| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |




From the Departments of Pathology,*
Medicine,
and MolecularPharmacology,
Albert Einstein College ofMedicine, Bronx, New York; and the Department ofAnatomy,
Wright State University,Dayton, Ohio
| Abstract |
|---|
|
|
|---|
Recently, stathmin has been identified as a microtubule (MT)-destabilizing factor. In vitro, the protein binds to tubulin,26-29 inhibits MT assembly,9,27,29 and promotes MT catastrophes.26,30 Consistent with this activity, overexpression of stathmin in cells leads to disassembly of MTs9,27,31 and, hence, inability to enter mitosis.17,18 Interestingly, the MT-destabilizing activity of stathmin is controlled by phosphorylation.9,27,31,32 Therefore, the biological function of stathmin is possibly related to its MT-destabilizing activity.
The high degree of evolutionary conservation of the gene encoding stathmin33-37 further suggests that it serves an essential function. It was surprising, therefore, that stathmin knockout mice did not exhibit any overt developmental abnormalities.1 This is presumably because of expression of other members of the stathmin gene family,33,38-40 which includes the genes encoding SCG10, Rb3 (and related proteins derived by alternative splicing), and SCG10-like protein (SCLIP). With respect to SCG10, we have found no evidence for up-regulation in young stathmin knockout mice (Schubart et al1 and unpublished observations).
We have now elucidated a phenotype of stathmin-/- mice by pathological-anatomical, neurophysiological, and molecular studies. Aged stathmin-/- mice were found to develop a progressive axonopathy, suggesting that stathmin is essential for the integrity of the nervous system.
| Materials and Methods |
|---|
|
|
|---|
The generation of stathmin-deficient mice was described previously.1 The line has been maintained by successively backcrossing heterozygotes (stathmin+/-) into the C57BL/6J strain. Homozygous wild-type (stathmin+/+) and mutant (stathmin-/-) mice were F1 mice obtained by crossing stathmin+/- littermates. Animals used for the initial studies were from the second and third backcrosses (N2 and N3). The neuropathological findings were subsequently recapitulated in mice from the sixth backcross (N6). Animals were subjected to clinical examinations as previously described41 for neurological and behavioral assessment of mice with experimental autoimmune encephalomyelitis, an animal model for multiple sclerosis. Specifically, we examined cranial nerves, motor function and sensory perception, coordination, balance, and gait. The mice were bred and housed in the barrier facility maintained by an Association for Assessment and Accreditation of Laboratory Animal Care accredited facility at the Albert Einstein College of Medicine. A total of 97 mice were analyzed, 58 for structural studies, 16 for Western and Northern blotting, and 23 for neurophysiology. Investigators were unaware of the genotype of the animals while carrying out the studies. All procedures were in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and were approved by the Animal Institute Committees of the academic institutions involved.
Genotyping
Genotyping for the targeted stathmin gene was performed on tail DNA, using the polymerase chain reaction, which was performed in polymerase chain reaction buffer (Boehringer Mannheim Corp., Indianapolis, IN) containing 1.5 mmol/L MgCl2, deoxynucleotide triphosphates (1 mmol/L each), three primers, and Taq polymerase (0.05 U/µl) using 25 temperature cycles (94°C, 30 seconds; 57°C, 30 seconds; 72°C, 60 seconds). The primers used were a wild-type allele-specific forward primer (GAGAATCCATGATTGCCAGCAC, 1 µmol/L), corresponding to a region of intron III deleted in the mutant allele; a mutant allele-specific forward primer (CTAATGGCTATAGTTTCATGTTCC, 1 µmol/L), which anneals in the mPGK-1b 3'-flanking region42 that is part of the PGKneo cassette used;1 and a reverse primer (AGCAAAACCAAATTAAGGGCCAGC, 2 µmol/L), corresponding to a region of intron III of the stathmin gene that is retained in the mutant allele. The polymerase chain reaction products obtained from the wild-type and mutant alleles were 463 bp and 610 bp in size, respectively.
Neuropathology
Neuropathological studies were performed as previously described.43,44 Briefly, mice were anesthetized with ether and perfused transcardially either with fixative [2.5% glutaraldehyde in Millonigs buffer (phosphate-buffered saline [PBS] supplemented with 5.4g dextrose/L) or 10% formalin in PBS, pH 7.4], or PBS, pH 7.4. Fixative-perfused tissue was embedded in paraffin or epoxy (Epon 812; Ladd Research Industries, Williston, VT) and PBS-perfused tissue was used for frozen blocks in OCT/Tissuetek or for tissue homogenization and denaturation before immunoblot analysis.
Light Microscopy
Glutaraldehyde/osmium-tetroxide fixed epoxy sections were sectioned on a Reichert ultramicrotome at 1 µm and stained with toluidine blue. Both longitudinal and cross sections were obtained from the optic nerve, corpus callosum, and brain stem. At least four, in most cases six, different levels of spinal cord were sampled, in addition to spinal roots and sciatic nerve, the latter sampled at mid-thigh level.
Immunocytochemistry
Either 10-µm frozen or 1-µm epoxy sections were incubated with primary antibody and developed using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA). The following primary antibodies were used: rabbit anti-stathmin C-terminal peptide,12 1:1000; mouse anti-glial fibrillary acidic protein (GFAP) (Zymed, San Francisco, CA), 1:200; mouse anti-NFH-(strongly phosphorylated) SMI 35 (Sternberger Monoclonals, Baltimore, MD), 1:5000; mouse anti-NFH-(nonphosphorylated) SMI 32 (Sternberger Monoclonals), 1:2000; mouse anti-NFH-(intermediately phosphorylated) SMI 31 (Sternberger Monoclonals), 1:5000; mouse anti-NFL (Sigma Chemical Co., St. Louis, MO), 1:100.
MorphometryLight Microscopy
Abnormal cellular aggregates in white matter, representing the end-stage of central nervous system (CNS) axonopathy (see Results), were counted in stathmin+/+ and stathmin-/- mice of different ages: 21 months of age, four of five mice each; 14 months of age, five of six mice each, and 6 weeks of age, six of six mice each. Matched cross-sections of cervical, thoracic, and upper lumbar spinal cord were scored at x100 magnification.
Electron Microscopy and Ultrastructural Morphometry
Blocks of tissue were selected for electron microscopy after light microscopy of semithin sections. Thin sections (60 to 80 nm) of epon-embedded tissue were mounted on 200-mesh copper grids, stained with lead acetate (1% in H2O) and uranyl acetate (8.5% in ethanol), carbon-coated, and scanned in a Siemens 101 electron microscope. The procedure has been described in more detail elsewhere.45
The basic outline of ultrastructural morphometry has been described elsewhere.43 Briefly, matched cross-sections of spinal cord anterior column and sciatic nerve were scanned at x7.500 magnification and printed at constant enlargement. Three axons each per spinal cord and per sciatic nerve were selected, n = 2 mice (21 months of age) per genotype. Myelinated axons were randomly selected for wild-type littermates. Only axons with a uniformly hyperdense axoplasm were analyzed for stathmin-/- mice. A square of 2.5-cm side-length was drawn into the micrograph and neurofilaments (NFs) and MTs were counted on the micrograph. Thus a total of six axons per mouse was analyzed.
Immunoblot Analysis
Spinal cord tissue of 17-month-old mice (four stathmin +/+ and four stathmin-/-), which had been perfused with ice-cold PBS in situ, was homogenized immediately in 8 mol/L urea. Protein was measured by the Bradford assay46 using Bio-Rad reagents (Bio-Rad Laboratories, Hercules, CA). Aliquots (50 µg) were subjected to immunoblot analysis as previously described.10 In addition to the antibodies described in the Immunocytochemistry section, the following antibodies were used: mouse anti-tubulin (Sigma Chemical Co.); and mouse anti-GFAP (Boehringer Mannheim Corp.). The blots were developed using ECL reagents (Amersham Life Science Inc., Arlington Heights, IL).
Northern Blot Analysis
Brain and spinal cord tissue was dissected from 19-month-old mice perfused with ice-cold PBS, pH 7.4, pretreated with diethyl pyrocarbonate 0.1%, and total RNA was isolated as described.47 To average the abundance of expressed mRNAs, RNA from four knockout mice was pooled. Northern blot analysis was performed as previously described.1,48 32P-labeled DNA probes for stathmin-related transcripts were generated by reverse transcriptase-polymerase chain reaction using normal mouse brain RNA as template. The primers used were: forward (stathmin) 5'-TCCCCGACCCCTTCCTAAATATCC; reverse (stathmin)5'-TACAGCACTAGCCATTAACCCAGC; forward (SCG10)5'-CTAGCTGCTATCATTGAACGTCTGC; reverse (SCG10) 5'-CTTCCCATACTGATATCGCATGATCC; for-ward (Rb3) 5'-AAAAGATTGACCAGTGAAGCCATCC; reverse (Rb3) 5'-GAACAGACGCACACAGACCTTAT-CC; forward (SCLIP) 5'-GTCTAGATGCGAATTTGTGCCTGC; reverse (SCLIP) 5'-GGTTGCCAACACATCCACTAAGAGG.
The amplified products were of the sizes predicted from the published sequences (GenBank accession numbers: AF105222 for Rb3, J04979 for stathmin, AU079912 for SCG10, AF069708 for SCLIP). Autoradiographs were developed with the phosphoimager system and software (Molecular Dynamics, Eugene, OR), and images were analyzed with the software program NIH image. Image analysis was performed on a Macintosh computer using the public domain NIH Image program (developed at the National Institutes of Health and available on the Internet at http://rsb.info.nih.gov/nih-image/).
Neurophysiology
Motor nerve conduction velocity in the sciatic nerve was measured by recording anti-dromic compound action potentials in lumbosacral dorsal roots of 23 mice (15 stathmin-/- and 8 stathmin+/+) anesthetized with ketamine (100 mg/kg, intramuscularly) and pentobarbital (30 mg/kg, intraperitoneally). Stimulus strengths from 0.02 to 1.0 mA (100 µsec duration, 1 to 2 Hz) were applied to the sciatic nerve to evoke anti-dromic action potentials in motor axons. The ventral root recordings consisted of population responses (compound action potentials). The conduction velocity for each root was calculated from the measured conduction distance (range, 27 to 35 mm) divided by the latency of the response at stimulus strengths that generated the maximal response amplitude. The latency was measured as the time from the onset of the stimulus to the beginning of the rapid upward deflection of the voltage trace. Individual conduction velocities measured from an animal were averaged to give a single value for each animal. For analysis, animals were grouped by genotype (stathmin-/- and stathmin+/+). Data (means ± SD) were compared using a two-sample t-test (Sigma Stat 2.0).
| Results |
|---|
|
|
|---|
With age, stathmin-/- mice develop a pan-nervous system axonopathy (see below) that did not result in an apparent clinical phenotype. On inspection, handling, and clinical examination of the mice41,43,44 we could not detect any overt abnormalities between stathmin-/- mice and wild-type littermates. Body weight was lower in stathmin-/- mice, but this difference was not statistically significant.
Stathmin Knockout Mice Develop a Late-Onset AxonopathyLight Microscopy Demonstrates an Involvement of Large-Caliber Myelinated Axons
With age, stathmin-/- mice develop a
pan-nervous system axonopathy with structural and functional
correlates. Affected axons were predominantly heavily myelinated and of
large caliber. At the light microscope level, the earliest pathology
was noted in the spinal cord and sciatic nerve of
stathmin-/- animals 14 months of age, and the
findings progressively worsened with age. This observation was in line
with our previous report on stathmin knockout mice displaying no gross
neuroanatomical abnormalities at birth and during the first months of
life.1
Semithin sections of spinal cord and sciatic nerve
from 20-month-old knockout mice revealed a striking axonal degeneration
of large-caliber axons (Figure 1; A to
F
). The mildest finding consisted of loss of regularity of the axoplasm
with preservation of myelin sheaths (Figure 1; A, B, D, and E
). In
later stages, myelin pathology was observed in association with the
axonal changes. The myelin sheaths were thinned and existed as isolated
lamellae around a tightly packed, hyperdense axoplasm. In other nerve
fibers, myelin debris surrounded tightly packed axonal remnants. In
association with some of these axons, infiltrating cells were observed
within the myelin sheaths and next to degenerating axons (Figure 1E)
.
None of these findings were observed in wild-type
(stathmin+/+) littermates (Figure 1, C and F)
.
For quantitation of the lesions, see below.
|
2 cm lay between spinal roots and sciatic nerve. Lack of
an appreciable difference in axonopathy between roots and sciatic nerve
does not argue for a markedly distal axonopathy. This does not,
however, exclude a subtler distal axonopathy. In all areas, the
abnormal findings were restricted to larger, heavily myelinated axons.
The corpus callosum and other hemispheric white matter tracts were not
affected by the axonopathy. Unmyelinated and small, thinly myelinated
fibers were spared. Furthermore, gray matter of brain, cerebellum, and
spinal cord appeared normal and there was no evidence of ventricular
enlargement. There were also no signs of nervous system inflammation or
irregularities in vascularization. The presence of a pan-nervous system axonopathy in stathmin-/- mice prompted us to examine skeletal muscle for changes consistent with a neurogenic myopathy. We found subtle, yet consistent irregularities in fiber diameter and overly large fibers displaying nuclear hypertrophy and, occasionally, centric nuclei (results not shown). Such changes were present in aged stathmin-/- mice at 14 to 16 months of age, but not in wild-type littermate controls or in young mice of either genotype. The findings are suggestive of a subtle neurogenic late-onset myopathy in stathmin-/- mice.
Stathmin Knockout Mice Develop a Late-Onset AxonopathyUltrastructural Changes
The unmistakable hallmarks of the ultrastructural findings are
depicted in Figure 2
. Large, heavily
myelinated axons showed first signs of degeneration at the age of 12
months, preceding light-microscopic changes by 2 months. The axoplasm
appeared disorganized with an irregular texture and abnormal
distribution of cytoskeletal elements (Figure 2A)
. In contrast to the
normal, regular axoplasm of wild-type littermates (Figure 2B)
,
stathmin-/- mice exhibited a highly irregular
pattern of tightly packed as well as diffuse axoplasm in the same axon
(Figure 2A
and Figure 3B
). In addition,
we noted marked heterogeneity between axons, where axons with tightly
packed axoplasm could be observed next to others that exhibited a low
density of MTs and neurofilaments (NFs) (Figure 2A
and Figure 3B
). The
inhomogeneity of the changes in the axoplasm precluded a standardized
morphometric analysis of NFs and MTs in individual axons (see below).
Longitudinal sections of thoracic spinal cord anterior column did not
reveal discontinuities of MTs or NFs (data not shown). There was also
no evidence of axonal swelling associated with accumulation of NFs, a
feature observed in other axonopathies, such as in motor neuron
degeneration of amyotrophic lateral sclerosis,49
or in
transgenic mouse models, such as those overexpressing NF
subunits,50,51
and those expressing human Cu/Zn superoxide
dismutase (SOD1) with a G93A mutation.52
The distribution
and localization of axonal mitochondria appeared normal in
stathmin-/- mice, suggesting that axonal
transport was not grossly altered (Figure 2A
and Figure 3B
). In the
oldest stathmin-/- mice examined, advanced
stages of axonal decay were seen with dys- and demyelination of
degenerating axons (Figure 2, C and D
; Figure 3, B and C
). In some
cases, infiltrating cells (resembling microglia in the CNS) could be
observed between myelin sheaths and axons (Figure 2D)
. Interestingly,
the somata and proximal dendrites of neurons throughout the CNS were
not affected. Our ultrastructural focus in this respect was spinal cord
motoneurons. MTs in these nerve cells were equally abundant and
regularly distributed in somata and proximal dendrites of
stathmin-/- mice and wild-type littermate
controls of all ages (Figure 2, E and F
; data not shown). With respect
to specific MT pathology in axons, we could not detect anomalies of
shape of MT. Apart from an altered density of all axoplasmic
cytoskeletal components (as described above), there was no anomaly of
abundance, aggregation, and number of MT in
stathmin-/- mice. With respect to motoneuron
somata, these cells were examined for chromatolysis, which could not be
detected.
|
|
Yet another feature of stathmin-/- mice
was the presence of cellular aggregates in the CNS white matter (Figure 3A)
. The size and abundance of these aggregates (nodules) increased
with age and, remarkably, they were absent in wild-type littermates.
The aggregates of large cells resembled hypertrophic astrocytes and
microglia in association with demyelinated and shrunken axons. The
ultrastructure of these lesions suggested that they represent clean-up
reactions of the white matter with debris of degenerated axons and
phagocytosed myelin surrounded by microglial cells and astrocytes
(Figure 3, B and C)
. To obtain quantitative parameters validly
reflecting the neuropathological differences between wild-type
littermates and stathmin-/- mice, we performed
a morphometric analysis of the white matter reactive changes in the
spinal cord. These white matter changes probably represented the
end-stages of axonopathy. As can be appreciated in Table 1
, no such changes were observed in the
wild-type, whereas their number increased in
stathmin-/- mice as they aged from 14 to 21
months (2.6 lesions to 12.5 lesions counted per spinal cord).
|
Gene Expression of Stathmin and Related Genes in the CNS of Aged Mice
To gain further insight into the axonal abnormalities of aging
stathmin knockout mice, we studied the expression of stathmin in spinal
cord and retina of aged mice using immunocytochemistry, using a
stathmin-specific antiserum.12
Stathmin immunoreactivity
was present in neurons with large somata in spinal cord gray matter and
in retinal ganglion cells of aged wild-type mice (Figure 4; A to F
). The intracellular
distribution of stathmin immunoreactivity in these neurons was
restricted to the somata and proximal dendrites (Figure 4C)
. In
contrast, large myelinated axons of the white matter or the peripheral
nervous system did not show detectable stathmin immunoreactivity in
aged wild-type mice. These findings demonstrated that the neurons
extending the large myelinated axons that exhibit axonal abnormalities
in stathmin knockout mice normally expressed stathmin. In aging mice,
we did not detect stathmin immunoreactivity in oligodendrocytes and
Schwann cells. From a previous study, it was known that
oligodendrocytes in early postnatal mice expressed
stathmin.12
|
The absence of a developmental phenotype and the protracted time course
of the abnormalities in stathmin-/- mice made
it likely that related genes were up-regulated, substituting for the
deleted gene. This substitution could not be verified for SCG10 in
earlier stages, as previously reported.1
To investigate
this intriguing question, we performed gene expression studies by
Northern blotting on RNA isolated from brain and spinal cord of aging
mice for SCG10, Rb3, and SCLIP. Stathmin and the latter three genes
constitute the stathmin gene family in which each member has a similar
effect on MT stability and catastrophe rate.53
The
experiments revealed that the three known stathmin-related genes were
expressed at relatively low levels in aged mice. Interestingly,
although expression of SCG10 and Rb3 was not significantly altered,
that of SCLIP was slightly increased in brain and greatly in spinal
cord (Figure 5)
of aged stathmin knockout
mice. SCLIP was expressed at higher level in the brain relative to
spinal cord.
|
The structural pathology prompted us to investigate the
neurophysiology in aging stathmin-/- mice. Aged
knockout mice did not exhibit overt weakness or impaired locomotor or
grooming behavior. Motor axon conduction velocity was significantly
reduced in stathmin-/- mice as compared to
wild-type littermates (mean age, 19 ± 2 months). Representative
recordings from a stathmin-/- mouse and a
stathmin+/+ littermate are depicted in Figure 6
. Of note is that the waveforms and
amplitudes of the ventral root recordings were similar in each case.
However, both the latency and peak of the potential in
stathmin-/- mice were delayed. Interestingly,
there seemed to be even greater slowing of the later components of the
response than of the short latency components, suggesting that smaller
axons may also be functionally affected (Figure 6)
. The results of the
conduction velocity recordings are summarized in Table 2
.
|
|
Chromosomal Mapping Position of the Human Stathmin GeneLack of Adjacent Disease Markers
We investigated the mapping position of the human stathmin gene by querying publicly and privately held databanks (http://www.ncbi.nlm.nih.gov/entrez, OMIM section; http://www.celera.com). The stathmin gene is localized on chromosome 1, 1p36.1-1p35. In this interval, no unassigned disease loci have been mapped. Thus, no neurodegenerative disease, in which an axonopathy could possibly be involved, could be linked to the chromosomal mapping position of the stathmin gene.
| Discussion |
|---|
|
|
|---|
Age-Dependent Axonopathy in Stathmin-Deficient Mice
Our neuroanatomical and neurophysiological studies demonstrated that stathmin-/- mice develop, with age, a progressive axonopathy of large-caliber, heavily myelinated central and peripheral axons. Neuropathology consisted of primary degenerative changes in the axoplasm. The neuropathological phenotype could be unambiguously ascribed to the absence of stathmin expression because the pathology remained unaltered after several backcrosses into the C57BL/6 strain. Consistent with this conclusion was our finding that neurons giving rise to the affected axons in stathmin-/- mice did express the protein in aged wild-type mice. The decrease in compound motor nerve conduction velocity of stathmin-/- mice could very likely be regarded as the functional correlate of the structural abnormalities present in these axons.
The pathological lesions described were distinct from age-related changes that may develop in normal mice.54,55 They also did not resemble findings from previously characterized age-related mouse models of neurodegeneration, such as age-related atrophic changes in motor axons of mice deficient in the mid-sized NF subunit,56 or acquired changes seen in toxic or metabolic neuropathies.
Stathmin Is Essential for Maintaining Axonal Integrity, Suggesting a Novel Function, Possibly Distinct from its Microtubule Destabilizing Activity
The progressive axonopathy that we have described in aging stathmin-/- mice suggests that the protein plays an essential role in maintaining axonal integrity. We speculate that, whereas other genes may compensate for lack of stathmin expression during development, adaptive changes fail later in life. Although we have found that the expression of one of the stathmin-related genes, namely the gene encoding SCLIP, is up-regulated in stathmin-deficient mice, this apparent adaptation does not seem to compensate fully for the loss of stathmin. With respect to whether the axonopathy in stathmin-/- mice is a distal or proximal process, the following circumstantial evidence favors a distal axonopathy: 1) age-related decay of axons in stathmin-/- mice occurred in axons corresponding to those arising from neurons that demonstrate somatic, but not axonal stathmin expression in wild-type littermates; 2) lack of neuropathological changes in somata of these neurons from stathmin-/- mice; 3) predominant involvement of large-caliber axons from long tracts in stathmin-/- mice. However, comparison of spinal roots versus sciatic nerve showed no convincing evidence indicative of a distal worsening.
Defects in other genes have been shown to lead to axonal degeneration52,56-59 or to attenuated repair after axonal injury.60,61 However, the pathology observed in these mouse models is distinct from the axonopathy that develops in stathmin-/- mice. Furthermore, the axonopathy in aged stathmin-/- mice did not resemble the pathology associated with known human diseases of the aging nervous system, such as amyotrophic lateral sclerosis, Alzheimers disease, and Huntingtons disease.49,62 Stathmin, therefore, seems to be a key gene for the maintenance of axonal integrity. Whether a similar axonopathy caused by a deficient stathmin gene exists in humans, remains a subject of future investigations.
The biochemical activity of stathmin that may be responsible for its axon-maintaining function is not known at present. In particular, the nervous system abnormalities uncovered in this study are not readily explained by the previously described pattern of expression and functional properties of stathmin. The MT-destabilizing activity of stathmin suggests that reversible phosphorylation of stathmin participates in the mechanism by which extracellular factors control MT dynamics in neurons, particularly at early stages of neuronal morphogenesis, when stathmin is most abundantly expressed. The lack of developmental defects of the nervous system in stathmin-/- mice was surprising, therefore, but may be explained by abundant expression of other members of the stathmin gene family.39,40,63,64 It seems unlikely that lack of the known MT-destabilizing function of stathmin is responsible for the axonal changes that we have observed. This conclusion is based on the lack of abnormalities, in aged stathmin-/- mice, of the MT cytoskeleton in motoneurons, and on the lack of gross alterations in axonal transport in these animals. Thus, our studies suggest that stathmin serves a function essential for maintaining axonal integrity, that may be distinct from its MT-destabilizing activity. The elucidation of molecular pathways related to stathmins functions will be the subject of future gene expression studies that will use cDNA microarrays, subtractive mRNA hybridization, and differential display.65-67
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by United States Public Health grants RO1 NS 25547 (to R. E. W. F.), NS 08952 and NS 11920 (to C. S. R.), and RO1 NS 26333 (to U. K. S.); and in part by a Feodor Lynen Fellowship of the Alexander von Humboldt Foundation, Bonn, Germany (to W. L.).
Accepted for publication October 17, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. E. Sellin, P. Holmfeldt, S. Stenmark, and M. Gullberg Global Regulation of the Interphase Microtubule System by Abundantly Expressed Op18/Stathmin Mol. Biol. Cell, July 1, 2008; 19(7): 2897 - 2906. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. C. Yang, C. H. Lin, and E. H. Y. Lee Serum- and Glucocorticoid-Inducible Kinase 1 (SGK1) Increases Neurite Formation through Microtubule Depolymerization by SGK1 and by SGK1 Phosphorylation of tau Mol. Cell. Biol., November 15, 2006; 26(22): 8357 - 8370. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zahedi, M. P. Revelo, S. Barone, Z. Wang, K. Tehrani, D. P. Citron, J. J. Bissler, H. Rabb, and M. Soleimani Stathmin-deficient mice develop fibrosis and show delayed recovery from ischemic-reperfusion injury Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1559 - F1567. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tararuk, N. Ostman, W. Li, B. Bjorkblom, A. Padzik, J. Zdrojewska, V. Hongisto, T. Herdegen, W. Konopka, M. J. Courtney, et al. JNK1 phosphorylation of SCG10 determines microtubule dynamics and axodendritic length J. Cell Biol., April 24, 2006; 173(2): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Giampietro, F. Luzzati, G. Gambarotta, P. Giacobini, E. Boda, A. Fasolo, and I. Perroteau Stathmin Expression Modulates Migratory Properties of GN-11 Neurons in Vitro Endocrinology, April 1, 2005; 146(4): 1825 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Southwood, C. He, J. Garbern, J. Kamholz, E. Arroyo, and A. Gow CNS Myelin Paranodes Require Nkx6-2 Homeoprotein Transcriptional Activity for Normal Structure J. Neurosci., December 15, 2004; 24(50): 11215 - 11225. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Strey, D. Spellman, A. Stieber, J. O. Gonatas, X. Wang, J. D. Lambris, and N. K. Gonatas Dysregulation of Stathmin, a Microtubule-Destabilizing Protein, and Up-Regulation of Hsp25, Hsp27, and the Antioxidant Peroxiredoxin 6 in a Mouse Model of Familial Amyotrophic Lateral Sclerosis Am. J. Pathol., November 1, 2004; 165(5): 1701 - 1718. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Errico, P. Claudiani, M. D'Addio, and E. I. Rugarli Spastin interacts with the centrosomal protein NA14, and is enriched in the spindle pole, the midbody and the distal axon Hum. Mol. Genet., September 15, 2004; 13(18): 2121 - 2132. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. JIN, X. O. MAO, B. COTTRELL, B. SCHILLING, L. XIE, R. H. ROW, Y. SUN, A. PEEL, J. CHILDS, G. GENDEH, et al. Proteomic and immunochemical characterization of a role for stathmin in adult neurogenesis FASEB J, February 1, 2004; 18(2): 287 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Walter-Yohrling, X. Cao, M. Callahan, W. Weber, S. Morgenbesser, S. L. Madden, C. Wang, and B. A. Teicher Identification of Genes Expressed in Malignant Cells That Promote Invasion Cancer Res., December 15, 2003; 63(24): 8939 - 8947. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |