| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the University of California at San Diego School of
Medicine,*
La Jolla; and the La Jolla Institute of
Allergy and Immunology,
La Jolla, California
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
The tumor suppressor gene p53 has well-established roles in cell-cycle control and apoptosis in response to DNA damage.8 Such damage is found in rheumatoid synovium,9 perhaps as a consequence of reactive oxygen and nitric oxide produced during inflammation. At the same time, p53 expression is increased in rheumatoid synovium.10 Overexpression of p53 in inflammation is not unique to RA and is now known to occur in many other inflammatory conditions.11 However, previous studies have not considered the function of p53 under these circumstances beyond its well-described response to DNA damage. We, therefore, hypothesized that p53 is an important homeostatic protein that has anti-inflammatory effects and that its expression will serve to down-regulate inflammation. To address this question, we examined the course of collagen-induced arthritis (CIA) in DBA/1 mice with homozygous disruption of the p53 gene. These studies showed that inflammatory arthritis was significantly greater in the p53-/- mice than in mice with functional p53 genes. The mechanism was related to decreased apoptosis along with enhanced synovial expression of cytokines and matrix metalloproteinases (MMPs).
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
p53-/-DBA/1 mice were generated by successive backcrosses (more than eight) of male p53-/- B6.129S2-Trp53tm1Tyj (Jackson Laboratory, Bar Harbor, ME) x female DBA1. Most mice were used after the ninth to tenth generation of backcrossing. Genotypes were determined by polymerase chain reaction analysis of genomic DNA isolated from tail samples using the following three primers: x6.5 (ACAGCGTGGTGGTACCTTAT); x7 (TATACTCAGAGCCGCCT); and neo (CTATCAGGACATAGCGTTGG). Targeted mutation (knockout) alleles were identified by a 575-bp polymerase chain reaction product, whereas wild-type alleles gave rise to a 375-bp product. p53+/- DBA/1 or p53-/- males were bred with DBA/1p53+/- females to yield p53+/+ DBA/1, p53+/-, and p53-/- for the experiments described. To verify that the backcrossed mice were congenic at another locus, peripheral blood mononuclear cells were evaluated by fluorescence-activated cell sorting analysis using anti-I-Aq (clone KH116) and anti-I-Ab (clone AF6-120.1) antibodies (BD-PharMingen, La Jolla, CA). All mice (p53+ and p53-/-) were positive for I-Aq and negative for I-Ab. A C57BL/6 control mouse (H2b), negative for I-Aq and positive for I-Ab, was included as a staining control (data not shown).
Induction of CIA
Mice (6 to 8 weeks old) were immunized at the base of the tail with 0.1 ml of a solution containing bovine type II collagen (1 mg/ml) (Chondrex, Redmond, WA) in complete Freund’s adjuvant. On day 21, 100 µg of type II collagen in 0.1 ml of phosphate-buffered saline (PBS) was injected intraperitoneally. Clinical arthritis scores were calculated using a semiquantitative scale of 0 to 4+ for each paw (hind paw: 0, no arthritis; 1, ankle swelling; 2, ankle and midfoot swelling; 3, ankle, midfoot, and metatarsal-phalangeal joint swelling; 4, ankle, midfoot, metatarsal-phalangeal joint, and digit swelling; scoring system for the forepaw was analogous; maximum score, 16 per animal). Four separate experiments were performed and the results for 13 p53-/- and 39 p53+ (homozygous and heterozygous) mice were pooled. Mice were not genotyped until after the study was completed. All animals were handled in accordance with UCSD Animal Subjects Committee and USDA guidelines. No tumors were observed in any animals during the course of these experiments. Right hind paws from each animal were fixed in a 10% formalin solution, decalcified in 15% ethylenediaminetetraacetic acid-PBS, and embedded in paraffin for histological analysis. Five-µm sections were cut, mounted on glass slides, and stained with hematoxylin and eosin (H&E) or safranin O. The tissue was evaluated using a semiquantitative scoring system for synovial hyperplasia, cartilage erosion, extra-articular inflammation, and cartilage proteoglycan content on safranin O and H&E-stained sections (0 to 3+ per each of the four items; maximum score, 12 per animal), and the total histological score was compared between p53-/- (n = 6) and p53+ mice (n = 17).
Fibroblast-Like Synoviocytes (FLS)
FLS from normal p53-/- and p53+ mice were isolated and cultured as previously described.12 Briefly, synovial tissues were obtained from microdissected ankle joints of the p53-/- and p53+ mice. The tissues were minced under sterile conditions and incubated with 1 mg/ml of collagenase in serum-free Dulbecco’s modified Eagle’s medium (Life Technologies, Inc., Grand Island, NY) for 2 hours at 37°C, filtered through a nylon mesh, extensively washed, and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum, 2 mmol/L glutamine, 50 µg/ml gentamicin, 100 U/ml penicillin, and 100 µg/ml streptomycin, in a humidified 5% CO2 atmosphere. After overnight culture, nonadherent cells were removed, and adherent cells were cultivated in the same medium. At confluence, cells were trypsinized, split at a 1:3 ratio, and recultured in medium. FLS from passages 3 through 6 were used in these experiments.
Terminal dUTP Nick-End Labeling (TUNEL) Assay
Decalcified paraffin-embedded sections of CIA ankle joints (day 43) were processed for TUNEL assays as per the manufacturer’s instructions (In Situ Cell Death Detection Kit; Roche, Mannheim, Germany). Briefly, the tissue sections were deparaffinized and rehydrated. Sections were then overlaid with 20 µg/ml of proteinase K and subsequently permeabilized with 0.1% Triton X in 0.1% sodium citrate. TUNEL reaction mixture was added and the tissue sections were counterstained with propidium iodide. The number of synovial TUNEL+ cells/high-power field was counted in 5 to 10 fields for each coded slide.
Western Blot Analysis
p53+/+ mice were immunized with type II collagen as described above. At various time points, groups of three to four animals were sacrificed, and joint tissues from left hind paws were collected and frozen until used. The frozen joint tissues were pulverized, and protein was extracted using RIPA buffer (50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate). The protein concentrations were determined with the DC Protein Assay kit (Bio-Rad, Hercules, CA). Equal amounts of protein samples (80 µg/lane) from pooled joint extracts at each time point were fractionated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane in transfer buffer (39 mmol/L glycine, 48 mmol/L Tris base, 0.037% sodium dodecyl sulfate, 20% methanol) at 100 mA for 2 hours. Differences in cellularity caused by progression of arthritis was normalized by loading similar amounts of protein in each lane. The membranes were blocked in Tris-buffered saline containing 0.1% Tween 20 and 5% dry milk for 1 hour at room temperature. p53 protein was detected with 1 µg/ml of FL-393, an affinity-purified rabbit polyclonal anti-p53 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), which recognizes murine, rat, and human p53 protein. After incubation with horseradish peroxidase-conjugated anti-rabbit IgG antibody (Roche), peroxidase activity was detected using hydrogen peroxide as substrate and visualized by chemiluminescence.
Anti-Type II Collagen Antibodies and Cytokines
Serum was collected from mice on day 20 or 43 at the time of
sacrifice and assayed for anti-mouse type II collagen antibodies using
a commercially available enzyme-linked immunosorbent assay (ELISA)
(Chondrex). Antibody titers are presented as arbitrary units compared
with a known standard. For tissue cytokine assays, snap-frozen joints
were homogenized in lysis solution (100 mmol/L potassium phosphate, pH
7.8, 0.2% Triton X-100, 1 mmol/L dithiothreitol). The volume of lysis
solution was adjusted to 250 mg of tissue per ml. Tissue lysate was
centrifuged, the supernatant was collected and the protein
concentration was determined using the DC Protein Assay kit.
Interleukin (IL)-6, tumor necrosis factor-
, and IL-1ß were
measured using a commercial ELISA according to manufacturer’s
instructions (R&D Systems, Minneapolis, MN). The values were normalized
to protein concentration. The sensitivity of these assays was 
1
pg/mg of total protein. In other experiments, serum cytokines were also
measured using the same ELISAs.
Northern Blot Analysis
Mouse limbs were cut just above and below the ankle or wrist and the skin was removed. Total RNA was fractionated on a 1.2% formaldehyde agarose gel and then transferred to a 0.45-µm nylon filter membrane. The blot was prehybridized in 50% formamide, 5x saline sodium phosphate-ethylenediaminetetraacetic acid, 5x Denhardt’s solution, 1% sodium dodecyl sulfate, 200 µg/ml ssDNA, and 50 µg/ml tRNA. Mouse collagenase-3 (MMP13) or G3PDH cDNA was denatured and labeled by random-primed incorporation of 32P-dATP (Random Primed Labeling Kit, Roche). The blot was hybridized overnight at 42°C, washed, and exposed to Kodak X-Omat AR film (Rochester, NY) with an intensifying screen at -80°C.
Statistics
Statistical significance was analyzed using the software package Statview 4.5 (Abacus Concepts, Berkeley, CA). Data are expressed as means ± SEM. Comparisons were performed using the unpaired Student’s t-test or by analysis of variance. Differences were considered statistically significant when P < 0.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
To determine the role of p53 in an animal model of chronic
inflammation, we first examined its expression in CIA in DBA/1 mice.
Western blot analysis was used to determine the levels of
immunoreactive p53 in the joints of mice throughout the disease. As
shown in Figure 1
, p53 protein expression
in joint tissues increased dramatically by day 20 after immunization
and remained elevated through at least day 45.
|
DBA/1 mice were bred with p53-/- animals
and backcrossed for at least eight generations, and CIA was induced in
p53+ (homozygous and heterozygous) and
p53-/- littermates. No significant differences
were observed between the p53+/+ and
p53+/- mice with any of the parameters
evaluated, so the results for these two groups were pooled and referred
to as p53+. To determine whether loss of p53
function can contribute to the severity of chronic inflammation, we
examined the clinical course of CIA in p53-/-
mice. The mice were immunized with bovine type II collagen and clinical
arthritis was measured using a semiquantitative scoring system. As
shown in Figure 2
, the severity of
arthritis in p53-/- mice was not significantly
increased in very early disease but was greater in the
p53-/- mice compared with
p53+ mice in late disease. The arthritis scores
at the conclusion were 11.5 ± 1.0 for
p53-/- mice and 8.1 ± 0.8 for
p53+ animals (P < 0.03).
The differences in mean scores indicates an increase in the number of
joints involved. For instance, the average hind paw in
p53+ mice had a score of 2 (ankle and midfoot
involvement only). However, the p53-/- mice had
an average hind paw score of nearly 3, indicating involvement of the
five metatarsal-phalangeal joints in each paw. Virtually all of the
paws were involved in the mice by day 35 and were affected
coordinately, so the differences in arthritis scores in late disease
were not because of high joint counts in one limb with no arthritis in
another limb of an individual animal. In addition to involvement of
more joints in p53-/- mice, histological
evaluation of the ankles revealed significantly greater synovial
inflammation and cartilage and bone destruction in the
p53-/- mice (Figure 3)
(p53-/- =
10.2 ± 0.5; p53+ = 6.2 ± 1.0;
P < 0.02). Therefore, p53-/-
mice with CIA had both a greater number of affected joints and
increased severity of arthritis in the involved joints compared with
p53+ mice.
|
|
To determine the mechanisms of increased arthritis and joint
destruction in the p53-/- mice, serum anti-type
II collagen antibodies were measured by solid-phase ELISA. However,
there were no significant differences between the
p53-/- and p53+ mice at
the end of the study (Table 1)
. Because
clinical disease is, in large part, initiated and perpetuated by
development of anti-type II collagen antibodies,13
enhanced immune responses to collagen probably do not contribute to the
differences in disease severity in the p53-/-
mice.
|
Apoptosis is low in the joints of RA patients despite the presence
of abundant DNA damage.14
However, the joints of mice late
in the course of CIA show TUNEL+ synovial cells
indicating apoptosis (Figure 4)
. As shown
in Figure 4
, apoptosis assessed by TUNEL was nearly absent in the
joints of animals lacking p53 in late disease when
p53-/- mice have more clinically active and
destructive arthritis (TUNEL+ cells were
2.83 ± 0.43 per field in p53+ animals
versus 0.60 ± 0.15 per field in
p53-/- mice). Therefore, apoptosis in the
synovia of mice with CIA is p53-dependent. Essentially no apoptotic
cells were present in the synovia of unimmunized
p53+ DBA/1 mice.15
We also did not
observe TUNEL+ cells in the synovia of
p53+ or p53-/- mice on
day 20 after immunization, a time when both groups have similar
arthritis scores. The level of apoptosis noted in the
p53+ mice during the late phase of disease
(1%) can clearly be a relevant determinant of tissue
cellularity.16
|
Production of the proinflammatory cytokines IL-6 and IL-1ß was
markedly increased in the joints of the p53-/-
mice with CIA on day 43 (Figure 5
and
Table 1
). Neither of these cytokines were increased in the joints of
the p53-/- mice compared with
p53+ mice in very early disease (day 20), when
the arthritis scores were similar to each other (Table 1)
. Tissue
specificity for the increase in cytokine production was noted because
serum levels of IL-6 were not significantly different in
p53-/- and p53+ mice
(Table 1)
. Because p53 is known to suppress IL-6 gene
transcription,17
the mechanism of increased IL-6
production may be directly related to the absence of p53 or because
IL-1 levels are increased.18
The same lysates and serum
samples were assayed for tumor necrosis factor-; however, the
concentrations were below the level of detection of the assay.
|
Collagenase-3 (MMP13) expression levels might contribute to the
increase in joint damage in p53-/- mice. mRNA
samples from joint extracts were assayed for collagenase-3 gene
expression by Northern blot analysis. Figure 6A
shows that significantly higher levels
of collagenase-3 mRNA were detected in the
p53-/- mice compared with the
p53+ mice. Quantification of the differences
shows that G3PDH-normalized collagenase-3 mRNA levels were 0.41 ±
0.08 in p53+ mice and 0.80 ± 0.09 in
p53-/- mice with CIA (P
< 0.02). Furthermore, basal and IL-1-stimulated collagenase-3 gene
expression was higher in cultured FLS from
p53-/- mice compared with
p53+ mice (Figure 6B)
. Increased basal expression
of MMP13 by cultured FLS grown in serum does not necessarily imply
increased in vivo expression in the absence of inflammation.
The situation is analogous to IL-6 (another p53-regulated gene) because
the effect of p53 was not observed until late in the disease (Table 1)
.
Previous studies have demonstrated that loss of p53 markedly increases
basal IL-6 expression in cultured FLS.7
Our findings are
also consistent with recent studies that have shown that wild-type p53
suppresses collagenase gene transcription.19
In addition,
p53 can decrease synovial lining hyperplasia by inhibiting cell
proliferation. As shown in Table 2
, the
growth rate of cultured synoviocytes from p53+/-
mice was only half that of the p53-/-
synoviocytes.
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The protection afforded by p53 is probably due to suppression of effector mechanisms in CIA, because the production of anti-type II collagen antibodies was unchanged in p53-/- mice. These antibodies are critical to the initiation and severity of the disease, indicating that nonimmunological mechanisms are likely responsible for the increase in synovitis and joint destruction rather than antigen-specific responses.22 In support of this hypothesis, p53 alters the cytokine balance in inflammation by suppressing proinflammatory cytokines such as IL-1 and IL-6 at the site of disease. The differences in cytokine balance are manifested in the late phase of CIA when synovial IL-1 and IL-6 production and clinical arthritis are significantly higher in p53-/- mice. Serum IL-6 is not increased, suggesting that the local inflammatory milieu is needed for excessive IL-6 induction in the absence of p53. Although it is difficult to separate the regulation of individual cytokines in the complex milieu of the joint, the p53-mediated decrease in IL-1ß or IL-6 might result from a direct effect of p5317,18 or secondary to other cytokine effects. Because IL-1 is a key regulator of joint destruction in animal models of arthritis, this could also contribute to increased bone destruction in the p53-/- mice.23
The present results support our hypothesis that p53 protects patients with RA and other inflammatory diseases. In this paradigm, the p53 gene is expressed in response to inflammation and genotoxic stimulation as a protective mechanism to induce cell-cycle arrest and apoptosis. Continued oxidative stress can eventually cause mutations in various genes, including p53, which supports cell for survival. Accordingly, apoptosis in the joints of mice with CIA is p53-dependent and indicates that a cell that lacking p53 function through mutation might have a growth advantage. Suppression of p53 function in human synoviocytes increases proliferation and invasiveness,24 and mutant cells that arises in the RA joint could contribute to increased cytokine production. More recently, we have also demonstrated that loss of p53 function increases FLS invasion into cartilage in a SCID mouse model.25
Although the results vary, several groups have independently demonstrated somatic mutations in the p53 gene in synovial tissues of RA patients requiring joint replacement surgery.4-6,26 The percentage of the p53 pool that is abnormal remains controversial, and generally varies between 5% and 30% of the total p53 mRNA. Disease stage or sampling error could account for some of these differences, because synoviocytes at sites of cartilage invasion are monoclonal or oligoclonal but are polyclonal when derived from nonerosive sites.27 The p53 mutations in RA are generally G>A or T>C transitions, which is consistent with oxidative damage in the inflamed synovium.11 We have also found that at least some of the mutations are dominant-negative and block the function of wild-type p53.7 Therefore, cells expressing the dominant-negative p53 genes could be functionally similar to p53-/- cells even though the RA cells still possess a functional p53 allele.
CIA and perhaps RA are initiated by a systemic immune response, which plays an essential part in the joint disease. However, several studies suggest that subsequent events play a major role in joint destruction. For instance, anti-CD4 antibodies effectively suppress CIA when administered around the time of primary immunization, but at later times have little or no effect on the disease progression.28,29 We propose that this immune response initiates the changes in the synovial microenvironment that induce apoptosis in p53+ cells and thereby selects cells with mutations. Loss of p53 function in mutant cells in the synovium24 or because of inflammatory mediators such as MIF that suppress p53 function30,31 not only protects them from apoptosis but also enhances invasiveness and collagenase expression.
Therefore, we suggest that p53 is induced in the rheumatoid joint and other sites of inflammation as a protective mechanism to arrest the cell cycle, suppress MMP expression, alter the cytokine network, and cause apoptosis. Because expression of secreted proteins such as MMPs, IL-6, and IL-1ß is decreased by wild-type p53, dominant-negative mutations in RA could have significant local effects on inflammation and bone destruction even if a relatively small percentage of synovial cells harbor the mutant genes. In this way, a subpopulation of abnormal synoviocytes could enhance articular matrix destruction by releasing excess proteases and cytokines. In the murine model, all of the cells in the p53-/- mice lack this key gene, which could exaggerate the observed effect compared with RA. It is important to remember that the sequelae in RA would accrue throughout many years and is likely comparable to the highly compressed CIA model. The loss of p53 function in RA, as in CIA, could then lead to a more aggressive disease, especially at the invasive front of pannus that erodes the extracellular matrix. Novel therapeutic approaches to induce apoptosis or de-activate partially transformed synoviocytes could be beneficial in RA by helping restore synovial homeostasis.
Although overexpression of p53 in tissues was originally thought to be a surrogate marker for mutations, many studies have demonstrated wild-type p53 in human inflammatory diseases, including RA, inflammatory osteoarthritis, reactive arthritis, inflammatory bowel disease, psoriasis, Helico pylori infection, and many others.11 We have also shown the same phenomenon in animal models of arthritis (adjuvant arthritis in rats21 and, now, in CIA in mice). Hence, p53 induction is a general phenomenon in inflammation and it functions as a regulatory molecule that modulates normal inflammatory responses. Our observations suggest that methods to enhance p53 function or expression will have beneficial effects in many inflammatory diseases.
|
Footnotes |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Supported by the National Institutes of Health (grant AR45347).
D. R. G. and G. S. F. contributed equally to this work.
Accepted for publication September 25, 2001.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  L. Pattacini, B. Casali, L. Boiardi, N. Pipitone, L. Albertazzi, and C. Salvarani Angiotensin II protects fibroblast-like synoviocytes from apoptosis via the AT1-NF-{kappa}B pathway Rheumatology, August 1, 2007; 46(8): 1252 - 1257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Dijsselbloem, S. Goriely, V. Albarani, S. Gerlo, S. Francoz, J.-C. Marine, M. Goldman, G. Haegeman, and W. V. Berghe A Critical Role for p53 in the Control of NF-{kappa}B-Dependent Gene Expression in TLR4-Stimulated Dendritic Cells Exposed to Genistein J. Immunol., April 15, 2007; 178(8): 5048 - 5057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Inoue, D. L. Boyle, M. Corr, D. Hammaker, R. J. Davis, R. A. Flavell, and G. S. Firestein Mitogen-activated protein kinase kinase 3 is a pivotal pathway regulating p38 activation in inflammatory arthritis PNAS, April 4, 2006; 103(14): 5484 - 5489. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Liu, K. Maas, and T. M. Aune Identification of gene expression signatures in autoimmune disease without the influence of familial resemblance Hum. Mol. Genet., February 1, 2006; 15(3): 501 - 509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cuzzocrea, E. Ayroldi, R. Di Paola, M. Agostini, E. Mazzon, S. Bruscoli, T. Genovese, S. Ronchetti, A. P. Caputi, and C. Riccardi Role of glucocorticoid-induced TNF receptor family gene (GITR) in collagen-induced arthritis FASEB J, August 1, 2005; 19(10): 1253 - 1265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Sweeney, D. Hammaker, D. L. Boyle, and G. S. Firestein Regulation of c-Jun Phosphorylation by the I{kappa}B Kinase-{epsilon} Complex in Fibroblast-Like Synoviocytes J. Immunol., May 15, 2005; 174(10): 6424 - 6430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Zheng, S.-E. Lamhamedi-Cherradi, P. Wang, L. Xu, and Y. H. Chen Tumor Suppressor p53 Inhibits Autoimmune Inflammation and Macrophage Function Diabetes, May 1, 2005; 54(5): 1423 - 1428. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yada, N. Takamura, K. Inagaki-Ohara, M. K. O'Leary, C. Wasem, T. Brunner, D. R. Green, T. Lin, and M. J. Pinkoski The Role of p53 and Fas in a Model of Acute Murine Graft-versus-Host Disease J. Immunol., February 1, 2005; 174(3): 1291 - 1297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Salvador, R Sanmarti, A Garcia-Peiro, J R Rodriguez-Cros, J Munoz-Gomez, and J D Canete p53 Expression in rheumatoid and psoriatic arthritis synovial tissue and association with joint damage Ann Rheum Dis, February 1, 2005; 64(2): 183 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Itoh, H. Hase, H. Kojima, K. Saotome, K. Nishioka, and T. Kobata Central role of mitochondria and p53 in Fas-mediated apoptosis of rheumatoid synovial fibroblasts Rheumatology, March 1, 2004; 43(3): 277 - 285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Pillinger, P. B. Rosenthal, S. N. Tolani, B. Apsel, V. Dinsell, J. Greenberg, E. S. L. Chan, P. F. Gomez, and S. B. Abramson Cyclooxygenase-2-Derived E Prostaglandins Down-Regulate Matrix Metalloproteinase-1 Expression in Fibroblast-Like Synoviocytes via Inhibition of Extracellular Signal-Regulated Kinase Activation J. Immunol., December 1, 2003; 171(11): 6080 - 6089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C A Seemayer, S Kuchen, M Neidhart, P Kuenzler, V Rihoskova, E Neumann, M Pruschy, W K Aicher, U Muller-Ladner, R E Gay, et al. p53 in rheumatoid arthritis synovial fibroblasts at sites of invasion Ann Rheum Dis, December 1, 2003; 62(12): 1139 - 1144. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Stuhlmuller, E. Kunisch, J. Franz, L. Martinez-Gamboa, M. M. Hernandez, A. Pruss, N. Ulbrich, V. A. Erdmann, G. R. Burmester, and R. W. Kinne Detection of Oncofetal H19 RNA in Rheumatoid Arthritis Synovial Tissue Am. J. Pathol., September 1, 2003; 163(3): 901 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Davis A Question of Transformation: The Synovial Fibroblast in Rheumatoid Arthritis Am. J. Pathol., May 1, 2003; 162(5): 1399 - 1402. [Full Text] [PDF]
|
|
|
|
|
|
H. Perlman, K. Bradley, H. Liu, S. Cole, E. Shamiyeh, R. C. Smith, K. Walsh, S. Fiore, A. E. Koch, G. S. Firestein, et al. IL-6 and Matrix Metalloproteinase-1 Are Regulated by the Cyclin-Dependent Kinase Inhibitor p21 in Synovial Fibroblasts J. Immunol., January 15, 2003; 170(2): 838 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ghosh, T. Mendoza, L. A. Ortiz, G. W. Hoyle, C. D. Fermin, A. R. Brody, M. Friedman, and G. F. Morris Bleomycin Sensitivity of Mice Expressing Dominant-Negative p53 in the Lung Epithelium Am. J. Respir. Crit. Care Med., September 15, 2002; 166(6): 890 - 897. [Abstract] [Full Text]
|
|
|
|
|
|
Y. Yamanishi, D. L. Boyle, S. Rosengren, D. R. Green, N. J. Zvaifler, and G. S. Firestein Regional analysis of p53 mutations in rheumatoid arthritis synovium PNAS, July 23, 2002; 99(15): 10025 - 10030. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
