| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From Inserm U423*
and the Département de
Génétique,
Université Paris
5, Hôpital Necker–Enfants Malades, Paris, France
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Nephrin, a transmembrane protein encoded by NPHS1 which is mutated in congenital nephrotic syndrome of the Finnish type,2 was shown to be a major component of the slit diaphragm.7-9 However, the composition of the slit diaphragm as well as the adaptor proteins linking nephrin to the cytoskeleton, is still largely unknown. CD2-associated protein (CD2AP) has been shown to interact with nephrin and could anchor nephrin to the cytoskeleton.5 P-cadherin, FAT, a novel transmembrane protein of the P-cadherin superfamily with a unique extra-cellular domain, and ZO-1 were also shown to be associated with the slit diaphragm, which represents a unique adherens-like cell junction.10,11
Recently, we have cloned a novel gene, NPHS2, mutated in patients presenting with autosomal recessive steroid-resistant nephrotic syndrome.4 This gene encodes a novel podocyte protein, podocin. Podocin presents similarities with proteins of the stomatin family and is predicted to be an integral membrane protein of 383 amino acids, with a single membrane domain forming a hairpin-like structure (amino acids 105 to 121) and with both N- and C-terminal domains in the cystosol.4 Here, we confirm the predicted structure of podocin by showing that both ends of the protein are intracellular, and we demonstrate by immunoelectron microscopy that podocin is located at the cystoplasmic face of the slit diaphragm.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Six-histidine-tagged N- and C-terminal fragments of podocin were produced in E. coli using the QIAExpressionist kit from Qiagen (Hilden, Germany). The 5' (nucleotides 110 to 337) and the 3' (nucleotides 471 to 1227) podocin cDNA sequences were PCR amplified with the proofreading Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) using primers which add BamHI and HindIII sites to the forward and reverse primers, respectively. The 5' and 3' podocin cDNA PCR products were then restriction enzyme digested and subcloned into the BamHI/HindIII-digested vectors pQE-32 and pQE-31, respectively. Double stranded sequencing of the constructs was performed to assure the fidelity of the polymerase and maintenance of the appropriate reading frame. The expression vectors pQE-32/5' and pQE31/3' were transformed in E. coli strains M15 and SG13009, respectively, and hexahistidine-tagged fusion proteins were purified on columns using a commercially prepared nickel-charged Ni-NTA agarose resin (Qiagen, Hilden, Germany), according to the manufacturer’s recommendations. The N-terminal recombinant protein was eluted under native conditions using an imidazole gradient whereas the C-terminal recombinant protein was eluted under denaturing conditions in phosphate buffer containing 8 mol/L urea at pH 4.5. Each recombinant protein was used in its elution buffer to raise polyclonal antibodies in two New Zealand White rabbits (Agrobio, La Ferti Saint-Aubin, France). The first immunization was performed with 200 µg of recombinant protein in Freund’s complete adjuvant and three booster immunizations with the same quantity of protein were performed 14, 28, and 42 days after the first immunization. Antisera were drawn at 35, 49, and 63 days after the first immunization and used without further purification.
Protein Fusion Constructs
The NPHS2 full-length cDNA coding region was PCR amplified with the Pfu Turbo DNA polymerase from Stratagene using the EcoRI-containing forward primer 5'CGGAATTCATGGAGAGGAGGGCGCGGAG3' and the NotI-containing reverse primer 5'TTGCGGCCGCCTATAACATGGGAGAGTCTT3', restriction enzyme digested and subcloned into the expression vector pcDNA 3.1 Zeo+ (Invitrogen, Carlsbad, CA) creating pNPHS2. Site- directed mutagenesis using the Quickchange site-directed mutagenesis kit to introduce the c-myc tag (EQKLISEEDL) was then carried out on this construct with the primer 5'GTGGTGGAATTCATGGAACAAAAACTTATTTCTGAAGAAGATCTGGAGAGGAGGGCGCGG3' coupled with its reverse complement, creating pcMyc-NPHS2.
Cell Culture and Transient Transfections
HEK293 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum, 100 U/ml penicillin/streptomycin and 2 mmol/L L-glutamine. Confluent cells were passaged the day before transfection and 8 x 105 cells were distributed into 100 mm dishes. Plasmid DNA was introduced into cells by calcium phosphate-mediated transfection.12 Five µg of each plasmid DNA were used in all transfections. Each plate was treated with 1 ml of DNA-calcium phosphate coprecipitate for a minimum of 6 hours. Transfected cells were then overlaid with supplemented DMEM and left to incubate for 48 hours.
Immunoprecipitation and Western Blotting
Non-transfected or HEK293 cells transfected with pcMyc-NPHS2 or pNPHS2 were lysed in 1 ml of ice-cold lysis buffer (1% Triton, 150 mmol/L NaCl, 50 mmol/L Tris-HCl (pH 8.0), 5 µg/ml leupeptine, 5 µg/ml aprotinin, 5 µg/ml pepstatin, and 1 mmol/L phenymethylsulfonyl fluoride [Sigma, St Louis, MO]) and incubated on ice for 10 minutes. The cell debris and nuclei were removed by centrifugation for 10 minutes at 4°C.
For immunoprecipitation experiments, each cell lysate was incubated overnight at 4°C with 30 µl of antiserum. The immune complexes were collected after the addition of 30 µl of protein A-Sepharose CL-4B (Sigma). The pellets of sepharose beads were washed three times with 1 ml of lysis buffer.
Total cell extracts or immunoprecipitates were boiled in Laemmli sample buffer, electrophoretically separated on 12.5% SDS-PAGE and transferred to PVDF membranes Immobilon-P (Millipore, Bedford, MA). After blocking in TBS pH 7.6 (20 mmol/L Tris-HCl, 150 mmol/L NaCl) plus 5% nonfat dry milk, the membranes were incubated at 4°C overnight with a 1:3000 dilution of the 9E10 mouse monoclonal antibody directed against c-myc (Santa Cruz Biotechnology) or with a 1:3000 dilution of antipodocin antibody in TBS/Tween 0.2% (TTBS)/BSA 0.1%. After three washes in TTBS, the filters were incubated for 1 hour at room temperature with a 1:10000 dilution of the horseradish peroxidase-conjugated sheep anti-mouse or donkey anti-rabbit antibody (Amersham Pharmacia Biotech, UK). The final detection was performed using the Amersham Pharmacia ECL reagents according to the manufacturer’s recommendations.
Tissue Samples
Six normal fetal kidneys (12 to 28 weeks) were obtained at autopsy after spontaneous abortion or termination of pregnancy for medical reasons. Six morphologically normal intact embryos (5 to 6 weeks) were obtained after legal abortion by mifepristone (RU 486) performed at Hôpital Broussais (Paris, France). Written maternal consent was obtained after information about the research project was provided and the abortion had been performed. Inserm and the ethics committee approved the entire procedure. Six normal kidneys (1 to 51 years), unsuitable for transplantation because of vascular problems, were also used for the study. End-stage kidneys, removed at the time of renal transplantation from two patients affected with steroid-resistant nephrotic syndrome were also studied. One patient carried a homozygous stop codon mutation at amino acid 138 (R138X) previously shown to result in the absence of NPHS2 transcript,4 and the other patient had a homozygous 855/6delAA mutation in exon 7 leading to a frameshift at amino acid 285 and to the synthesis of a putative truncated protein of 302 amino acids (O Gribouval, manuscript in preparation). Normal rat and mouse adult kidneys were also used. Specimens were immediately snap-frozen in liquid nitrogen using CRYO-H-BED (Bright, Huntingdon, England) and stored at -80°C until use, or fixed in 4% paraformaldehyde before embedding. Embryos were fixed in 4% paraformaldehyde in phosphate-buffered saline solution (PBS), microdissected from the whole trophoblast, dehydrated, and embedded in paraplast before sectioning.
In Situ Hybridization
In situ hybridization was carried out on sections of paraffin-embedded embryos, and fetal and mature kidneys according to a standard protocol previously reported.13 Briefly, paraffin-embedded 6 µm thick sections were deparaffinized, rehydrated, and treated by microwave heating in sodium citrate buffer (0.01 mol/L, pH 6.0). Sense and anti-sense riboprobes synthesized from a 1065-base pair PCR product (spanning bases 728 to 1792 in the NPHS2 cDNA) and labeled with either digoxigenin-11-UTP (Roche) or [35S] UTP (Amersham Pharmacia Biotech) were used for the study.4
Immunohistology
Antibodies and Reagents
Immunostaining was performed using antibodies against the C-terminal region of podocin diluted at 1:1000, or the N-terminal region of the protein diluted at 1:50, and the labeling was detected by immunofluorescence or immunoperoxidase staining.
For double immunolabeling, the following antibodies were used: mouse
anti-
3-integrin, CD49c (Beckman Coulter, Brea, CA), anti--3 chain
of type IV collagen, MAB3 (Wieslab, Lund, Sweden), and
anti-synaptopodin G1D4 (Progen Biotechnik GMBH, Heidelberg, Germany).
Cyanine2 or fluorescein (FITC)-conjugated AffiniPure goat or donkey anti-rabbit IgG and cyanine3-conjugated AffiniPure donkey anti-mouse IgG antibodies were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA). Vectastain Elite avidin biotin complex kit, avidin-biotin blocking kit, and diaminobenzidine (DAB) were from Vector Laboratories (Burlingame, CA).
Normal human serum adsorbed goat anti-rabbit IgG conjugated with 10 nm colloidal gold particles (GAR-gold 10 nm), and staphylococcal protein A conjugated with 10 nm colloidal gold particles (ptA-gold 10 nm) obtained from BioCell (Cardiff, UK) were used for immunoelectron microscopy.
Immunofluorescence and Immunoperoxidase Staining
Immunofluorescence labeling was performed on 3-µm-thick cryostat sections fixed in acetone for 10 minutes, and incubated for 20 minutes with 10% normal swine serum in PBST (0.01 mol/L PBS containing 0.05% Tween-20) for blocking nonspecific binding. After incubation for 1 hour at room temperature with primary antibodies diluted in the same buffer, the sections were rinsed three times in PBS and incubated for 30 minutes with FITC-conjugated anti-rabbit antibodies diluted 1:40 to 1:80 in PBS. A mounting media for immunofluorescence (Fluoprep, BioMerieux, Lyon, France) was used to delay fluorescence quenching. Labeling was examined with a orthoplan microscope equipped for light, fluorescence, and phase contrast microscopy (Leica Microscopic Systems, Heezbrugg, Switzerland).
Immunoperoxidase staining was carried out using the Vectastain Elite ABC kit and DAB substrate as previously described.14 After washing in fresh buffer (0.01 mol/L PBS, pH 7.4), endogenous biotin was blocked by the Biotin Blocking Agent according to the instructions of the manufacturer. Sections were then incubated for 1 hour at room temperature in a moist chamber with the appropriate dilution of primary antibodies in PBST, washed in PBS and incubated with the biotinylated secondary antibody for 30 minutes. For quenching the endogenous peroxidase, sections were treated with 3% hydrogen peroxide in methanol for 5 minutes and then washed in PBS for 20 minutes. They were then incubated for 30 minutes with Vectastain Elite ABC reagent. After washing, the final staining of the sections by DAB was monitored under the microscope. Tissue sections incubated with the preimmune rabbit sera or directly with the secondary antibodies served as controls.
Double Immunofluorescence Labeling and Confocal Microscopy
For dual fluorochrome labeling, the slides were simultaneously
incubated with rabbit anti-podocin antibodies and mouse anti-3(IV),
anti-3-integrin or anti-synaptopodin antibodies, as previously
described.15
After washing with PBS, the slides were
simultaneously incubated with Cy2-conjugated goat anti-rabbit IgG and
Cy3-conjugated donkey anti-mouse IgG. Sections were examined with a
orthoplan microscope equipped with appropriate filters (Leica
Microscopic Systems) and with a Zeiss confocal microscope (Carl Zeiss
Microscopy, Jena, Germany).
Immunogold Electron Microscopy
Kidneys from anesthesized adult mice were fixed by perfusion of periodate-lysine-paraformaldehyde solution (PLP) through the left ventricle. They were removed and postfixed for 1 hour in PLP, incubated for 1 hour in glycine-PBS before embedding in LRWhite (London Resin, Besingstoke, UK). The resin was polymerized at -24°C. Ultrathin sections were cut, mounted on nickel grids coated with collodium and carbon films, and processed for immunocytochemistry.
For immunolabeling, tissue sections were first incubated for 5 minutes on a drop of 0.1 mol/L PBS, pH 7.4, containing 5% bovine serum albumin (BSA) and 10% normal goat serum (G), and then with the primary antibodies diluted in the blocking solution [1% BSA, 1% G and 0.1% Tween 20 (T)] and incubated at room temperature for 2 hours. The grids were then rinsed with the same buffer and incubated for 45 minutes on a drop of the secondary antibody (GAR-gold 10 nm) or ptA-gold 10 nm, diluted in the same buffer containing gelatin 0.1%. They were then washed with PBS, post-fixed for 15 minutes with 2% glutaraldehyde, briefly stained with 2% osmium tetroxyde, and dried. After staining with uranyl acetate and lead citrate, the sections were examined with a Zeiss EM 902 electron microscope. Direct incubation with the secondary antibody or the protein A-gold alone was performed as controls.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Polyclonal rabbit antisera were raised against fusion proteins
derived from two regions of podocin: P18 and P21 against the whole
N-terminal region before the membrane-associated domain (amino acids 15
to 89), P35 and P39 against the C-terminal region downstream of the
membrane-associated domain (amino acids 135 to 383). The specificity of
these antisera was first tested by Western blot analysis of HEK293
cells transiently transfected with a c-myc-tagged podocin
expression construct, pcMyc-NPHS2. Both N- and C-terminal
antibodies detected a thick band of 49-kd in transfected cells (Figure 1a)
. This band was also detected by the
9E10 antibody directed against the c-myc epitope. In
contrast, this band was not detected by these antibodies in the non-
transfected cells (Figure 1a)
nor by the preimmune antisera in the
transfected and non-transfected cells (data not shown).
|
. The same
results were obtained by immunoprecipitation with P18 and P39 (data not
shown). Expression of NPHS2 Transcript in the Human Kidney
In the 5- to 6-week-old embryos, no signal was detected except in
the mesonephros. No signal was detected in the primitive metanephros
consisting of the uninduced mesenchyma and the branching ureteric bud
or in other developing structures. In contrast, NPHS2 was
specifically expressed in mesonephric podocytes from the S-shaped body
stage, then in the large fully developed glomeruli (Figure 2a)
. In the developing metanephric
kidney, no NPHS2 transcript was detected at the initial
steps of nephron formation whereas hybridization signals were seen at
the late S-shaped body stage, in the future podocytes of the inferior
segment of the S-shaped body (Figure 2, b and c)
. Strong expression
persisted in the immature and mature glomeruli (Figure 2b)
. In
postnatal kidneys, all glomeruli were strongly labeled with the
antisense probe. At high magnification, expression of the transcript
was clearly localized within podocytes, at the periphery of the
glomerular tuft (Figure 2, d–f)
. NPHS2 expression was seen
in the patient with a frame-shift mutation (855/6delAA) in exon 7
(Figure 2f)
. No specific signal was obtained with the sense probe (data
not shown).
|
Polyclonal antibodies against the C- or the N-terminal regions of
podocin gave the same pattern of immunolabeling but the staining was
stronger with P35 and P39, the anti-C-terminal antibodies. In the
fetus, the most primitive nephronic structures, vesicles, comma-shaped
and early S-shaped bodies were unlabeled. A faint signal first appeared
at the base of the primitive podocytes along the vascular cleft of the
S body at the beginning of the indentation of the inferior segment of
the S-shaped body (Figure 3a)
. The signal
increased with glomerular maturation (Figure 3, a–c)
. During the
capillary loop and maturing glomerulus stages, immunolabeling was
intense in the basal region of the podocytes, along the glomerular
basement membrane, but was also detected as thin spiky projections
between the developing podocytes (Figure 3, b and c)
. Later, in the
mature glomeruli located in the deep cortex of fetal kidneys, podocin
labeling strictly followed the course of the GBM. The same distribution
was maintained in mature kidneys where all podocytes were regularly
labeled with the antibodies (Figure 3, d–f)
. No staining was detected
in other glomerular or extraglomerular cells. No labeling was seen in
control experiments or in the kidney of the patient with a homozygous
stop codon mutation (R138X) known to result in the absence of a
transcript.4
In contrast, a very strong podocyte labeling
was observed in the patient with the 855/6delAA mutation using
antibodies directed against the N-terminal part of the protein whereas
no labeling was seen with the anti-C terminal domain (Figure 3, g and h)
. The same pattern as in the human mature glomeruli was obtained on
mouse and rat mature kidney sections labeled with P21 or P35 (Figure 3i)
.
|
To better delineate the subcellular localization of podocin,
double immunofluorescence labeling was performed on human mature
glomeruli, with anti-podocin antibodies (in green) and antibodies
directed against the 3 chain of type IV collagen (Figure 4a
-c), synaptopodin (Figure 4, d–f)
and
the 3 chain of 3ß1 integrin (Figure 4, g–i)
(in red).
|
3 chain of type IV collagen gave a strong linear labeling
of the glomerular basement membrane (GBM). Dual stained sections seen
at low magnification showed a nearly complete superposition of the red
and green labeling. However, high magnification and confocal microscopy
examination clearly disclosed the red linear labeling of the GBM with
the anti-3(IV) antibodies from the green, somewhat granular,
labeling of the base of the podocytes with the anti-podocin antibodies
(Figure 4, a–c)
. Synaptopodin is an actin-associated protein in the
podocyte foot processes.16
Dual labeling with podocin
showed a tight superposition of both markers evidenced by the yellow
color of the labeling outlining the GBM (Figure 4, d–f)
. In addition,
the green podocin labeling could be focally seen at the periphery of
the synaptopodin staining (Figure 4f)
. CD49c recognizes the 3 chain
of the 3ß1 integrin, an adhesion molecule highly expressed in the
glomerular epithelial cells along the GBM.17
It gave a
strong labeling of the podocytes at their site of adhesion to the GBM.
Dual labeling showed that podocin and 3 integrin are co-distributed
along the GBM with focally a tight alternance of red and green spots
well discriminated by confocal microscopy (Figure 4, g–i)
. Immunoelectron Microscopy
The localization of podocin molecules was precisely determined by
immunoelectron microscopy in mature mouse glomeruli. Both anti-C- and
N-terminal antibodies gave the same labeling pattern. Gold particles
were distributed at the base of the podocyte foot processes, near the
GBM (Figure 5)
. They were primarily
located at the cytoplasmic face of the plasma membrane adjacent to the
filtration slits which were globally unlabeled. Small clusters of
particles were occasionally found along the surface of the foot
processes at a distance from the GBM. No significant labeling was
observed on the GBM or the podocyte cell bodies. No labeling was
detected on Bowman’s capsule epithelial cells, endothelial, or
mesangial cells. Control stainings were negative.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Here, we describe the expression pattern of podocin during human embryogenesis and kidney development and the subcellular localization of podocin in the podocytes, using in situ hybridization and immunohistochemistry. For this purpose, we raised antibodies against both the N- and C-terminal regions of podocin. The specificity of these antibodies was demonstrated by Western blotting and immunoprecipitation and confirmed by the absence of staining of the kidney of a patient with a homozygous NPHS2 mutation (R138X) resulting in the absence of NPHS2 transcript.4 Furthermore, no labeling was observed with the anti-C-terminal antibodies on kidney sections from a patient carrying a NPHS2 homozygous 855/6delAA mutation, whereas a strong labeling was observed on kidney sections of this patient with antibodies directed against the N-terminal domain of podocin. As the 855/6delAA mutation is predicted to introduce a frame-shift at amino acid 285 and to lead to the production of a truncated podocin lacking the last 98 amino acids, this suggests that the epitopes recognized by the C-terminal antibodies, P35 and P39, are localized in this 98-amino-acid sequence.
NPHS2 expression was detected in 5-week human embryos, the
earliest developmental stage studied. The gene was specifically
expressed in the mesonephros, and more precisely in the mesonephric
future podocytes from the late S-shaped body. No other embryonic
structure was found to express NPHS2. In metanephric
kidneys, the NPHS2 transcript was initially detected in the
lower limb of the late S-shaped body, in the presumptive podocytes but
not in future parietal epithelial cells. This expression persisted
throughout glomerular differentiation and in mature glomeruli.
Expression of the protein was detected somewhat later than the
transcript, at a time when the inferior limb of the S-shaped body
becomes indented. At this stage, as well as at the early capillary loop
stage, podocin was distributed at the basal pole and along the lateral
surface of immature podocytes that had not yet developed foot
processes. Podocin expression increased with glomerular maturation and
persisted at a high level in mature kidneys at the basal pole of
podocytes. Double immunolabelings and confocal microscopy examination
confirmed this localization. Podocin labeling followed the external
aspect of the GBM stained for type IV collagen 3 chain. By light
microscopy, podocin was tightly contiguous to -3 integrin expressed
at the site of foot process attachment to the GBM. It co-localized with
synaptopodin, a prolin-rich cytoplasmic protein intimately associated
with actin filaments present in the foot processes.16
An
interesting observation was the strong expression of the N-terminal
domain of podocin in the patient with the NPHS2 homozygous
855/6delAA mutation. This shows that the increased synthesis of the
truncated podocin is not able to compensate for its defective function
and emphasizes the crucial role of the C-terminal region of podocin,
which contains proline residues that might be the site of interaction
with Src homology 3 (SH3) domain-encoding proteins.23
Using immunogold labeling and electron microsopy, we showed the podocin distribution at the base of the foot processes and precisely determined its localization on either side of the slit diaphragm, the slit membrane itself being unlabeled. Interestingly, both the C- and N-terminal domains of the protein identified by specific antibodies are co-localized at the cytoplasmic face of the plasma membrane, a finding in agreement with the hairpin-like predicted structure of podocin. This structure is also reminiscent of that of other proteins such as caveolins which incorporate in specialized membrane microdomains.24
More generally, podocin shows the same pattern of distribution during kidney development as that described for nephrin.8,18,19,25 Indeed, it is expressed in the mesonephros, in future podocyte from the late S-shaped body. Later, the expression is restricted to the base of the cells as soon as they differentiate with the appearance of foot processes. However, the nephrin extracellular domain is localized within the slit diaphragm,9,25 whereas podocin, as ZO-1,26 is present on the cytoplasmic face, at the point of attachment of the slit diaphragm. This suggests that podocin, as a membrane protein anchored to the plasma membrane, could interact with the intracellular domains of the transmembrane proteins localized in the slit diaphragm such as nephrin, P-cadherin, or FAT. Given the structure and the subcellular localization of the protein, it is tempting to speculate that podocin might assemble in lipid microdomains in the podocyte membrane and recruit other proteins such as CD2AP and ZO-1. More generally, podocin might serve to connect directly or indirectly the components of the slit diaphragm to the actin cytoskeleton.
The antipodocin antibodies provided here will be useful tools for testing the potential interaction of these proteins with podocin, for identifying unknown podocin partners, and for studying the podocin expression pattern in various glomerular nephropathies.
|
Acknowledgements |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
Footnotes |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Supported in part by grants from Association pour l’Utilisation du Rein Artificiel, Fondation pour la Recherche Médicale, and Association Claude Bernard. S.R. is a fellow of the Ministère de l’Education Nationale, de la Recherche, et de la Technologie.
Accepted for publication September 25, 2001.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
1-6 subunits of integrins are characteristically expressed in distinct segments of developing and adult human nephron. J Cell Biol 1990, 111:1245-1254This article has been cited by other articles:
 |
|
 |
|
  P. Muhonen and H. Holthofer Epigenetic and microRNA-mediated regulation in diabetes Nephrol. Dial. Transplant., April 1, 2009; 24(4): 1088 - 1096. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jeansson, K. Bjorck, O. Tenstad, and B. Haraldsson Adriamycin Alters Glomerular Endothelium to Induce Proteinuria J. Am. Soc. Nephrol., January 1, 2009; 20(1): 114 - 122. [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Pitera, P. J. Scambler, and A. S. Woolf Fras1, a basement membrane-associated protein mutated in Fraser syndrome, mediates both the initiation of the mammalian kidney and the integrity of renal glomeruli Hum. Mol. Genet., December 15, 2008; 17(24): 3953 - 3964. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Harvey, G. Jarad, J. Cunningham, S. Goldberg, B. Schermer, B. D. Harfe, M. T. McManus, T. Benzing, and J. H. Miner Podocyte-Specific Deletion of Dicer Alters Cytoskeletal Dynamics and Causes Glomerular Disease J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2150 - 2158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ho, K. H. Ng, S. Rosen, A. Dostal, R. I. Gregory, and J. A. Kreidberg Podocyte-Specific Loss of Functional MicroRNAs Leads to Rapid Glomerular and Tubular Injury J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2069 - 2075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Philippe, F. Nevo, E. L. Esquivel, D. Reklaityte, O. Gribouval, M.-J. Tete, C. Loirat, J. Dantal, M. Fischbach, C. Pouteil-Noble, et al. Nephrin Mutations Can Cause Childhood-Onset Steroid-Resistant Nephrotic Syndrome J. Am. Soc. Nephrol., October 1, 2008; 19(10): 1871 - 1878. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Baleato, P. L. Guthrie, M.-C. Gubler, L. K. Ashman, and S. Roselli Deletion of Cd151 Results in a Strain-Dependent Glomerular Disease Due to Severe Alterations of the Glomerular Basement Membrane Am. J. Pathol., October 1, 2008; 173(4): 927 - 937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ratelade, T. A. Lavin, A. O. Muda, L. Morisset, G. Mollet, O. Boyer, D. S. Chen, A. Henger, M. Kretzler, N. Hubner, et al. Maternal Environment Interacts with Modifier Genes to Influence Progression of Nephrotic Syndrome J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1491 - 1499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Koop, M. Eikmans, M. Wehland, H. Baelde, D. Ijpelaar, R. Kreutz, H. Kawachi, D. Kerjaschki, E. de Heer, and J. A. Bruijn Selective Loss of Podoplanin Protein Expression Accompanies Proteinuria and Precedes Alterations in Podocyte Morphology in a Spontaneous Proteinuric Rat Model Am. J. Pathol., August 1, 2008; 173(2): 315 - 326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Thorner, M. Ho, V. Eremina, Y. Sado, and S. Quaggin Podocytes Contribute to the Formation of Glomerular Crescents J. Am. Soc. Nephrol., March 1, 2008; 19(3): 495 - 502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Quaggin and J. A. Kreidberg Development of the renal glomerulus: good neighbors and good fences Development, February 15, 2008; 135(4): 609 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kiselyov, A. Soyombo, and S. Muallem TRPpathies J. Physiol., February 1, 2007; 578(3): 641 - 653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. B. Huber, B. Schermer, R. U. Muller, M. Hohne, M. Bartram, A. Calixto, H. Hagmann, C. Reinhardt, F. Koos, K. Kunzelmann, et al. Inaugural Article: Podocin and MEC-2 bind cholesterol to regulate the activity of associated ion channels PNAS, November 14, 2006; 103(46): 17079 - 17086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ye, J. Wysocki, J. William, M. J. Soler, I. Cokic, and D. Batlle Glomerular Localization and Expression of Angiotensin-Converting Enzyme 2 and Angiotensin-Converting Enzyme: Implications for Albuminuria in Diabetes J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3067 - 3075. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. El-Aouni, N. Herbach, S. M. Blattner, A. Henger, M. P. Rastaldi, G. Jarad, J. H. Miner, M. J. Moeller, R. St-Arnaud, S. Dedhar, et al. Podocyte-Specific Deletion of Integrin-Linked Kinase Results in Severe Glomerular Basement Membrane Alterations and Progressive Glomerulosclerosis J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1334 - 1344. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Tryggvason, J. Patrakka, and J. Wartiovaara Hereditary proteinuria syndromes and mechanisms of proteinuria. N. Engl. J. Med., March 30, 2006; 354(13): 1387 - 1401. [Full Text] [PDF]
|
|
|
|
|
|
G. D. Han, K. Suzuki, H. Koike, K. Suzuki, H. Yoneyama, S. Narumi, F. Shimizu, and H. Kawachi IFN-Inducible Protein-10 Plays a Pivotal Role in Maintaining Slit-Diaphragm Function by Regulating Podocyte Cell-Cycle Balance J. Am. Soc. Nephrol., February 1, 2006; 17(2): 442 - 453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Winn, N. Daskalakis, R. F. Spurney, and J. P. Middleton Unexpected Role of TRPC6 Channel in Familial Nephrotic Syndrome: Does It Have Clinical Implications? J. Am. Soc. Nephrol., February 1, 2006; 17(2): 378 - 387. [Full Text] [PDF]
|
|
|
|
|
|
J. Perry, S. Tam, K. Zheng, Y. Sado, H. Dobson, B. Jefferson, R. Jacobs, and P. S. Thorner Type IV Collagen Induces Podocytic Features in Bone Marrow Stromal Stem Cells In Vitro J. Am. Soc. Nephrol., January 1, 2006; 17(1): 66 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Plaisier, B. Mougenot, M. C. Verpont, C. Jouanneau, J. J. Archelos, R. Martini, D. Kerjaschki, and P. Ronco Glomerular Permeability Is Altered by Loss of P0, a Myelin Protein Expressed in Glomerular Epithelial Cells J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3350 - 3356. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Jouret, C. Auzanneau, H. Debaix, G.-H. S. Wada, C. Pretto, E. Marbaix, F. E. Karet, P. J. Courtoy, and O. Devuyst Ubiquitous and Kidney-Specific Subunits of Vacuolar H+-ATPase Are Differentially Expressed during Nephrogenesis J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3235 - 3246. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Winn, P. J. Conlon, K. L. Lynn, M. K. Farrington, T. Creazzo, A. F. Hawkins, N. Daskalakis, S. Y. Kwan, S. Ebersviller, J. L. Burchette, et al. A Mutation in the TRPC6 Cation Channel Causes Familial Focal Segmental Glomerulosclerosis Science, June 17, 2005; 308(5729): 1801 - 1804. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. A. Drummond Kidney Development and Disease in the Zebrafish J. Am. Soc. Nephrol., February 1, 2005; 16(2): 299 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Benzing Signaling at the Slit Diaphragm J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1382 - 1391. [Full Text] [PDF]
|
|
|
|
|
|
G. M. Ghiggeri, M. Carraro, and F. Vincenti Recurrent focal glomerulosclerosis in the era of genetics of podocyte proteins: theory and therapy Nephrol. Dial. Transplant., May 1, 2004; 19(5): 1036 - 1040. [Full Text] [PDF]
|
|
|
|
|
|
P. Niaudet Podocin and Nephrotic Syndrome: Implications for the Clinician J. Am. Soc. Nephrol., March 1, 2004; 15(3): 832 - 834. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Roselli, L. Heidet, M. Sich, A. Henger, M. Kretzler, M.-C. Gubler, and C. Antignac Early Glomerular Filtration Defect and Severe Renal Disease in Podocin-Deficient Mice Mol. Cell. Biol., January 15, 2004; 24(2): 550 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. B. Huber, M. Simons, B. Hartleben, L. Sernetz, M. Schmidts, E. Gundlach, M. A. Saleem, G. Walz, and T. Benzing Molecular basis of the functional podocin-nephrin complex: mutations in the NPHS2 gene disrupt nephrin targeting to lipid raft microdomains Hum. Mol. Genet., December 15, 2003; 12(24): 3397 - 3405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Khoshnoodi, K. Sigmundsson, L.-G. Ofverstedt, U. Skoglund, B. Obrink, J. Wartiovaara, and K. Tryggvason Nephrin Promotes Cell-Cell Adhesion through Homophilic Interactions Am. J. Pathol., December 1, 2003; 163(6): 2337 - 2346. [Abstract] [Full Text]
|
|
|
|
|
|
K. Koop, M. Eikmans, H. J. Baelde, H. Kawachi, E. de Heer, L. C. Paul, and J. A. Bruijn Expression of Podocyte-Associated Molecules in Acquired Human Kidney Diseases J. Am. Soc. Nephrol., August 1, 2003; 14(8): 2063 - 2071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Heidet, E. M. H. F. Bongers, M. Sich, S.-Y. Zhang, C. Loirat, A. Meyrier, M. Broyer, G. Landthaler, B. Faller, Y. Sado, et al. In Vivo Expression of Putative LMX1B Targets in Nail-Patella Syndrome Kidneys Am. J. Pathol., July 1, 2003; 163(1): 145 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. K. Peitsch, I. Hofmann, N. Endlich, S. Pratzel, C. Kuhn, H. Spring, H.-J. Grone, W. Kriz, and W. W. Franke Cell Biological and Biochemical Characterization of Drebrin Complexes in Mesangial Cells and Podocytes of Renal Glomeruli J. Am. Soc. Nephrol., June 1, 2003; 14(6): 1452 - 1463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-C. Gubler Podocyte Differentiation and Hereditary Proteinuria/Nephrotic Syndromes J. Am. Soc. Nephrol., June 1, 2003; 14(90001): S22 - 26. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Kikkawa, I. Virtanen, and J. H. Miner Mesangial cells organize the glomerular capillaries by adhering to the G domain of laminin {alpha}5 in the glomerular basement membrane J. Cell Biol., April 14, 2003; 161(1): 187 - 196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. B. Huber, M. Schmidts, P. Gerke, B. Schermer, A. Zahn, B. Hartleben, L. Sellin, G. Walz, and T. Benzing The Carboxyl Terminus of Neph Family Members Binds to the PDZ Domain Protein Zonula Occludens-1 J. Biol. Chem., April 4, 2003; 278(15): 13417 - 13421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Balabanian, J. Couderc, L. Bouchet-Delbos, A. Amara, D. Berrebi, A. Foussat, F. Baleux, A. Portier, I. Durand-Gasselin, R. L. Coffman, et al. Role of the Chemokine Stromal Cell-Derived Factor 1 in Autoantibody Production and Nephritis in Murine Lupus J. Immunol., March 15, 2003; 170(6): 3392 - 3400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Kreidberg Podocyte Differentiation and Glomerulogenesis J. Am. Soc. Nephrol., March 1, 2003; 14(3): 806 - 814. [Full Text] [PDF]
|
|
|
|
|
|
H. Kawachi, H. Koike, H. Kurihara, T. Sakai, and F. Shimizu Cloning of Rat Homologue of Podocin: Expression in Proteinuric States and in Developing Glomeruli J. Am. Soc. Nephrol., January 1, 2003; 14(1): 46 - 56. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. C. Morrow, S. Rea, S. Martin, I. A. Prior, R. Prohaska, J. F. Hancock, D. E. James, and R. G. Parton Flotillin-1/Reggie-2 Traffics to Surface Raft Domains via a Novel Golgi-independent Pathway. IDENTIFICATION OF A NOVEL MEMBRANE TARGETING DOMAIN AND A ROLE FOR PALMITOYLATION J. Biol. Chem., December 6, 2002; 277(50): 48834 - 48841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Mundel and S. J. Shankland Podocyte Biology and Response to Injury J. Am. Soc. Nephrol., December 1, 2002; 13(12): 3005 - 3015. [Full Text] [PDF]
|
|
|
|
|
|
M. R. Pollak Inherited Podocytopathies: FSGS and Nephrotic Syndrome from a Genetic Viewpoint J. Am. Soc. Nephrol., December 1, 2002; 13(12): 3016 - 3023. [Full Text] [PDF]
|
|
|
|
|
|
T. A. Natoli, J. Liu, V. Eremina, K. Hodgens, C. Li, Y. Hamano, P. Mundel, R. Kalluri, J. H. Miner, S. E. Quaggin, et al. A Mutant Form of the Wilms' Tumor Suppressor Gene WT1 Observed in Denys-Drash Syndrome Interferes with Glomerular Capillary Development J. Am. Soc. Nephrol., August 1, 2002; 13(8): 2058 - 2067. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Reiser, G. von Gersdorff, M. Simons, K. Schwarz, C. Faul, L. Giardino, T. Heider, M. Loos, and P. Mundel Novel concepts in understanding and management of glomerular proteinuria Nephrol. Dial. Transplant., June 1, 2002; 17(6): 951 - 955. [Full Text] [PDF]
|
|
|
|
|
|
J. H. Miner Focusing on the Glomerular Slit Diaphragm : Podocin Enters the Picture Am. J. Pathol., January 1, 2002; 160(1): 3 - 5. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
