| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Departments of Pharmacology*
andSurgery,
University of Pittsburgh,Pittsburgh, Pennsylvania
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Galectin-3 is a Mr 31 kd carbohydrate-binding protein with affinity for ß-galactoside.3,4 This protein is involved in diverse biological processes such as cell-cell and cell-matrix interactions,5-7 induction of pre-mRNA splicing,8 cell proliferation,9 cell cycle regulation,6,10 angiogenesis,11 and more importantly, tumorigenesis12-14 and metastasis.4,12 In a variety of primary and metastatic tumor cells, the level of galectin-3 is elevated compared to that of normal tissues,12 although this has not been a consistent observation.4 Recently, it was shown that the metastatic potential of colon cancer cell lines directly correlated with the expression of galectin-3,15 supporting the role of galectin-3 in enhancing metastasis. However, the mechanisms by which galectin-3 enhances metastasis are yet to be elucidated.
Growing evidence has shown that galectin-3 protects against apoptotic
cell death in response to a variety of apoptosis-inducing stimuli
including staurosporine, anti-Fas antibody, cisplatin, tumor necrosis
factor-
, menadione, and loss of cell
adhesion.6,7,16-18
We hypothesized that galectin-3
enhances metastasis of tumor cells by functioning as a survival factor
against the cytotoxic reactive nitrogen and oxygen species generated
when they are arrested within the microcirculation. In this study, we
show that galectin-3 enhances the metastatic potential of human breast
carcinoma BT549 cells using the experimental liver metastatic model. We
also show that galectin-3 protects BT549 cells from the cytotoxic
effect of the liver fragments previously exposed to ischemia treatment
in a co-culture system, as well as of peroxynitrite treatment in cell
culture. A single amino acid mutation in the NWGR motif obliterates the
metastatic potential enhancement and cytoprotective effect of
galectin-3.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The human breast carcinoma BT549 (BT549par) and its stable clones expressing the human galectin-3 proteins, wild-type (BT549gal-3 wt, clone 11914, reference 13) and mutant (BT549gal-3 mt, clone 5, reference 17), were obtained from Dr. A. Raz (Wayne State University, Detroit, MI). BT549par has a galectin-3 null phenotype and shows nontumorigenic in athymic nude mice. The galectin-3 mutant contains an alanine residue instead of a glycine residue at position 182. All cell lines were grown in Dulbecco’s modified Eagle medium/nutrient mixture F-12 (DMEM/F-12, Life Technologies, Rockville, MD) supplemented with 10% heat-inactivated fetal bovine serum (Hyclone, Logan, UT), 100 units/ml penicillin, 100 µg/ml streptomycin, and 2 mmol/L L-glutamine in a 95% air and 5% CO2 incubator at 37°C.
Animals
Athymic nude (Crl:CD-1-nuBR) and C57BL/6 mice (C57BL/6NCrlBR) were purchased from Charles River (Wilmington, MA). Mice deficient in inducible nitric oxide synthase (iNOS) were generated by the gene targeted disruption method as described19 and backcrossed onto the mice C57BL/6 background through ten generations. All mice were female and 10 to 14 weeks old. Animal protocol was approved by Institutional Animal Care and Use Committee (Protocol no. 0101142).
Experimental Liver Metastasis Model
Experimental liver metastasis was performed according to the procedure described previously.20 Briefly, groups of five athymic nude mice were anesthetized with intraperitoneal injection of 2,2,2-tribromoethanol (200 mg/kg, Aldrich, Milwaukee, WI), and BT549 cells (2.0 x 106) suspended in 0.1 ml of phosphate-buffered saline (PBS) were directly injected into the spleen. All groups were sacrificed 8 weeks after injection and the tumor colonies in the liver and spleen were counted under the dissecting microscope.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) for iNOS mRNA
Total RNA was isolated from approximately 100 mg of liver tissue using RNA-STAT (Tel-test, Friendswood, TX), treated with 10 U/µl of RNase-free DNase (Sigma, St. Louis, MO). Reverse transcription of 1 µg of total RNA to cDNA was carried out using a GenAmp RNA PCR Core Kit (Perkin-Elmer, Foster City, CA) in 20 µl volume, according to the manufacturer’s protocol. The final cDNA samples (2 µl) were added into a PCR reaction mixture (48 µl) containing iNOS primers (sense, ACAACAGGAACCTACCAGCTC; antisense, GATGTTGTAGCGCTGTGT-GTCA). Composition of the reaction mixture was 0.2 µmol/L 5' primer, 0.2 µmol/L 3' primer, 50 mmol/L KCl, 10 mmol/L Tris-HCl pH 9.0, 1.5 mmol/L MgCl2, 200 µmol/L each dNTP, and 0.5 U/reaction Taq DNA polymerase (Perkin Elmer). PCR was performed with 30 cycles (94°C , 1 minute; 60°C, 30 seconds; 72°C, 40 seconds), with initial incubation at 94°C for 3 minutes, and final extension at 72°C for 3 minutes. Ten µl of the amplified products were resolved by 2% agarose gel electrophoresis and visualized with ethidium bromide staining.
Cell Labeling with Fluorescence Dye
For the measurement of cell viability, BT549 cells were labeled
with two fluorescing reagents, rhodamine B-isothiocyanate dextran
10s (Rd-Dx; Sigma), with maximum excitation/emission
at 530/590 nm, and calcein-AM (Molecular Probes, Eugene, OR), with
maximum/emission at 485/530 nm according to the method described
previously with slight modifications.2
Briefly, cells
(5 x 106) were suspended in 20 mg/ml Rd-Dx
in PBS, and received two electrical pulses (capacitance: 330 µF and
300 V; load resistance: high 
; charge rate: fast) using Cell-Porator
Electroporation System I (BRL, Gaithersburg, MD). The
Rd-Dx-loaded cells were incubated for 16 hours at 37°C in complete
tissue culture medium, and then adherent cells were recovered by
trypsin. The cells were suspended in PBS and incubated with calcein-AM
at a final concentration of 4 µmol/L for 30 minutes at 37°C.
Induction of Liver Ischemia
To induce liver ischemia, mice were anesthetized by intraperitoneal injection of 2,2,2-tribromoethanol (200 mg/kg) and the abdomen was aseptically opened. The portal vein and hepatic artery were clamped separately with a hemostat for 3 and 20 minutes, respectively, in athymic nude and C57BL/6 mice.
Mouse Liver/Tumor Cell Co-Culture
The effect of liver tissue on human breast carcinoma cells was studied using a co-culture method.20 Briefly, cells pre-labeled with Rd-Dx and calcein AM were added to a 55-ml rotating wall vessel (RWV, Synthecon, Houston, TX), which had been filled with the co-culture medium (a 1:1 mixture of HepatoZYME-SFM (Life Technologies) and DMEM/F-12). Liver was dissected into 1- to 3-mm fragments, washed once with ice-cold PBS, and then loaded into the RWV. The RWV was connected to a rotator unit equipped with an air pump to provide the RWV chamber with air. The whole co-culture system was placed in a 37°C-incubator with 5% CO2 and rotated at 15 rpm for 24 hours. Following a period of co-culture, tumor cells were observed under a fluorescence microscope (Nikon Microphot-FXL, Tokyo, Japan).
Survival of BT549 Cells with Peroxynitrite Treatment
BT549 cells were plated and grown for 2 days to obtain 70 to 80% confluency before treating with peroxynitrite (Alexis, San Diego, CA). Cell viability was assessed by a Trypan Blue dye exclusion method. Briefly, both floating and attached cells were collected by centrifugation at 200 x g for 3 minutes. Trypan Blue solution (Life Technologies) was added to the cells in equal volume. At least 300 cells were counted using hemacytometer after 15 minutes of incubation at room temperature and survival fraction was calculated.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The human breast carcinoma BT549 cell line has been widely used to
investigate the function of galectin-3 since it does not express this
protein. Introduction of human galectin-3 cDNA into BT549 cells results
in acquisition of a tumorigenic phenotype.13
However, the
effect of galectin-3 transfection on metastatic potential has not been
tested in the BT549 cell line. Therefore, we investigated whether
galectin-3 transfected BT549 cells (BT549gal-3
wt) can produce liver colonization after intrasplenic
injection into athymic nude mice. While none of the animals injected
with BT549par cells developed tumors in the
spleen or liver (Figure 1A, B, E)
, all of
the mice injected with BT549gal-3 wt cells
developed tumors in both the spleen and liver (Figure 1, A, D, G)
.
These results indicate that the galectin-3 protein can enhance the
metastatic potential of BT549 cells. This agrees with previous results
showing that galectin-3 expression correlates with the metastatic
potential of human colon cancer cell lines.15
|
. Since the mutant
galectin-3 is different from the wild-type protein in only one amino
acid residue (glycine to alanine in 182 position) that is located in
the NWGR motif, this result points to the importance of the
antiapoptotic NWGR motif of galectin-3 in promoting metastasis. Galectin-3 Inhibits Ischemia-Reperfusion Mediated Cytotoxicity
Based on previous results, we hypothesized that the promotion of metastatic potential in galectin-3 expressing BT549gal-3 wt cells is associated with resistance against the cytotoxic reactive oxygen and nitrogen radicals which are formed during ischemia-reperfusion. To determine the role of galectin-3 in enhancing tumor cell viability during the liver ischemia-reperfusion period, we cultured BT549 cells in a rotating suspension culture system containing the mouse liver fragments with or without ischemia induction. The reperfusion of the liver fragments is ensured by providing air into the culture vessel with positive pressure using the compressor attached to the device. This co-culture system has great advantages in simulating the in vivo experiments, since the architecture and viability of the liver can be maintained for at least 24 hours.20 To distinguish tumor cells from mouse liver cells, the BT549 cells were dual-labeled with Rd-Dx and calcein-AM. The latter produces a fluorescence signal only in live cells with ATP-dependent cytoplasmic esterase activity.
As shown in Figure 2A
, BT549 tumor cells
in the same field were observed under the fluorescence microscope. The
red-colored Rd-Dx (top panels) and green-colored calcein-AM (bottom
panels) serve as the cell and viability marker, respectively. After
co-culturing with the normal liver fragments for 24 hours, all three
types of the Rd-Dx-labeled BT549 cells showed the green fluorescence of
calcein-AM at the same positions, indicating that BT549 cells maintain
their metabolic integrity under the co-culture system for at least 24
hours. The overall survival fractions were 85.0% to 96.0% (Figure 2B)
. When BT549par cells were co-cultured with
the liver fragments that had been exposed to ischemia in
vivo, more than half of Rd-Dx-labeled cells lost the calcein-AM
fluorescence (pointed by the arrowheads in Figure 2A
), which means that
BT549par cells are killed by the liver fragments
stimulated with ischemia. On the other hand, BT549gal-3
wt cells were not killed by the ischemia-stimulated liver
fragments. The galectin-3-induced enhanced survival of BT549 cells was
completely obliterated with a single mutation in the NWGR motif. These
results indicate that galectin-3 may contribute to the survival of
BT549gal-3 wt cells in the presence of these
toxic chemicals produced by the liver during the ischemia-reperfusion
injury, and that the NWGR motif of the protein is involved in the cell
survival.
|
Jessup and colleagues reported that tumor cells induce ischemia in
microscopic regions of the host liver during the first 24 hours after
arrest in the hepatic sinusoids.2
Based on this, we
postulated that ischemia induced during tumor cell arrest in hepatic
sinusoids leads to the formation of toxic reactive oxygen and nitrogen
species by increasing iNOS expression during reoxygenation. Thus, we
examined whether ischemia-reperfusion of the liver activates iNOS gene
expression. Figure 3
shows that the level
of iNOS mRNA was significantly increased in the liver 2 hours after
ischemia-reperfusion injury, while iNOS gene expression in the normal
liver was not significantly increased. This is similar to our previous
studies using a model of partial hepatic ischemia-reperfusion where
iNOS mRNA can be detected at 3 hours following reperfusion in the
ischemic but not non-ischemic lobe.22
|
To prove the involvement of iNOS in tumor cell death, we adopted
the co-culture system using the liver fragments from iNOS knockout
(iNOS -/-) mice. As shown in Figure 4A and B
, the ischemia-induced liver from iNOS knockout mice did not cause
cytotoxicity to BT549par, BT549gal-3
mt, and BT549gal-3 wt cells. These
results and Figure 2
indicate that NO plays an important role in
ischemia-reperfusion-mediated cytotoxicity. Galectin-3 probably
protects tumor cells from NO and/or
ONOO--mediated cytotoxicity during
ischemia-reperfusion.
|
Although the data presented here and those of others suggest that
the reactive oxygen and nitrogen species are responsible for tumor cell
death after they arrest in the liver sinusoid and terminal portal vein,
the identity of the chemicals that kill the tumor cells is yet to be
determined. Peroxynitrite, a product of NO and
O2-, is thought to contribute
to the pathophysiology of many diseases associated with inflammation
and ischemia-reperfusion injury.23
We tested whether
galectin-3 can inhibit the ONOO--mediated
cytotoxicity in BT549 cells. Figure 5
shows that the treatment of BT549par and
BT549gal-3 mt cells with
ONOO- resulted in cell death in dose- and
time-dependent manners, while BT549gal-3 wt cells
were resistant to ONOO-. For example,
approximately 10% of BT549par and
BT549gal-3 mt cells survived with the treatment
of 200 µmol/L ONOO- for 12 hours, while more
than 90% of BT549gal-3 wt cells survived under
the same conditions. These results suggest that galectin-3 could
protect BT549 cells from cytotoxicity of ONOO-
and the NWGR motif in the COOH-terminus of galectin-3 is involved in
its protective mechanism.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
. While these data provide direct evidence for the role of galectin-3
in metastasis, it is still premature to generalize on the importance of
galectin-3 in metastasis of all types of tumor cells. The conflicting
evidence suggests that the role of galectin-3 in metastasis might be
tissue or cell type-dependent.
The next question addressed in this study is the underlying mechanisms
by which galectin-3 enhances the metastatic potential of tumor cells.
Our results show that galectin-3 enhances survival of BT549 cells and
protects BT549 cells from toxicity associated with iNOS expression and
ONOO- (Figures 2, 4, 5)
. Previous studies
demonstrated that hepatocytes and Kupffer cells produce the reactive
nitrogen and oxygen species during hepatic ischemia and
reperfusion.34-36
This oxidative stress probably leads to
the apoptotic death of breast tumor cells by activating caspases.
Recently, Wang and colleagues reported evidence that NO is a natural
anti-metastatic molecule.37
In that study, the production
of NO in the liver was observed immediately after injection of B16F1
melanoma cells via the portal vein. The injected tumor cells underwent
apoptotic death within 4 to 24 hours and NO production and apoptotic
death was blocked by the iNOS inhibitor,
NG-nitro-L-arginine methyl
ester. However, NO can be either anti- or pro-apoptotic.38
Our previous data indicates that NO inhibits apoptosis in hepatocytes
by suppressing caspase activity and activation.39
Interestingly, iNOS which can be induced by ischemia-reperfusion
(Figure 3
and Reference 22) can induce hepatic injury as shown in
studies comparing iNOS +/+ and iNOS -/- mice.22
This NO
may either protect or injure even liver cells depending on the presence
of oxidant such as O2-. In
general, it is thought that hepatocytes are resistant to
NO,39,40
while tumor cells are sensitive to
NO.41,42
These controversial functions of NO are beginning
to be understood by a recent study, which shows that non-heme iron
content in the cells is probably a key factor in determining the effect
of NO on cell viability by regulating the chemical fate of
NO.43
This is why hepatocytes that contain high levels of
non-heme iron are resistant to NO toxicity. Data from this study shows
that BT549gal-3 wt cells are resistant to the
ischemia-induced liver fragments (Figure 2)
suggesting that galectin-3
may enhance the metastatic potential of BT549 cells by protecting them
from reactive nitrogen and oxygen species generated during the arrest
of tumor cells in the hepatic microvasculature. Although the exact
nature of the toxic chemicals that directly kill the tumor cells is
still unclear, several evidences show that both NO and
O2- are important in
cytotoxicity of tumor cells.2,44
These reports showed that
the cytotoxic effect of the ischemia-induced liver fragments and the
hepatic sinusoidal endothelial cells was abolished in the presence of
either NG-monomethyl-L-arginine (NMMA, an iNOS
inhibitor) or superoxide dismutase (a scavenger of superoxide anions),
suggesting that the direct cytotoxic chemical may be
ONOO-, an adduct of NO and
O2-. In this study, we
demonstrate that galectin-3 transfected BT549gal-3
wt cells become resistant to peroxynitrite treatment
(Figure 5)
. These results indicate that galectin-3 protects cells from
peroxynitrite-induced cytotoxicity.
Finally, a question would arise about the mechanisms by which
galectin-3 protects BT549 cells from the cytotoxicity mediated by
reactive nitrogen and oxygen species. A possible protection mechanism
has been suggested to be the inhibition of apoptosis induced by loss of
cell adhesion by galectin-3.6,7
Our data shows that a
single point mutation in the NWGR motif of galectin-3 results in the
abrogation of its protective effect from the ischemia-induced liver
(Figure 2)
, as well as ONOO- treatment in cell
culture (Figure 5)
. Furthermore, BT549gal-3 mt
cells also lost tumorigenicity and metastatic potential in the
experimental liver metastasis model (Figure 1)
. Since the NWGR motif of
galectin-3 is critical for anti-apoptotic activity,16,21
these results suggest that the protective mechanisms might involve
inhibition of apoptosis on NO and/or ONOO-, and
this anti-apoptotic function directly affects the metastatic potential
of BT549 cells. Presently, the detailed mechanism by which galectin-3
inhibits apoptosis of BT549 cells against these chemicals is yet to be
elucidated. Using other apoptosis-inducing reagents such as cisplatin,
TNF-, and menadione, however, it has been shown that galectin-3
protects cells from apoptotic death by inhibiting the caspase pathway
or by maintaining mitochondrial homeostasis.17,18
In conclusion, we provide evidence that galectin-3 enhances the metastatic potential of human breast carcinoma BT549 cells by increasing resistance to the reactive nitrogen and oxygen species, such as NO and ONOO-, most likely through the bcl-2-like antiapoptotic function of galectin-3. Although we are far from understanding how galectin-3 protects cells from peroxynitrite-induced cytotoxicity and ischemia-reperfusion injury, this model will provide a framework for future studies.
|
Footnotes |
|---|
Supported by National Institutes of Health/National Cancer Institute grant CA-48000.
Accepted for publication December 13, 2001.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  G. A. Rabinovich, A. Cumashi, G. A. Bianco, D. Ciavardelli, I. Iurisci, M. D'Egidio, E. Piccolo, N. Tinari, N. Nifantiev, and S. Iacobelli Synthetic lactulose amines: novel class of anticancer agents that induce tumor-cell apoptosis and inhibit galectin-mediated homotypic cell aggregation and endothelial cell morphogenesis Glycobiology, March 1, 2006; 16(3): 210 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mazurek, Y. J. Sun, J. E. Price, L. Ramdas, W. Schober, P. Nangia-Makker, J. C. Byrd, A. Raz, and R. S. Bresalier Phosphorylation of Galectin-3 Contributes to Malignant Transformation of Human Epithelial Cells via Modulation of Unique Sets of Genes Cancer Res., December 1, 2005; 65(23): 10767 - 10775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Hoyer, M. Pang, D. Gui, I. P. Shintaku, I. Kuwabara, F.-T. Liu, J. W. Said, L. G. Baum, and M. A. Teitell An Anti-Apoptotic Role for Galectin-3 in Diffuse Large B-Cell Lymphomas Am. J. Pathol., March 1, 2004; 164(3): 893 - 902. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
