| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |




**¶
From the Division of Cancer Pathobiology,*
ResearchSection of Pathophysiology, and the Division of Cancer GeneRegulation,
Research Section of DiseaseControl, Institute for Genetic Medicine, Hokkaido University, Sapporo,Japan; Fujirebio
Incorporated, DiagnosticResearch Laboratories, Hachioji, Japan; and the Second Department ofOral and Maxillofacial Surgery,
HealthSciences University of Hokkaido, Tobetsu, Ishikari,**
Oraland Maxillofacial Surgery,¶
Gifu UniversitySchool of Medicine, Tsukasa, Gifu, Japan
| Abstract |
|---|
|
|
|---|
Animal tumor models are revealing genes associated with tumor progression that also appear in human cancers such as NM23,1 Kiss-1,2 mts1,3 and CD44,4 which are differentially expressed between high- and low-metastatic tumor cells. The tumor progression model of mouse fibrosarcoma cells (QR clone) has been established by our group, which has advantages compared to other models.5-10 The QR tumor clones regress spontaneously after injection of up to 2 x 105 cells subcutaneously or 1 x 106 cells intravenously in normal syngeneic mice; the tumor regression is mediated by host immunity because the tumor cells grow progressively in immunosuppressed or nude mice and a tumor cell-derived immunosuppressive factor, prostaglandin E2 (PGE2) is associated with this process.11 Thus by using QR clones, we are able to mimic the natural course of tumor progression, ie, transition from weak tumorigenicity and nonmetastatic benign tumor cells or dormant state of tumor cells to tumorigenic/metastatic malignant tumor cells in mice. The transitional change can be determined by augmented tumorigenicity or metastatic potential.5-10 The model is available for detection of possible internal or external factors for tumor progression. We have previously identified that inflammation5-7,12 or antitumor drug treatments8-10 accelerated tumor progression and the resultant daughter cells possessed irreversibly stable malignant phenotypes, all of which derived from a clonal QR-32 tumor line. Comparison of the genes between single-cell-originated benign tumor cells and its derived malignant tumor cells would be of benefit for identifying the progression-associated gene alterations because of their very close genetic backgrounds.
We tried to define gene expression comparatively between QR-32 cells and its derived progressor cell line, QRsP-30 cells by differential display and the identified thymosin-ß4 gene was transcriptionally elevated in all of the malignant tumor cell lines we tested. We demonstrated that thymosin-ß4 expression regulated tumorigenicity, cell motility, and metastatic potential of fibrosarcoma cells through actin-based cytoskeletal organization by sense and antisense thymosin-ß4 cDNA transfection strategy.
| Materials and Methods |
|---|
|
|
|---|
The weakly tumorigenic and poorly metastatic mouse clonal fibrosarcoma cell line QR-32, its derivative highly tumorigenic and highly metastatic cell line, QRsP, and the transfectants were maintained as previously described.5,7 Briefly, these cell lines were maintained in Eagles minimum essential medium that contained 8% fetal bovine serum, sodium pyruvate, nonessential amino acids and L-glutamine, at 37°C, in a humidified 5% carbon dioxide/95% air mixture.
mRNA Differential Display
The mRNA differential display was performed following the original technique described by Liang and Pardee.13 DNase I-digested total RNA (1 µg) from QR-32 and QRsP-30 cells were, respectively, reverse-transcribed with 200 U of Superscript RNase H-reverse transcriptase (GIBCO BRL) in the presence of 2.5 µmol/L of one of four anchored primers, T15MG, T15MC, T15MA, and T15MT (Operon Technologies Inc.). Sixty arbitrary 10-mer primer (Operon Technologies, Inc.) was selected at random to be used for polymerase chain reaction (PCR) with the appropriate anchored primer with 5 U/µl of Taq polymerase (Takara). The cycling conditions were 3 minutes at 94°C, 5 minutes at 40°C, 5 minutes at 72°C (1 cycle), 15 seconds at 95°C, 2 minutes at 40°C, 1 minute at 72°C (25 cycles), and 5 minutes at 72°C (1 cycle). Two independent reaction products, respectively, from QR-32 and QRsP-30 cells were separated in 8% polyacrylamide gel with glycerol-tolerant running buffer (United States Biochemical). Differentially expressed cDNA bands were directly excised from the gel and reamplified with the same primer sets in high-stringency conditions. Bands were then cloned into pGEM-T (Promega Corp.) and sequenced with ALF express sequencer (Amersham Pharmacia Biotech).
Vector Construction of Sense or Antisense Nucleotide of Thymosin-ß4 and Preparation of Transfectants
The coding region of thymosin-ß4 (nucleotides 158 to 292) was cloned from QRsP-30 cDNA library by PCR. The coding region of thymosin-ß4 cDNA was inserted into the pcDNA3.1 vector, which contains the cytomegalovirus enhancer-promoter (Invitrogen) at the PmeI and XhoI sites in the direction of sense or antisense orientation. The orientation of the insert was determined by enzymatic digestion and it was confirmed that no mutations were introduced during the PCR amplification by direct DNA sequencing (data not shown).
The thymosin-ß4 sense or antisense vector, and the vector alone pcDNA3.1 were individually transfected into tumor cells with Lipofectin reagent (GIBCO/BRL). Transfectants stably expressing the introduced vector were selected by continuous neomycin treatment with 400 µg/ml (Geneticin, GIBCO/BRL). Neomycin-resistant cells were cloned by the limiting dilution method and maintained in the medium containing neomycin.
RNA Extraction and Northern Blot Analysis
Total RNA was isolated from cells exponentially growing in
vitro with a Trizol reagent (GIBCO/BRL). Twenty µg of total RNA
was size-fractionated on a denaturing formaldehyde-agarose gel (1.0%)
and transferred onto trans-Blot transfer membrane (Bio-Rad).
The membrane was hybridized at 42°C for 24 hours with denatured
thymosin-ß4 probe labeled with [
-32P] dCTP
(Amersham) with the use of a random-primer DNA-labeling kit (Takara,
Japan) in the buffer containing 50% formamide, 5x SSPE, 0.5% sodium
dodecyl sulfate (SDS), 5x Denhardts solution, and 100 µg of
denatured salmon sperm DNA. Then the membranes were washed with 2x
standard saline citrate and 0.1% SDS at room temperature for 10
minutes, 0.2x standard saline citrate and 0.1% SDS at room
temperature for 10 minutes, and then 0.2x standard saline citrate and
0.1% SDS at 42°C for 60 minutes. To confirm the amounts of RNA
loaded in each lane, the blots were hybridized afterward with a L38
cDNA.14
Image analysis was performed with BAS2000II system
(FUJIX, Japan).
Reverse Transcriptase (RT)-PCR Analysis
Three hundred ng of total RNA was used for the synthesis of the first-strand cDNA in a 20-µl reaction mixture containing 1x first-strand buffer (GIBCO/BRL), 7.5 mmol/L dithiothreitol, 0.5 mmol/L MgCl2, 0.5 mmol/L dNTO, 100 pg random primer (GIBCO/BRL), and Moloney murine leukemia virus reverse transcriptase (GIBCO/BRL). The reverse transcription was done in a block incubator (Astec, B1-525; Japan) for 50 minutes at 37°C after annealing at 25°C for 10 minutes. PCR was performed at 95°C for 5 minutes and on ice for 5 minutes in a block incubator. PCR was performed in a 20-µl reaction mixture containing 1x native pfu buffer (Stratagene), 200 nmol/L of each primer, 0.2 mmol/L dNTPs, and 0.25 U of native pfu polymerase (Stratagene). Gene-specific primers were designated to span the coding region of mouse thymosin-ß4 (5' to 3'); thymosin-ß4 upstream, CCTCATCCTCCTCGTCCTTA; thymosin-ß4 downstream, TGATCCAACCTCTTTGCATC. Control studies for RT-PCR were conducted by using aliquots from the same samples and amplifying them with primers to GAPDH gene (5' to 3'); mouse GAPDH upstream, GGGTGTGAACCACGAGAAAT; mouse GAPDH downstream, GGTCCTCAGTGTAGCCCAAG. RT-PCR of mRNA encoding mouse thymosin-ß4 and GAPDH resulted in PCR products of 295- and 442-bp long, respectively. The PCR cycles consisted of 1 minute initial denaturation at 95°C, followed by 35 cycles of 95°C for 40 seconds, 59°C for 40 seconds, and 78°C for 1.5 minutes in a thermal cycler (2400R, Perkin Elmer). Each PCR amplification included a negative control containing all of the reaction products except cDNA. Five µl of each PCR product was separated in 2% agarose (Iwai Chem. Pharm., Japan), and stained with ethidium bromide, and photographed under UV light.
Thymosin-ß4 Monoclonal Antibody Preparation and Peptide Inhibition Assay
Because synthetic full-size peptide of human thymosin-ß4
gave no antibody rise on intraperitoneal injections into BALB/c mice,
we therefore used the N-terminal half of thymosin-ß4 molecule. The
synthetic peptide (Thyb4-2: MSDKPDMAEIEKFDKSKLKKTETQEKN) was made with
an additional Cys moiety at the C-terminal position for conjugation
with KLH. Mice were immunized three times with the Thyb4-2 (20 µg/ml)
and Freunds complete adjuvant. Two weeks later, the mice were boosted
with Thyb4-2 and Freunds noncomplete adjuvant. After the final
immunization, the spleen was fused with myeloma cells (P3U1) and 50%
PEG (1500; Boehringer Mannheim Yamanouchi, Tokyo, Japan) with the
standard screening method to obtain a desired monoclonal antibody,
TB4N1-5. The subclass of the antibody was IgG1 (
). The established
hybridoma cells were injected intraperitoneally into BALB/c mice to
produce ascites and the antibody was purified with the use of a
protein-A column.
For peptide competitive inhibition assay, 96-well plates were coated with synthetic peptide Tyb4-2 (2 µg/ml) of thymosin-ß4 for overnight at 4°C. After washing with phosphate-buffered saline (PBS) containing 0.02% Tween 20 (T-PBS), the plates were incubated with 1% skim milk in PBS. Then TB4N1-5 antibody (5 µg/ml) was added to the wells with serially diluted synthetic peptide Tyb4-2 (for thymosin-ß4) or Tyb10 (for thymosin-ß10, full size) as a control, and the plates were incubated for 3 hours at 37°C. After three washes, anti-mouse immunoglobulins conjugated with horseradish peroxidase were added to the wells and incubated for 1 hour at 37°C. After three washes, an ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt]/H2O2 solution (0.1%/0.003%) in citrate/phosphate buffer (0.1 mol/L, pH 4.5) was added to each well. After 10 minutes, absorbance was measured at 405 nm.
Protein Extraction and Western Blotting
Proteins were extracted from cell lines and Western blot analysis was performed as follows. Briefly, lysates of the cultured cells were prepared in Laemmlis buffer.15 Then 100 µg of the protein was separated by electrophoresis on a SDS-10% polyacrylamide gel. The gel was incubated in phosphate-buffered saline (PBS) containing 10% glutaraldehyde (Wako Pure Chemical Ind., Japan) for 1 hour, washed three times in PBS for 20 minutes, and further incubated in a blotting buffer for 30 minutes at room temperature. The protein was transferred to a polyvinylidene difluoride membrane (Immobilon-P; Millipore, Japan) by electrotransfer. The membrane was preincubated for 2 hours with 5% skim milk in PBS containing 0.05% T-PBS. The membrane was incubated for 1 hour at room temperature with a monoclonal antibody to thymosin-ß4 (TB4N1-5). After five washes with T-PBS, the membrane was incubated with horseradish peroxidase-conjugated sheep anti-mouse immunoglobulin antibody (NA931, Amersham) for 1 hour at room temperature. After five washes of the membrane with T-PBS, the specific protein-antibody reaction was detected by the enhanced chemiluminescence detection system (Amersham). The intensities of individual bands were semiquantified by means of densitometry of autoradiogram with the Kodak Digital Science (IS 440CF). Each membrane was stained with 0.1% Amido Black 10B (161-0402, BioRad) and equivalence of the loading protein was confirmed in each lane.
Immunofluorescence, Texas Red-X Phalloidin Staining, and Confocal Images
Cells from each cell line were allowed to spread on glass coverslips (22 x 22 mm; Matsunami Glass, Japan) in 6-well plates (no. 3046; Falcon). The cells were fixed with 3.0% paraformaldehyde and then permeabilized with 0.1% Triton X-100 for 5 minutes. The cells were treated with 70% methanol for 5 minutes at -30°C and washed with 0.1% bovine serum albumin in T-PBS (PBT). Then the cells were stained with anti-thymosin-ß4 antibody (TB4N1-5, 1 µg/ml) for 1 hour, followed by incubation for 1 hour with Alexa 488 anti-mouse IgG (A-11029, 10 µg/ml; Molecular Probes). Thereafter F-actin staining was done by incubating with 1 U of Texas Red-X phalloidin (T-7471, Molecular Probes) for 1 hour. Cells were mounted and analyzed by confocal microscopy as follows. The confocal scanning laser microscope images were generated on a confocal laser-scanning microscope equipped with an argon laser and ZEISS 63x oil immersion (1.4 n.a.) objective. The condition for confocal imaging was fixed as follows and scanning was done exactly and the same condition at one time. Image collection: speed, normal; collection filter, Kalman, Factor 1; and box and pixel size, 512 x 512 pixels (0.4 µm/pixel). PhotoMultiplier: iris, 2.0; gain, 1500; BLev, 0; emission filter, 605 DF32; and low signal, checked. The final images were volume rendered on a computer (DELL Power Edge 2200) using Bio-Rad Sharp Confocal System (MRC-1024 version 3.2, Bio-Rad). The digital images were subsequently photographed with a digitalized film recorder (Color Video Copy Processor, CP2000; Mitsubishi, Japan) onto a paper sheet (model CK2000L, Mitsubishi Electric).
Determination of in Vitro Tumor Cell Growth, Plating Efficiency, and Soft Agar Colony Formation
For in vitro cell growth analysis, cells were seeded into a 6-well plate (1 x 105 cells per well). The medium was changed every other day. The cells were harvested and counted every day from day 1 to 7 by trypan blue exclusion test. Doubling time was calculated from the logarithmic phase of the growth curve.
For evaluation of plating efficiency, 1 x 103 cells suspended in the medium containing 8% fetal bovine serum were plated into 60-mm dishes (MS-10600; S.B. Medical, Japan) in triplicate. The dishes were incubated for 7 days, and colonies were fixed in Carnoys fixative, stained with 0.1% crystal violet, and scored.
For determination of the soft agar growth (anchorage-independent), 2 x 102 cells were suspended in 1 ml of the medium containing 0.3% agar (GIBCO/BRL) and twice volume of fetal bovine serum, and applied onto the presolidified 0.6% agar (1 ml) in 6-well plates. Triplicate plates were prepared for each cell line. After 3 weeks of incubation, colonies larger than 0.1 mm in diameter were scored.
In Vitro Cell Motility Assays
Phagokinetic Track Assay
Uniform carpets of gold particles were prepared on glass coverslips (22 x 22 mm) coated with bovine serum albumin as described previously.16 The gold particle on glass coverslips was placed in 35-mm culture dishes (627160, Greiner Labortechnik) containing 2 ml of Eagles minimum essential medium supplemented with 8% fetal bovine serum. Then 2 x 103 cells were added to each dish. After 48 hours, phagokinetic tracks of 40 cells were visualized under a microscope. The area cleared of gold particles by a cell was quantified by using a microscope analyzer (Cosmozone R500; Nikon, Japan).
Scratch Wound Closure Assay
Confluent tumor-cell monolayers on glass coverslips (22 x 22 mm) in six-well plates were scraped using a pipette tip (MARS, CL-200; Japan) to make a wound 22-mm long. The cells were incubated at 37°C and allowed to migrate into the wound for intervals of several hour, then fixed and stained with 0.1% crystal violet. The numbers of cells that moved into the 22-mm2 area in each line were counted in a microscope.
Subcutaneous Tumorigenicity and Metastasis Assay in Vivo
Animal protocols were approved by the Committee of Institute for Animal Experimentation at the Hokkaido University School of Medicine (no. 9910). Female C57BL/6 mice were purchased from Japan SLC and used at 6 to 10 weeks of age. Subcutaneous tumorigenicity was examined by injecting 2 x 105 cells/0.2 ml into the subcutis of the mice. In the study on spontaneous metastasis, moribund mice were sacrificed and the organs were removed, weighed, and the number of metastatic nodules on the surface of lung and the other organs were counted macroscopically.
Experimental metastatic potential of the cells was measured by the lung colonization assay as described previously.5 In brief, the cells were injected into the tail vein of mice at the density of 1 x 106 cells/0.2 ml. Twenty-five days later, the mice were sacrificed and the metastatic nodules on the lung surface and the other organs were counted macroscopically.
Statistical Analysis
Differences in the subcutaneous tumor and those in spontaneous and experimental metastases were evaluated by chi-square test. Differences in the plating efficiency, the latency periods, the mean survival times, and the motility of tumor cells were calculated by Students t-test.
| Results |
|---|
|
|
|---|
We have previously found that foreign body-induced inflammation
not only promotes the local growth of weakly tumorigenic and
nonmetastatic tumor cells (QR-32) but also converts them into more
aggressive tumors (QRsP), ie, they acquire enhanced tumorigenicity and
metastatic ability.5
Using differential display, we
identified 23 genes that were expressed differentially between QR-32
cells and its derivative highly tumorigenic and metastatic fibrosarcoma
cell line, QRsP-30. Based on Northern blot analysis of those 23 genes,
we further selected 3 genes. To identify these genes, we extracted the
differential display bands, reamplified, and sequenced. A search in the
BLAST computer database found that these cDNAs were more than 90%
homologous to calcyclin, thymosin-ß4, and vimentin, respectively
(data not shown). Figure 1
illustrates a
typical example of differential display (Figure 1A)
and a Northern blot
(Figure 1B)
that confirms the existence of 0.7-kb thymosin-ß4 mRNA in
the QRsP-30 cells but not in the parental QR-32 cells.
|
Regulation of Thymosin-ß4 Expression in QR-32 or QRsP-30 Cells by Sense or Antisense Thymosin-ß4 cDNA Transfection
To elucidate the role of thymosin-ß4 in tumor malignancy, we
introduced the pcDNA3.1 expression vector containing the cDNAs encoding
either sense and antisense orientation of the mouse thymosin-ß4 into
QR-32 cells and QRsP-30 cells, respectively. To obtain sense
thymosin-ß4-transfected QR-32 cells, we initially isolated 24
neomycin-resistant clones, all of which were then screened for
expression of thymosin-ß4 mRNA. Sense or antisense transcripts of the
thymosin-ß4 in the transfected cells were determined by RT-PCR
amplification with the primers designated to span the coding region of
thymosin-ß4. Thymosin-ß4 was expressed at 295 bp in 32-S cells
(Figure 2A)
. To obtain antisense
thymosin-ß4-transfected QR-30 cells, we isolated 20
neomycin-resistant clones and then screened for thymosin-ß4 and
measured its expression. We isolated four 30-AS clones that reduced
thymosin-ß4 transcripts as shown in Figure 2B
. We tested more than
100 clones from QR-32 or QRsP-30 cells transfected with empty vector.
However, as far as we tested, we could not find any clone that changed
thymosin-ß4 expression. Therefore, we considered that alteration of
thymosin-ß4 levels in the sense or antisense cDNA transfected cells
was caused by the transfected thymosin-ß4 gene instead of the
transfection procedures, ie, vector construct or neomycin selection.
|
|
|
|
We evaluated the metastatic ability of the transfectants (Table 2)
. None of the QR-32 cells or 32-V
clones, except the 32-V1 clone, metastasized to lung after intravenous
injection into C57BL/6 mice. In contrast, 32-S clones developed lung
metastatic nodules and significantly increased incidences of lung
metastasis. Two of four 32-S clones metastasized to other organs such
as ovary or peritoneal cavity. In contrast, QRsP-30 and 30-V clones
aggressively metastasized to the lungs, ovaries, and peritoneal
cavities; however, antisense thymosin-ß4 cDNA-transfected clones,
30-AS4 and 30-AS9, had significantly less lung colonization and none of
the 30-AS clones had metastasis in other organs. Under similar
conditions, the mean survival periods of 30-AS clone-injected mice were
significantly longer than those of QRsP-30 or 30-V clone-injected mice
(60.2 ± 12.0 versus 45.1 ± 12.5 or 49.1 ±
10.4 days, respectively, P < 0.001).
|
|
Thymosin-ß4 Expression and in Vitro Tumor Cell Motility
The motility of thymosin-ß4 transfectants and their control
cells was examined using two separate assays. We used phagokinetic
track assay to examine motile potential of single cells. The mean
motility of 32-S clones was 57.1 ± 7.5 x
103
µm2, which was
3.6-fold greater than that the mean values of 15.9 ± 1.0
µm2
determined in the 32-V clones (Figure 5A)
. The motility of QRsP-30 cells was
5.2-fold greater than that of the parental QR-32 cells; however, 30-AS
clones were less motile than 30-V clones: 47.1 ± 5.8 x
103
µm2
versus
88.5 ± 1.1 x 103
µm2
(Figure 5B)
.
|
These results demonstrated that level of thymosin-ß4 expression is associated with cell motility, suggesting that thymosin-ß4 may regulate metastasis by controlling cytoskeletal alterations essential for cell motility.
Thymosin-ß4 Expression and Actin-Based Cytoskeletal Organization
We next examined thymosin-ß4 expression by immunofluorescence
staining with anti-thymosin-ß4 antibody (green) and actin-based
cytoskeletal changes by Texas Red-X phalloidin staining (red) using
confocal microscopy. Thymosin-ß4 expression was observed mainly in
the cytoplasm of the cells that was coincident with the previous
reports.17,18
Low expression of thymosin-ß4 in 32-V and
30-AS clones have strong F-actin staining at the cytoskeleton (Figure 6)
, however, high expression of
thymosin-ß4 in 32-S and 30-V have weak and irregular staining.
Sensitive confocal laser sectioning and subsequent computer-assisted
image merging revealed that thymosin-ß4 partially merged with F-actin
but thymosin-ß4 mainly localized at the cytoplasm, whereas F-actin
localized at the cytoskeleton (Figure 6)
.
|
| Discussion |
|---|
|
|
|---|
ß-thymosins are a family of small peptides that were originally supposed to be thymic hormone.19 They were then identified as actin monomer-binding proteins20,21 that bind monomeric actin (G-actin) and disturb the assembly of filamentous actin (F-actin).22,23 The balance of those two types of actins maintains the cytoskeletal actin for polymerization.19,20 Among ß-thymosin members, thymosin-ß4 has been the most thoroughly studied, which is expressed ubiquitously in mammalian cells.24,25
Enhanced thymosin-ß4 expression is observed in medullary thyroid carcinoma26 and renal tumor27 as compared with their normal counterparts. Clark and colleagues28 have recently reported that thymosin-ß4 is involved in the formation of metastasis of both human and mouse melanoma cells from their analysis by DNA array. We found that thymosin-ß4 was highly expressed in the tumor cells progressed from weakly tumorigenic and nonmetastatic fibrosarcoma cells and that the expression regulated not only tumorigenicity but metastatic ability of the tumor cells that is facilitated through cell motility. Stimulation of cell motility phenotype is a common feature of ß-thymosins as seen in thymosin-ß1029 and thymosin-ß15.30 It was also reported that those ß-thymosins are expressed in advanced tumors and highly metastatic human tumor cells.30-34 Namely, increased cell motility is associated with enhanced metastatic potential of animal and human tumors.35,36
Interestingly, we found that thymosin-ß4 expression regulated plating
efficiency, whereas in vitro cell growth or ability of
colony formation was not associated with thymosin-ß4 expression
(Table 1)
. These results may indicate that thymosin-ß4 regulates cell
attachment to substrate and spreading. Figure 4
shows that dramatic
morphological alteration followed thymosin-ß4 expression. The
thymosin-ß4-induced morphological change is quite similar to what is
referred as epithelial-to-mesenchymal transition (EMT). It has been
suggested that EMT occurs in many developmental systems and tumor
metastasis, and that it is triggered by balanced cross-modulation among
cell-cell adhesion molecules (such as E- or N-cadherins), cell-ECM
adhesion molecules, and actin-based cytoskeletal molecules. On the
basis of our results and other researchers,37,38
we
suggested that increased adhesion, spreading, and EMT-like
morphological changes could be because of the downstream effects of the
increased thymosin-ß4.
Significant progress has been made recently in identifying and
clarifying the roles of thymosin-ß4. It is known that thymosin-ß4
is involved in the regulation of actin-based cytoskeleton and focal
adhesion proteins that are localized to the termini of the stress
fiber-like actin filaments, as well as in the cell-cell junctions
adjacent to circumferential actin bundles.39
Thymosin-ß4
induces myosin IIA,
-actinin, and tropomyosin expressions that are
known to compose stress fibers or the actin
bundles,38,40,41
also, it has been shown to induce focal
adhesion proteins such as vinculin, talin,
5-integrin, focal adhesion kinase
(pp125FAK),38,40,41
and possibly to
cross-link to p130 Crk-associated substrate (Cas) and
paxillin.42-45
Both thymosin-ß446
and
actin47
serve as an endogenous substrate for
transglutaminases; therefore, the thymosin-ß4 seems to play an
important role in transglutaminase-related apoptotic processes in
vivo. Niu and Nachmias42
have reported that enhanced
thymosin-ß4 gene expression induced resistance to ultraviolet or
TNF-
-induced apoptosis in NIH3T3 cells, which was dependent on the
phosphorylation of focal adhesion kinase
(pp125FAK) and its-associated actin
cytoskeleton-associated protein, paxillin.48
Taken
together, escape from physiologically induced apoptosis in
vivo will be an important factor for survival of malignant tumor
cells. Furthermore, thymosin-ß4 stimulates
angiogenesis,49,50
wound healing,51
and blood
coagulation;20,52
all of these are critical for tumor
cells to acquire metastatic phenotype. Reorganization of the actin
network by thymosin-ß4 expression may therefore affect the dynamics
of focal adhesion assembly and lead to modulation of cell-substratum
interaction, cellular shape, cell motility, cell survival, and
consequently metastatic ability of tumor cells.
The expression of thymosin-ß4 after malignant progression of mouse fibrosarcoma cells differed depending on the causes of progression. All of the malignant fibrosarcoma cell lines used in this study, converted from QR-32 cells by inflammation induced at the implantation site, expressed high levels of thymosin-ß4 mRNA. We have recently established an in vivo model of tumor progression in which the QR-32 cells acquire malignant phenotype by administration of antitumor drugs, such as adriamycin,9 cis-diaminedichloro-platinum (II) (cisplatin), or UFT.10 Such antitumor drug-induced malignant tumor cell lines express only a slight increase of thymosin-ß4 mRNA expression (less than threefold as compared to QR-32 cells, data not shown). We observed that activated leukocyte cell adhesion molecule and annexin II genes were expressed in the antitumor drug-induced malignant tumors cells and that they controlled their metastatic potential.8 Those results indicate the gene expression associated with malignant conversion of QR-32 cells strictly differ depending on the causes of progression.
The correlation between thymosin-ß4 expression and tumor malignancy
does not seem to be a common phenomenon in all of the organs. Yamamoto
and colleagues53
showed an inverse relation between
thymosin-ß4 expression and the liver metastatic ability of human
colorectal carcinoma cells. There was no explanation in that work how
the reduced expression of thymosin-ß4 related with the promoted
metastatic ability. An interpretation of the discrepancy is still
unclear, however, several points need to be taken into account to
clarify the role of thymosin-ß4 in carcinogenesis and metastatic
potential of tumors. Firstly, the organ environment and genetic
alteration(s) affects the ß-thymosin expression. We observed that the
thymosin-ß4 expression in the in vivo growing malignant
tumor cells (Figure 1, C and D)
was much higher than that of the
thymosin-ß4-transfected tumor cells (Figure 2A)
. We speculated that
this phenomenon resulted from host selection pressure to allow highly
thymosin-ß4 expressed cells to grow. Another speculation was that the
thymosin-ß4 level can be altered rapidly by environmental
stimuli.54
A recent report has shown that oxidation also
modulates the function of thymosin-ß4; for instance, it attenuates
G-actin sequestering activity.55,56
Other studies have
demonstrated that, tumor-suppressing maspin (mammary serine protease
inhibitor) is one of the isoforms of serpin binding to thymosin-ß4 as
ligand57
and that the maspin is regulated directly by the
p53 tumor suppressor gene.58
It is well known that p53
mutation in the colorectal tumors is accumulated at advanced phase; it
is most likely that the environmental circumstances of the colorectal
carcinoma (ie, oxidative stress induced by inflammation or bacterial
microflora) may directly or indirectly modulate the function of the
thymosin-ß4. Secondly, in most studies only one type of ß-thymosin
has been investigated, although most cells and tissues express at least
two or three ß-thymosins that may share the same function(s). In the
colon, the major ß-thymosin may vary. Califano and
colleagues33
have observed that overexpression of
thymosin-ß10, which is another abundant ß-thymosin in mammalian
cells24
with a high degree of sequence homology to
thymosin-ß4, in the neoplastic transformation of the colon epithelial
cell.
To show tumorigenic and metastatic function of ß-thymosins in relation with their G-actin sequestering activities, we need to determine the intracellular peptide concentration or changes in G-actin/F-actin ratio or identification of receptors for the peptide. Investigations at such standpoints of view will help us elucidate the role of ß-thymosin in tumor development and progression, for which we are now undertaking experiments.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by a grant-in-aid for Cancer Research from the Japanese Ministry of Health, Labor, and Welfare (10-1 to M. H. and 10-36 to F. O.) and a grant-in-aid from Japanese Ministry of Education, Culture, Sports, Science, and Technology (to F. O.).
Accepted for publication November 21, 2001.
| References |
|---|
|
|
|---|
6ß4 integrin in a breast cancer cell line alters invasive potential. Exp Cell Res 1997, 235:325-333[Medline]
This article has been cited by other articles:
![]() |
K. Iguchi, M. Ito, S. Usui, A. Mizokami, M. Namiki, and K. Hirano Downregulation of Thymosin {beta}4 Expression by Androgen in Prostate Cancer LNCaP Cells J Androl, March 1, 2008; 29(2): 207 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bednarek, J. Boncela, K. Smolarczyk, A. Cierniewska-Cieslak, E. Wyroba, and C. S. Cierniewski Ku80 as a Novel Receptor for Thymosin 4 That Mediates Its Intracellular Activity Different from G-actin Sequestering J. Biol. Chem., January 18, 2008; 283(3): 1534 - 1544. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Okada, M. Kobayashi, H. Tanaka, T. Kobayashi, H. Tazawa, Y. Iuchi, K. Onuma, M. Hosokawa, M. C. Dinauer, and N. H. Hunt The Role of Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Derived Reactive Oxygen Species in the Acquisition of Metastatic Ability of Tumor Cells Am. J. Pathol., July 1, 2006; 169(1): 294 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Hsiao, W.-S. Wang, P.-M. Chen, and Y. Su Overexpression of thymosin {beta}-4 renders SW480 colon carcinoma cells more resistant to apoptosis triggered by FasL and two topoisomerase II inhibitors via downregulating Fas and upregulating Survivin expression, respectively Carcinogenesis, May 1, 2006; 27(5): 936 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Nummela, M. Yin, M. Kielosto, V. Leaner, M. J. Birrer, and E. Holtta Thymosin {beta}4 Is a Determinant of the Transformed Phenotype and Invasiveness of S-Adenosylmethionine Decarboxylase-Transfected Fibroblasts Cancer Res., January 15, 2006; 66(2): 701 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Jain, S. M. Moore, K. Yamaguchi, T. E. Eling, and S. J. Baek Selective Nonsteroidal Anti-Inflammatory Drugs Induce Thymosin {beta}-4 and Alter Actin Cytoskeletal Organization in Human Colorectal Cancer Cells J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 885 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. De Corte, K. Van Impe, E. Bruyneel, C. Boucherie, M. Mareel, J. Vandekerckhove, and J. Gettemans Increased importin-{beta}-dependent nuclear import of the actin modulating protein CapG promotes cell invasion J. Cell Sci., October 15, 2004; 117(22): 5283 - 5292. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Huff, O. Rosorius, A. M. Otto, C. S. G. Muller, E. Ballweber, E. Hannappel, and H. G. Mannherz Nuclear localisation of the G-actin sequestering peptide thymosin {beta}4 J. Cell Sci., October 15, 2004; 117(22): 5333 - 5341. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Huber, D. Vlasny, S. Jeckel, F. Stubenrauch, and T. Iftner Gene Profiling of Cottontail Rabbit Papillomavirus-Induced Carcinomas Identifies Upregulated Genes Directly Involved in Stroma Invasion as Shown by Small Interfering RNA-Mediated Gene Silencing J. Virol., July 15, 2004; 78(14): 7478 - 7489. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Goldstein Thymosin {beta}4: A New Molecular Target for Antitumor Strategies J Natl Cancer Inst, November 19, 2003; 95(22): 1646 - 1647. [Full Text] [PDF] |
||||
![]() |
H.-J. Cha, M.-J. Jeong, and H. K. Kleinman Role of Thymosin {beta}4 in Tumor Metastasis and Angiogenesis J Natl Cancer Inst, November 19, 2003; 95(22): 1674 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, S.-T. Pang, L. Sahlin, A. Blanck, G. Norstedt, and A. Flores-Morales Gene Expression Profiling of the Effects of Castration and Estrogen Treatment in the Rat Uterus Biol Reprod, October 1, 2003; 69(4): 1308 - 1317. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |