| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Animal Model |
From the Departments of Pathology,*
Laboratory
Medicine,
and Biological
Structure,
University of Washington,
Seattle, Washington
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Clinical manifestations of cryoglobulinemia can include involvement of the skin, kidney, central nervous system, gut, vascular system, and the lung.6 The typical renal manifestation is a membranoproliferative pattern of glomerulonephritis with periodic acid-Schiff (PAS)-positive deposits (containing the cryoglobulins in immune complexes) filling capillary lumina (hyaline thrombi), endocapillary proliferation with prominent infiltration of capillaries by monocyte/macrophages, and, at times, vasculitis involving small- and medium-sized renal arteries.12,13 The pathogenesis of this important form of glomerulonephritis is still incompletely understood. In part this has been because of the lack of a reliable animal model of this disease process.
Thymic stromal lymphopoietin (TSLP) has been isolated from conditioned
medium of a thymic stromal cell line and supports differentiation of
IgM-positive B cells.14,15
This 140-amino acid protein
supports the growth of pre-B cell colonies and promotes co-mitogenic
activity in fetal thymocytes.15
TSLP functions via a
complex of the TSLP receptor and the IL-7 receptor 
chain.16,17
Those are co-expressed on monocytes, dendritic
cells, and T cells.18
No expression of the TSLP receptor
was detected in various nonlymphoid fetal tissues including fetal
heart, liver, lung, and kidney.18
Here we describe that overexpression of TSLP results in cryoglobulin formation and a systemic inflammatory disease involving the kidney, liver, spleen, lungs, and the skin. We demonstrate that such mice consistently develop a pattern of MPGN closely resembling the disease seen in humans, with a predictable disease course, and which demonstrates a surprising stability of the injury pattern after its induction. This represents the first reproducible mouse model of mixed cryoglobulinemia-associated MPGN.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The establishment of the TSLP transgenic mouse strain (FF8) under the control of the proximal lck promoter and details about the development of lymphoid organs in these mice will be described separately (A. Farr, manuscript in preparation). The lck gene encodes a lymphocyte-specific protein-tyrosine kinase, p56lck. The lck proximal promoter is preferentially active in early thymocyte development.19,20 TSLP transgenic mice were derived from a single founder. Mice were maintained in a specific pathogen-free facility, with food and water ad libitum, and under a 12-hour light/dark cycle. All animal studies were reviewed and approved by the Animal Care Committee of the University of Washington, Seattle, WA. TSLP transgenic mice were backcrossed for more than eight generations to a C57BL6 background. TSLP transgenic males were mated with wild-type C57BL6 females. At 3 weeks of age, pups were weaned, labeled by ear-tag, and tail tips were acquired for genotyping.
Study Design
The main study group consisted of a total of 123 mice, including 61 TSLP transgenic mice and 62 wild-type controls. At least five TSLP transgenic males and five controls were sacrificed at monthly intervals up to 7 months of age (total n = 75). An equal number of female mice were sacrificed at 1, 1.5, 2, and 2.5 months of age (total n = 48). Furthermore, laboratory data were acquired on an additional series of 27 TSLP transgenic and 16 wild-type controls that were the pilot cohort from which patterns of disease studied in the prospective, serial sacrifice study were first identified.
Preparation of DNA and Genotyping
The DNeasy tissue kit (Qiagen Inc., Valencia, CA) was used according to the protocol of the manufacturer for DNA isolation. The tail-tips were incubated overnight at 55°C in a mixture containing 180 µl of buffer ATL and 20 µl of Proteinase K (Qiagen Inc.). After spinning, the supernatant was removed, mixed with 400 µl of buffer AL-ethanol buffer mixture (Qiagen Inc.). The mixture was transferred to a DNeasy mini column, centrifuged, and subsequently washed with buffer AW1 and AW2 (Qiagen Inc.). The DNA was eluted in AE buffer (Qiagen Inc.), and the DNA concentration was calculated by the UV absorption at 260 nm. Mice were genotyped using polymerase chain reaction primers: 5'TGCAAGTACTAGTACGGATGGGGC3' from the 5' end of the coding region of the TSLP gene and 5'GGACTTCTTGTGCCA TTTCCTGAG3' from the 3' end of the coding region of the TSLP gene. TSLP transgenic animals demonstrate a product of 323 bp. The polymerase chain reaction contained DNA, 1x Enzyme Storage Buffer B, 2.5 mmol/L MgCl, 400 nmol/L of each primer, 0.2 mmol/L dNTP, and 1.25 U of Taq DNA polymerase (all from Promega Corp., Madison, WI) in a 50-µl polymerase chain reaction. Cycling conditions were: 94°C for 2 minutes, followed by 34 cycles of 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds and finally 72°C for 5 minutes.
Tissue Collection
Mice were weighed, anesthetized, and blood was drawn by cardiac puncture into a prewarmed syringe at the time of sacrifice. Spleen, kidneys, liver, lungs, heart, thymus, ears, and bone were collected and portions of each fixed in 10% neutral-buffered formalin, in methyl Carnoys solution (60% methanol, 30% chloroform, 10% acetic acid), in half-strength Karnovsky’s solution (1% paraformaldehyde and 1.25% glutaraldehyde in 0.1 mol/L Na cacodylate buffer, pH 7.0) and in part snap-frozen in Tissue-Tek (Sakura Finetek, Torrance, CA). Formalin-fixed and methyl Carnoys-fixed tissues were subsequently embedded in paraffin using routine protocols. Kidneys were sectioned at 2 µm and stained using hematoxylin and eosin (H&E), PAS, and periodic acid methenamine silver stain (silver stain).21 Other organs were embedded in paraffin, cut at 4 µm, and stained with H&E. Snap-frozen kidneys were cut at 6 µm, air-dried, and fixed in ice-cold acetone for 10 minutes.
Immunofluorescence
Acetone-fixed sections were air-dried and repeatedly washed in phosphate-buffered saline (PBS; pH 7.4). Sections were incubated with fluorescein-conjugated antibodies against mouse IgA, mouse IgG, mouse IgM, and mouse complement C3 (all from Cappel Pharmaceuticals, Aurora, OH). After subsequent washing steps in PBS, slides were mounted in Vectashield mounting media (Vector, Burlingame, CA), coverslipped, and viewed in a Zeiss fluorescence microscope. In a blinded manner a semiquantitative score was applied to describe the fluorescence intensity (0, negative; 1, weak; 2, moderate; 3, strong).
Immunohistochemistry
The protocols for immunohistochemistry have previously been described in detail.22,23 T cells were detected using a monoclonal rat anti-CD3 antibody (clone number CD3-2; Serotec, Raleigh, NC), glomerular macrophages were detected using a rat anti-mouse MAC-2 antibody (Cederlane, Ontario, Canada24 ), B cells were detected using a monoclonal rat anti-mouse CD45 RA antibody (Pharmingen, San Diego, CA), and leukocytes with an antibody against CD45 common on all leukocytes (clone number 30-F11, Pharmingen).25 Serial 2-µm sections of formalin-fixed or methyl Carnoys-fixed and paraffin-embedded tissue were used. Antigen retrieval by steam heating was performed on deparaffinized and rehydrated slides in Antigen Unmasking Solution (Vector) when necessary. Endogenous peroxidases were blocked by incubation with hydrogen peroxide and endogenous biotin was blocked using an Avidin/Biotin blocking kit (Vector). Incubation with primary antibodies was done for 1 hour or overnight, diluted in PBS containing 1% bovine serum albumin (Sigma, St. Louis, MO). After subsequent washing in PBS the tissue was incubated with the biotinylated secondary antibody (rabbit anti-rat, Vector). The ABC-Elite reagent (Vector) was used for signal amplification and 3,3'-diaminobenzidine with nickel enhancement, resulting in a black color product, was used as chromogen. Slides were counterstained with methyl green, dehydrated, and coverslipped.
Electron Microscopy
The protocol for tissue preparation and staining for transmission electron microscopy has been described previously.26 Grids were scanned using a Philips 410 electron microscope (Philips Export BV, Eindhoven, The Netherlands). At least six tubular structures present in the immune deposits in four cases of MPGN were measured in high-magnification electron micrographs (x7100 or x10,400) using a Digimatic caliper (Mitutoyo Corp., Japan) for the calculation of the mean diameter.
Serum Evaluation (Cryoglobulin Isolation, Immunofixation, Anti-Nuclear Antibodies (ANAs), and Blood Urea Nitrogen)
Blood was allowed to clot at 37°C, and serum was collected after centrifugation at 2800 rpm for 30 minutes. Serum samples were kept at 4°C for several days, and formation of cryoprecipitates were identified by visual inspection. Cryoprecipitates were washed four times with ice-cold 0.85% sodium chloride solution (Fisher Scientific, Pittsburgh, PA) and resuspended in 40 µl of a sodium chloride solution. Cryoprecipitates were redissolved at 37°C before further characterization. The components of the cryoprecipitates were evaluated by agarose gel electrophoresis and immunofixation, and the involved Ig isotypes were evaluated using a Mouse Monoclonal Antibody Isotyping Kit (Life Technologies, Inc., Gaithersburg, MD).
Two µl of serum or cryoprecipitate were applied to 0.8% agarose gels (CLP, San Diego, CA) on gel support film (Bio-Rad Laboratories, Hercules, CA). Proteins were separated by electrophoresis in barbital buffer (50 mmol/L sodium barbital (Sigma), 2 mmol/L calcium lactate, pH 8.6) for 35 minutes. Gels were fixed for 10 minutes in a solution consisting of 83.3% saturated picric Acid (Sigma) and 16.7% glacial acetic acid (Sigma), dried, and stained with amido black (ICN Pharmaceuticals, Inc., Costa Mesa, CA).
Gels for immunofixation were incubated with antibodies against mouse IgG (Vector), mouse IgM (Sigma), mouse kappa light chain (clone EM 34.1, Sigma), and mouse lambda light chain (clone 9A8, Sigma) for 1.5 hours. Gels were subsequently dried, washed in 0.85% sodium chloride solution (Fisher Scientific) for 2 hours, dried, and stained with brilliant blue (Sigma). The Mouse Monoclonal Antibody Isotyping Kit (Life Technologies) was used according to the instructions provided by the manufacturer.
Blood urea nitrogen, a measure of renal excretory function, was measured using a standard clinical chemistry analyzer (LX-20; Beckman Laboratories, Brea, CA). The presence of ANAs were examined using the HEP-2 human epithelial cell line as substrate, and anti-double-stranded DNA (dsDNA) antibodies were detected by binding to the Crithidia luciliae substrate (both from Sanofi Diagnostics Pasteur/BioRad, Redmond, WA). For ANA testing, mouse sera were diluted 1:40, and for dsDNA testing sera were diluted to 1:10. Fluorescein-labeled goat antibodies to mouse IgG (Sigma) were used to detect the murine antibodies bound to the substrate.
Urinary Albumin and Creatinine
Urine samples were evaluated for proteinuria using the albumin/creatinine ratio. Albuminuria was measured using the Albuwell (Exocell, Inc., Philadelphia, PA) mouse albumin enzyme-linked immunosorbent assay and creatinine using the Creatinine Companion (Exocell) according to the protocols of the manufacturer.
Analysis and Statistics
Morphometric analysis was performed on H&E- and silver-stained histological sections as well as on histological sections stained for macrophages. In a blinded manner 15 consecutive glomerular cross-sections were photographed using a digital camera (Olympus DP11; Olympus America Inc., Melville, NY), and imported into Image-Pro Plus (Media Cybernetics, Silver Spring, MD). The number of nuclei, the area of mesangial matrix, the area occupied by macrophages (determined by measuring all intracellular areas marked by the macrophage cytoplasmic marker Mac-2), and the glomerular tuft area (independent of the urinary space) were quantified for each glomerular cross-section. Using the InStat program (Version 3.0 for Windows; Intuitive Software for Science, San Diego, CA), the mean numbers were compared using the nonparametric Kruskal-Wallis test and the Dunn’s multiple comparison. A P < 0.05 was considered to be statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Wild-type females (C57BL6) were mated with TSLP transgenic males on the same genetic background (backcrossed for more than eight generations). Of 256 mice, born during 8 months, 132 were TSLP transgenic (51.6%) and 124 (48.4%) were wild types. The male to female ratio was 0.98 to 1.02. During this time period 17 mice died spontaneously, 5 transgenic males between 40 and 209 days of age and 12 females between 35 and 99 days of age. The higher and earlier mortality of females led us to separate the study groups by gender and include earlier time points for females.
The most impressive clinical symptoms for the entire cohort were
progressive ulcerative lesions of the ears. The first manifestation was
usually on the side of the ear-tag. Ear involvement was present in
eight males at the time of sacrifice, with an age range from 81 to 203
days, but only in one female, sacrificed at the age of 56 days.
Although a prominent symptom, the mice did not seem to be clinically
impaired by these lesions. The mean body weights rose with age in all
groups, but were slightly lower in transgenic animals as compared to
wild-type controls. The difference was more prominent in females and at
early time points (eg, at the age of 1 month the mean body weights of
females were 11.7 ± 0.3 g for wild-type and 8.8 ±
0.8 g for TSLP transgenic mice, respectively). The TSLP transgenic
groups included mice with very low body weights (see range in Table 1
).
|
and
Figures 1 and 2
). The enlarged spleen commonly
compressed the upper part of the left kidney (Figure 1E)
. The mean
weight of spleens from TSLP transgenic mice was almost five times that
of wild-type controls. Although there was marked splenic hypertrophy,
histological examination revealed preservation of splenic architecture
and cellular diversity and no evidence of a neoplastic population.
Furthermore, TSLP transgenic mice showed significantly higher weights
of the lungs and the liver.
|
|
. Eosinophils formed a
significant part of the infiltrating leukocytes. Later the alveoli and
interstitial spaces from TSLP transgenic mice were filled with
macrophages containing eosinophilic material, and commonly, crystals
(Figure 2C)
. We attribute the principal cause of death during the
disease course to the severe lung involvement as most of the alveoli
were occluded by this inflammatory infiltrate at late time points. The
liver involvement began with small perivenous leukocyte infiltrates,
which then increased in size, and infiltrated deeper into the liver
parenchyma (Figure 2, D, E, and F)
. The lesion did not progress to a
cirrhotic degeneration of the liver within the time frame of our study.
No weight differences were found for the heart, although some TSLP
transgenic mice demonstrated a prominent enlargement of the heart,
detectable by visual examination at necropsy. The mediastinal tissue
was increased because of prominent enlargement of lymph nodes and
infiltration by leukocytes (Figure 2, I and N)
. The normal structure of
the thymus was no longer apparent (Figure 2, M and N)
. TSLP Transgenic Mice Develop Mixed Cryoglobulins and Proteinuria, but only a Minor Decrease in Excretory Renal Function
One hundred fifteen sera were evaluated for cryoprecipitates.
Forty-seven samples contained visible cryoprecipitates after storage at
4°C (Figure 1A)
. All samples were from TSLP transgenic mice,
including 29 of 36 TSLP transgenic males and 18 of 20 TSLP transgenic
females undergoing such evaluation. None of the wild-type samples
contained visible cryoprecipitates. The cryoprecipitates of selected
cases were further evaluated by immunofixation for IgM, IgG, kappa
light chains, and lambda light chains (n = 9,
Figure 1
). All nine studied cases contained type III cryoglobulins,
consisting of polyclonal IgM and polyclonal IgG. Dipstick isotype
analysis was performed in six cases. All cryoglobulins were positive
for IgG1, IgM, and kappa and lambda light chains. IgG3 was detectable
in two cases, IgG2A and IgA were detectable in one case each.
Electrophoresis of serum demonstrated a prominent polyclonal increase
of the 
region in TSLP transgenic animals, consistent with a
polyclonal B cell activation (Figure 1C)
.
ANA and dsDNA antibodies were studied in a preliminary cohort of TSLP transgenic mice and controls (see Material and Methods). ANAs were detected in 11 of 25 TSLP transgenic mice, but not in wild-type controls. No dsDNA antibodies were detected in the tested animals. The serological tests and immunofixation of the cryoprecipitates were selectively performed because of the limited amounts of mouse serum obtainable and that were insufficient for a multitude of tests in the same small animal.
Renal function was evaluated by measurement of blood urea
nitrogen (Table 1)
. TSLP transgenic mice of both genders showed a
significant increase in blood urea nitrogen compared to wild-type mice
(Table 1)
. Although statistically significant, the differences were
small and the decrease of excretory renal function might therefore not
be of clinical importance. Forty-six animals were evaluated for
proteinuria at the time of sacrifice. Both genders showed a
significantly increased albumin excretion, with an albumin/creatinine
ratio increase by 
2.5-fold in TSLP transgenic males and fivefold in
TSLP transgenic females compared to wild-type mice (Table 1)
.
TSLP Transgenic Mice Develop a Cryoglobulinemic Glomerulonephritis
The kidneys appeared macroscopically normal in size, with a normal surface, and the weight was not different compared to wild-type controls.
The time course of the glomerular lesions is illustrated in Figure 3
and the details in Figure 4
. After the age of 1 month all TSLP
transgenic animals demonstrated renal lesions. TSLP transgenic mice of
both genders showed a widening of the mesangial area. This was because
of an increase in mesangial matrix and mesangial deposits of immune
complexes. The deposits could be distinguished on silver staining by
lack of reactivity with the silver stain, unlike the silver staining of
mesangial matrix (Figure 4, B and E)
. No prominent increase in
glomerular cell numbers was apparent. The widening of the mesangial
area became apparent during the first month of age, and was more
prominent in females at early time points (eg, 1 to 2 months of age)
than in males (Figures 3 and 4B)
. Capillary walls were thickened,
sometimes with prominent double contours of the capillary walls, as
revealed by silver stains (Figures 3H and 4F)
. PAS-positive deposits
were present in the mesangium and in capillary walls. These deposits
narrowed the capillary lumina, and these intracapillary globular
thrombi appeared to cause complete capillary occlusion (Figure 4, C and D)
. Therefore, with progression of the disease course the number of
patent capillary lumina decreased. A lobular accentuation of the
glomerular tuft architecture was commonly apparent. In the most severe
cases, the mesangium was widened, and most of the capillary lumina were
occluded. In contrast, globally sclerotic glomeruli were absent and the
tubulointerstitium was well preserved in all cases, without significant
inflammation or fibrosis (Figure 4, D and E)
. No leukocytic infiltrates
were found in arterial walls.
|
|
, and Table 2
). TSLP transgenic mice demonstrated a
significant increase in the proportion of each glomerulus occupied by
extracellular matrix (Table 2)
. The glomerular tuft area was increased
in TSLP transgenic animals of both genders, but the difference compared
to wild-type controls reached the level of significance only in male
mice. The cell number per glomerulus was significantly increased in
TSLP transgenic animals, but the cell number adjusted for glomerular
tuft area did not change during the disease course. Therefore, the
lesion in TSLP transgenic mice is characterized by increased glomerular
size, an absolute increase in the cell number per glomerulus, and an
increase of glomerular extracellular matrix. The time course covering
the first 2 months in females and the first 7 months in males (Figures 5 and 6)
illustrates that the increase in extracellular matrix and in
cells per glomerulus took place at the onset of the disease course,
within the first 2 months, and then reached a plateau. Both features
seemed to be more pronounced in TSLP transgenic females as compared to
males at early time points.
|
|
|
and
Table 3
). Mild to moderate deposition of
all three Igs were detectable in wild-type controls and were pronounced
in males as compared to females. C3 deposition was only occasionally
detected in glomeruli from wild-type mice. Compared with wild-type
mice, TSLP transgenic mice demonstrated Ig deposits with greater
fluorescence signals. TSLP transgenic females demonstrated
significantly increased scores for all three types of Igs and C3, in
TSLP transgenic males the scores for IgG, IgA, and C3 were
significantly elevated (Table 3
, Figure 7
). The deposits were found in
the mesangium and in peripheral glomerular capillaries with a granular
pattern of deposition. Some cases contained IgM in deposits that filled
capillary lumina (comparable in shape to the described PAS-positive
globular deposits). In these cases the glomerular distribution of IgG
(Figure 7, E and F)
and C3 (Figure 7, H and I)
was similar to the IgM
distribution pattern. However, C3 staining was weaker and more focal in
nature compared with IgG and IgM staining. In addition to
glomerular deposits, TSLP transgenic animals demonstrated
immunoreactivity of all three Ig classes in the peritubular
interstitium. In contrast, interstitial C3 deposition was weak or
absent, without differences between wild-type and TSLP transgenic
animals.
|
|
. The area
occupied by macrophages rose progressively in TSLP transgenic females
during the first 3 months of life (Figure 5)
. In males the macrophage
area peaked during the third and fourth month of life and then
gradually decreased (Figure 6)
.
The ultrastructure of the renal lesions was further evaluated by
transmission electron microscopy in selected cases (Figures 8 and 9)
.
Electron-dense immune deposits were apparent in the mesangium as well
as in the subendothelial space in TSLP transgenic mice (Figure 8)
.
Podocyte foot processes were usually well preserved, but foot process
effacement was seen in areas of capillary walls involved by immune
deposits (Figure 8, A and C)
. The endothelial cells covering the immune
deposits demonstrated signs of activation, with cellular swelling and
absence of the normal pores. Subendothelial deposits and cellular
interposition were accompanied by splitting of capillary walls.
Leukocytes were present in capillary lumina, some adherent to
endothelial cells, and some were found infiltrating the mesangium.
Occasional basophils were seen in the capillary lumen and in the
mesangium. At higher magnification the deposits commonly demonstrated
organization in the form of microtubules arranged in arrays (Figures 8C and 9)
. Measurement of these tubules in four cases revealed an
approximate mean diameter of 41, 44, 53, and 55 nm.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MPGN has been described as a secondary consequence of a wide range of underlying diseases, primarily by those with chronic antigenemia, such as infected ventriculoatrial shunts (shunt nephritis) or endocarditis, chronic viral infections (eg, hepatitis virus), parasitic infections (eg, malaria, schistosomiasis), and systemic immune complex diseases such as systemic lupus erythematosus and cryoglobulinemia.29
Mixed cryoglobulinemia, especially in the context of hepatitis C virus infection, is currently thought to be a common, and perhaps the most common underlying disease in which MPGN type I is encountered.12 An opportunity to study the development and evolution of mixed cryoglobulinemia is particularly relevant to an understanding of the pathogenesis of MPGN type I. Our knowledge about the pathogenesis of MPGN is still severely limited because of a lack of available, relevant animal models.30 MPGN has been described in large animals such as Finnish Landrace lambs,31-33 dogs,34-37 horses,38 and pigs.39-42 Although some of these diseases are inherited and have defined genetic defects such as complement deficiency, these systems have limited utility for most investigators, because of such factors as limited availability of reagents to characterize cells and peptides in these species, the need for special animal care facilities to maintain such large animals with resultant large expenses, and the time required to breed sufficient animals to perform interventional studies with large enough cohorts to be statistically significant. We know of only one mouse model of MPGN that has been described, the sphha/sphha mice with congenital hemolytic anemia, but this model has not been subjected to extensive subsequent studies.43
In this study we describe a reproducible MPGN model in a transgenic mouse strain that might help to overcome some of the mentioned limitations of other models. All TSLP transgenic mice developed glomerular lesions as early as the first month of life. By 50 days of age females already show a very prominent histological lesion of MPGN. Consistent with a MPGN pattern, TSLP transgenic mice develop subendothelial immune deposits, splitting with cellular interposition of capillary walls, and an accentuated lobular appearance of the glomerular tuft. Furthermore, the deposition pattern of Igs and C3 is similar to the human disease. These features make this mouse strain a very attractive MPGN model and enable detailed pathogenetic studies by inbreeding of genetically modified murine strains.
TSLP transgenic mice develop MPGN in the context of type III cryoglobulins and demonstrate the most typical features of cryoglobulinemic glomerulonephritis. There are reported examples of murine hybridomas that have produced cryoprecipitable Igs analogous to type I cryoglobulins in humans, but infusion studies of these Igs have not resulted in production of MPGN-like lesions in animals.44 Another approach has been to use human cryoglobulins removed by therapeutic aphereses, to purify them, and reinfuse the cryoglobulins into rodents. Infusion of some of these cryoglobulins has resulted in glomerular lesions similar to those encountered in the patients from whom they were derived.45 Although an interesting proof of principle, these models are limited in their availability for extended use in studies of pathogenesis or therapeutic interventions. In addition to the features of idiopathic MPGN, cryoglobulinemia-associated cases show a prominent macrophage influx and occlusion of glomerular capillaries by PAS-positive material, corresponding to precipitates of the complexed Igs.12,46 Both features were present in TSLP transgenic mice.
Another characteristic feature of cryoglobulin deposition in the kidney is an ultrastructural organization of the Igs detectable by electron microscopy. Tubular, fibrillar, and fingerprint features, as well as cylindrical and annular organization of the deposits have been described in humans.47-53 Commonly the electron-dense deposits in TSLP transgenic mice demonstrated a microtubular appearance with annular structures on transverse sections and a cylindrical appearance on longitudinal sections. Therefore the ultrastructure of the electron-dense deposits closely resembles the description of some mixed cryoglobulins occurring in humans.
TSLP transgenic female mice developed a more severe phenotype than TSLP transgenic males, resulting in severer renal lesions early in the disease course and a higher mortality as compared to males. The prevalence of detectable amounts of cryoglobulins was slightly higher in females, and consistent with this finding female gender has been described as a risk factor for hepatitis C-associated cryoglobulinemia.10 Furthermore, gender differences with a female predominance have been described in various human and experimental autoimmune diseases.54,55 B-cell hyperactivity with increased synthesis of Igs including autoantibodies has been described in estrogen-treated mice, a mechanism that might be of importance in our model.56 The exact cause for the gender differences in TSLP transgenic mice, although consistent with other models of autoimmune diseases remain speculative and need to be addressed in further studies.
In summary, we present the first transgenic mouse model of mixed cryoglobulinemia (type III) that closely resembles important aspects of the human disease. The renal lesion is characterized by mesangial expansion because of matrix and immune complex deposition, capillary wall thickening (by immune deposits and cellular interposition), occlusion of capillary lumina by subendothelial deposits and intraluminal PAS-positive material, and macrophage influx. Therefore, TSLP transgenic mice will enable detailed studies on the pathogenetic events of the membranoproliferative pattern of glomerulonephritis, as well as the evaluation of functional roles of cytokines and growth hormones by crossbreeding with other genetically manipulated mouse strains on the same defined genetic background.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported in part by grants from the KIDNEEDS foundation, the Northwest Kidney Centers Foundation, pilot project funds from the National Institutes of Health (grant U19 AI41320 and grant A144160), and a grant from the Else Kröner-Fresenius-Stiftung, Bad Homburg v. d. Höhe, Germany.
S. T. and S. S. both contributed equally to this work.
Accepted for publication August 27, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Guo, A. S. Muhlfeld, T. A. Wietecha, C. J. Peutz-Kootstra, J. Kowalewska, K. Yi, M. Spencer, W. Pichaiwong, F. Nimmerjahn, K. L. Hudkins, et al. Deletion of Activating Fc{gamma} Receptors Does Not Confer Protection in Murine Cryoglobulinemia-Associated Membranoproliferative Glomerulonephritis Am. J. Pathol., July 1, 2009; 175(1): 107 - 118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Iyoda, K. L. Hudkins, S. Becker-Herman, T. A. Wietecha, M. C. Banas, S. Guo, A. Meyer-Bahlburg, J. Kowalewska, G. Liu, S. F. Ziegler, et al. Imatinib Suppresses Cryoglobulinemia and Secondary Membranoproliferative Glomerulonephritis J. Am. Soc. Nephrol., January 1, 2009; 20(1): 68 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. K. Jessup, A. W. Brewer, M. Omori, E. A. Rickel, A. L. Budelsky, B.-R. P. Yoon, S. F. Ziegler, and M. R. Comeau Intradermal Administration of Thymic Stromal Lymphopoietin Induces a T Cell- and Eosinophil-Dependent Systemic Th2 Inflammatory Response J. Immunol., September 15, 2008; 181(6): 4311 - 4319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Guo, J. Kowalewska, T. A. Wietecha, M. Iyoda, L. Wang, K. Yi, M. Spencer, M. Banas, S. Alexandrescu, K. L. Hudkins, et al. Renin-Angiotensin System Blockade Is Renoprotective in Immune Complex-Mediated Glomerulonephritis J. Am. Soc. Nephrol., June 1, 2008; 19(6): 1168 - 1176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Hunninghake, J. Lasky-Su, M. E. Soto-Quiros, L. Avila, C. Liang, S. L. Lake, T. J. Hudson, M. Spesny, E. Fournier, J. S. Sylvia, et al. Sex-stratified Linkage Analysis Identifies a Female-specific Locus for IgE to Cockroach in Costa Ricans Am. J. Respir. Crit. Care Med., April 15, 2008; 177(8): 830 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Banas, B. Banas, K. L. Hudkins, T. A. Wietecha, M. Iyoda, E. Bock, P. Hauser, J. W. Pippin, S. J. Shankland, K. D. Smith, et al. TLR4 Links Podocytes with the Innate Immune System to Mediate Glomerular Injury J. Am. Soc. Nephrol., April 1, 2008; 19(4): 704 - 713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Taneda, K. L. Hudkins, A. S. Muhlfeld, J. Kowalewska, J. W. Pippin, S. J. Shankland, and C. E. Alpers Protease Nexin-1, tPA, and PAI-1 are Upregulated in Cryoglobulinemic Membranoproliferative Glomerulonephritis J. Am. Soc. Nephrol., February 1, 2008; 19(2): 243 - 251. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Iyoda, K. L. Hudkins, T. A. Wietecha, M. C. Banas, S. Guo, G. Liu, L. Wang, J. Kowalewska, and C. E. Alpers All-trans-retinoic acid aggravates cryoglobulin-associated membranoproliferative glomerulonephritis in mice Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3451 - 3461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. Alpers and J. Kowalewska Emerging Paradigms in the Renal Pathology of Viral Diseases Clin. J. Am. Soc. Nephrol., July 1, 2007; 2(Supplement_1): S6 - S12. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sansonno, A. Carbone, V. De Re, and F. Dammacco Hepatitis C virus infection, cryoglobulinaemia, and beyond Rheumatology, April 1, 2007; 46(4): 572 - 578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kowalewska, A. S. Muhlfeld, K. L. Hudkins, M. M. Yeh, A. G. Farr, J. V. Ravetch, and C. E. Alpers Thymic Stromal Lymphopoietin Transgenic Mice Develop Cryoglobulinemia and Hepatitis with Similarities to Human Hepatitis C Liver Disease Am. J. Pathol., March 1, 2007; 170(3): 981 - 989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Carpino, W. E. Thierfelder, M.-s. Chang, C. Saris, S. J. Turner, S. F. Ziegler, and J. N. Ihle Absence of an Essential Role for Thymic Stromal Lymphopoietin Receptor in Murine B-Cell Development Mol. Cell. Biol., March 15, 2004; 24(6): 2584 - 2592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Hudkins, D. G. Gilbertson, M. Carling, S. Taneda, S. D. Hughes, M. S. Holdren, T. E. Palmer, S. Topouzis, A. C. Haran, A. L. Feldhaus, et al. Exogenous PDGF-D Is a Potent Mesangial Cell Mitogen and Causes a Severe Mesangial Proliferative Glomerulopathy J. Am. Soc. Nephrol., February 1, 2004; 15(2): 286 - 298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Osborn, P. L. Ryan, N. Kirchhof, A. Panoskaltsis-Mortari, F. Mortari, and K.-S. R. S. Tudor Overexpression of murine TSLP impairs lymphopoiesis and myelopoiesis Blood, February 1, 2004; 103(3): 843 - 851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Muhlfeld, S. Segerer, K. Hudkins, M. D. Carling, M. Wen, A. G. Farr, J. V. Ravetch, and C. E. Alpers Deletion of the Fc{gamma} Receptor IIb in Thymic Stromal Lymphopoietin Transgenic Mice Aggravates Membranoproliferative Glomerulonephritis Am. J. Pathol., September 1, 2003; 163(3): 1127 - 1136. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Taneda, J. W. Pippin, E. H. Sage, K. L. Hudkins, Y. Takeuchi, W. G. Couser, and C. E. Alpers Amelioration of Diabetic Nephropathy in SPARC-Null Mice J. Am. Soc. Nephrol., April 1, 2003; 14(4): 968 - 980. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
