thummel CS: The drosophila 78C early late puff contains E78, an ecdysone-inducible gene that encodes a novel member of the nuclear hormone receptor superfamily. Cell 1993, 75:307-320[Medline]
-
Mitsui K, Matsumoto A, Ohtsuka S, Ohtsubo M, Yoshimura A: Cloning and characterization of a novel p21cip1/waf1-interacting zinc finger protein. Ciz1 Biochem Biophysical Res Comm 1999, 264:457-464
-
Fisher LW, Torchia DA, Fohr B, Young MF, Fedarko NS: Flexible structures of SIBLING proteins, bone sialoprotein and osteopontin. Biochem Biophys Res Commun 2001, 280:460-465[Medline]
-
Russell SR, Heimbeck G, Goddard CM, Carpenter AT, Ashburner M: The Drosophila Eip78C gene is not vital but has a role in regulating chromosome puffs. Genetics 1996, 144:159-170[Abstract]
-
Bryant Z, Subrahmanyan L, Tworoger M, Latray L, Liu CR, Li MJ, van den Engh G, Ruohola-Baker H: Characterization of differentially expressed genes in purified Drosophila follicle cells: toward a general strategy for cell type-specific developmental analysis. Proc Natl Acad Sci USA 1999, 96:5559-5564[Abstract/Free Full Text]
-
Suarez BK, Lin J, Burmester JK, Broman KW, Weber JL, Banerjee TK, Goddard KA, Witte JS, Elston RC, Catalona WJ: A genome screen of multiplex sibships with prostate cancer. Am J Hum Genet 2000, 66:933-944[Medline]
-
Alers JC, Rochat J, Krijtenburg PJ, Hop WC, Kranse R, Rosenberg C, Tanke HJ, Schroder FH, van Dekken H: Identification of genetic markers for prostatic cancer progression. Lab Invest 2000, 80:931-942[Medline]
This article has been cited by other articles:
|
|
|
|
 
Y. P. Yu and J.-H. Luo
Myopodin-mediated suppression of prostate cancer cell migration involves interaction with zyxin.
Cancer Res.,
August 1, 2006;
66(15):
7414 - 7419.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. P. Yu, D. Landsittel, L. Jing, J. Nelson, B. Ren, L. Liu, C. McDonald, R. Thomas, R. Dhir, S. Finkelstein, et al.
Gene Expression Alterations in Prostate Cancer Predicting Tumor Aggression and Preceding Development of Malignancy
J. Clin. Oncol.,
July 15, 2004;
22(14):
2790 - 2799.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Jing, L. Liu, Y. P. Yu, R. Dhir, M. Acquafondada, D. Landsittel, K. Cieply, A. Wells, and J.-H. Luo
Expression of Myopodin Induces Suppression of Tumor Growth and Metastasis
Am. J. Pathol.,
May 1, 2004;
164(5):
1799 - 1806.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
