| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |






From the Department of Infectious Diseases andMicrobiology,*
Graduate School of Public Health, and theDepartments of Pathology
and MolecularGenetics and Microbiology,
University ofPittsburgh School of Medicine, Pittsburgh, Pennsylvania; and theLaboratory of Retroviral Pathogenesis,
AIDSVaccine Program, Science Applications International CorporationFrederick, National Cancer Institute at Frederick, Frederick, Maryland
| Abstract |
|---|
|
|
|---|
Despite the absence of convincing evidence of neuronal infection, neurodegeneration has been reported in both HIV and SIV infection.5,6,9,16,25 Some studies suggest neural damage can occur even in the absence of significant infection within the brain. SIVmac251-infected cynomolgus monkeys exhibit dendritic damage even in the absence of encephalitis or detectable central nervous system (CNS) virus.26 However, the majority of studies link profuse activated and lentiviral-infected brain macrophages to neurodegeneration.5,8,12,15,17,21,24,27-32 It is unclear whether neurodegeneration is caused by direct effects of the virus, indirect effects of infection, or both. Many studies have suggested the secreted products of activated macrophages might directly act on neurons or indirectly act on supporting glial cells initiating synaptic damage and neuronal death.33-44
Both presynaptic and postsynaptic damage have been reported during HIVE.19-24,26,45,46 This suggests that there is disruption in neuronal circuitry that could cause neurological deficits and lead to neuronal loss. Synaptophysin (SYN), a 38-kd calcium-binding protein associated with membranes of neuronal presynaptic vesicles and involved in neurotransmitter release, is widely used to mark presynaptic terminals and to approximate synaptic density.22,47-51 Loss of synaptophysin immunoreactivity has been interpreted as morphological evidence of presynaptic neuronal damage and is closely associated with signs and symptoms observed in several chronic dementias.45,52-58 Similarly, microtubule-associated protein-2 (MAP-2), a high molecular weight protein found in neuronal cell bodies and dendrites, is widely used to mark postsynaptic elements.26,56,57,59,60 MAP proteins are involved in the polymerization of tubulin into microtubules and help provide physical stability to microtubule formations. Loss of MAP-2 immunoreactivity has been interpreted as morphological evidence of dendritic pathology.59,60 The universal response of CNS tissue to any nonspecific damage is gliosis. Gliosis is readily identified by immunohistochemical staining for glial fibrillary acidic protein (GFAP), a 52-kd intermediate filament protein found in astrocytes.
There is substantial controversy regarding the relative role of virus and activated macrophages in mediating lentiviral-associated neurodegeneration. Using the SIV-infected macaque model, we assessed the relationship between virus and macrophages and neurological damage by laser confocal microscopy. We found that some regions of the CNS in infected macaques showed presynaptic damage during systemic infection independent of the presence of encephalitis. However, we observed that lentiviral encephalitis was distinctly associated with severe synaptic damage and tightly linked with the presence of both activated and infected macrophages. The microscopic multifocality of the infectious process was similarly reflected in the focality of the neurological damage.
| Materials and Methods |
|---|
|
|
|---|
Rhesus macaques (Macaca mulatta) were housed and
maintained according to strict American Association of Laboratory
Animal Care standards. Macaque infection parameters are described in
Table 1
. Six rhesus macaques derived from
vaccine trials, challenged with viral swarm SIVdeltaB670 (SIV/dB670),
and sacrificed were used in this study. Two macaques were involved in
vaccine studies. Two macaques were administered PMPA
[9-R-(2-phosphonomethoxypropyl)adenine] 24 hours before
inoculation with SIV. Macaques were infected intravenously with
SIV/deltaB670 (n = 4), via bronchoscope with
bronchial alveolar lavage from an animal infected with SIV/dB670
(n = 1), or rectally with SIV/dB670 and a
subsequent infection via bronchoscope with bronchoalveolar lavage from
an animal infected with SIV/dB670 (n = 1).
Because the focus of this study was on CNS manifestations due to CNS
SIV infection, the divergent routes of infection and clinical history
in this group of animals does not impact directly on the final outcome
of CNS disease. Ages of the macaques used in this study ranged from 33
to 100 months. Length of infection varied from 37 to 379 days. Macaques
were sacrificed when moribund with AIDS (Table 2)
. Only two macaques (macaques 603 and
221) exhibited neurological signs consisting of decreased feeding,
decreased spontaneous movement, neglect of novel environmental stimuli,
lethargic response to physical stimulation, and variable focal
neurological signs. Two noninfected macaques served as controls.
Complete necropsies were performed after humane sacrifice.
|
|
Buffy coats from peripheral blood obtained from SIV-infected macaques immediately before euthanasia were labeled with fluorochrome-conjugated monoclonal antibodies against CD4 (OKT4; Coulter, Hialeah, FL). Two-parameter light-scatter profiles were used to gate the lymphocyte population and to determine the percentage of CD4+ lymphocytes. Absolute CD4+ cell numbers were calculated using percent CD4+ lymphocytes and differential cell counts from the blood as previously described.61
Tissue
Brains were removed immediately after euthanasia and processed for analysis. The left hemisphere was cut into regional blocks and stored at -80°C. The right hemisphere was fixed in 10% buffered formalin (Fisher Scientific, Pittsburgh, PA). Coronal sections were made, and tissue blocks were paraffin-embedded. Six-µm sections were made for pathological analysis.
Quantitation of SIV RNA in Brain Tissue
For real-time polymerase chain reaction (PCR) analysis, total RNA
was isolated from
100 mg of frozen (-80°C) brain tissue from
frontal neocortical gray and white matter, occipital neocortical gray
and white matter, caudate, putamen, globus pallidus, hippocampus, and
cerebellum. RNA isolation was performed using Trizol reagent (Life
Technologies, Inc., Rockville, MD) according to the manufacturers
recommendations. Pelleted total RNA isolated from brain tissue was
dissolved in molecular biology grade water and SIV gag-encoding
sequences quantified by real time PCR in an Applied Biosystems Prism
7700 (Applied Biosystems, Foster City, CA) as previously
described.62
The threshold sensitivity of this method was
10 copy Eq/reaction, typically corresponding to 1 µg of input total
RNA, or the equivalent of
0.9 mg of brain tissue. The RNA assay was
normalized based on input RNA but reported here as copy Eq/mg tissue.
The RNA yield from animal to animal was very consistent at 0.87 µg of
RNA/mg tissue ± 0.15 (mean ± SD). Region to region RNA
yield varied as expected (0.6 to 1.4 µg of RNA/mg tissue) with
cerebellum > neocortical gray matter > caudate =
putamen = globus pallidus = hippocampus > neocortical
white matter.
Quantitation of SIV RNA in Plasma
Quantitation of virion-associated RNA in plasma was performed by real-time PCR in a Prism 7700 (ABI). Virions were pelleted from 1 ml of plasma by centrifugation at 14,000 x g for 1 hour. Total RNA was extracted from the virus pellet using Trizol (Life Technologies, Inc.) and 20 µl of each sample was analyzed in a 96-well plate. Synthesis of cDNA was accomplished in triplicate reactions containing 5.0 nmol/L MgCl2, 1x PCR buffer II, 0.75 mmol/L of each dNTP, RNase inhibitor, 1.2 U MULV reverse transcriptase, 2.5 µmol/L random hexamers, and 10% of total viral RNA. Samples were mixed and incubated at room temperature for 10 minutes followed by 42°C for 12 minutes and the reaction terminated by heating at 99°C for 5 minutes then cooling to 4°C for 5 minutes. The PCR reaction was then initiated by adding 30 µl of a PCR master mix containing 1x PCR buffer A, 5.5 mmol/L MgCl2, 2.5 U of AmpliTaq Gold, 200 mmol/L of each dNTP, 450 nmol/L of each primer, and 200 nmol/L of probe. The primers and probe used were: forward primer U5/LTR, 5'AGGCTGGCAGATTGAGCCCTGGGAGGTTTC3'; reverse primer 5' R region of LTR, 5'CCAGGCGGCGACTAGGAGAGATGGGAACAC3'; andprobe 6FAM, 5'TTCCCTGCTAGACTCTCACCAGCACTTGG-3'TAMRA. The amplification was performed by heating at 95°C for 10 minutes to activate AmpliTaq Gold (Perkin Elmer), followed by 40 cycles of 95°C for 15 seconds, 55°C for 15 seconds, and 72°C for 30 seconds. Serial dilutions of RNA ranging from 108 to 100 copies/reaction obtained by in vitro transcription of a plasmid containing the target LTR region were subjected to RT-PCR reaction in triplicate along with the samples to generate the standard curve with a sensitivity threshold of 100 copies/reaction. RNA copy numbers from the unknown plasma samples were calculated from the standard curve and expressed as RNA copies/ml plasma.
Histology
Paraffin sections of brain tissue containing putamen, caudate, neocortical gray and white matter, and hippocampus were stained with hematoxylin and eosin (H&E) and assessed for the presence of SIVE. SIVE was empirically defined as the presence of microglial nodules and multinucleated giant cells, and profuse perivascular mononuclear infiltrates. To assess the distribution and abundance of macrophages and SIV morphologically, we used a monoclonal antibody against a macrophage/microglia-associated protein CD68 (clone KP1;DAKO, Carpinteria, CA) and a polyclonal antibody against the SIV envelope gp110 (generously provided by Dr. Kelly Stefano Cole and Dr. Ron Montelaro, University of Pittsburgh, Pittsburgh, PA), respectively. Three of the infected macaques showed histological findings of SIVE. The remaining three SIV-infected macaques did not show histopathological features of SIVE, however, neuropathological findings in these three SIV-infected macaques included rare perivascular infiltrates. Each SIV-infected macaque used in this study showed no histopathological abnormalities outside those associated with SIV encephalitis/infection. The noninfected control macaque brains showed no histopathological abnormalities.
Immunofluorescent Histochemistry
Paraffin sections containing putamen, caudate, neocortical gray and white matter, and hippocampus were deparaffinized in Histoclear (3 x 5 minutes) (National Diagnostics, Atlanta, GA). Sections were rehydrated as follows: 100% ethanol (2 x 5 minutes), 95% ethanol (1 x 5 minutes), 70% ethanol (1 x 5 minutes), and H2O (1 x 5 minutes). Rehydrated sections were immersed in 3% H2O2 (Sigma, St. Louis, MO) in 70% methanol (J. T. Baker, Phillipsburg, NJ) (1 x 30 minutes) to block endogenous peroxidase activity. To unmask antigens, sections were incubated in Target Retrieval Solution (DAKO) at 97°C for 1 hour. Sections were cooled (1 x 30 minutes, room temperature) and blocked with 10% normal goat serum (DAKO). Sections were incubated with mouse-monoclonal antibody against a macrophage lysosomal-associated protein CD68 and rabbit polyclonal antibody to the SIV envelope protein SIV-gp110 (1:50,000 and 5 µg/ml dilutions, respectively, at 4°C overnight). The mouse monoclonal antibody CD68 could not be detected by Cy3-conjugated goat anti-mouse IgG at the concentration used in this staining protocol, so the CD68 signal was amplified using the commercially available Tyramide Signal Amplification kit (NEN Life Science Products, Boston, MA).63 Sections were incubated with biotinylated goat anti-mouse IgG serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) (1:200, room temperature, 1 hour). After being washed with 0.5% Tween-20 buffer, sections were incubated with blocking buffer (room temperature, 30 minutes) followed by horseradish peroxidase-conjugated streptavidin (1:500 in blocking buffer, room temperature, 30 minutes). Sections were washed with 0.5% Tween-20 buffer and incubated with fluorescein-conjugated tyramide (1:100 in 1x Amplification Diluent, room temperature, 10 minutes). After washing with 0.5% Tween-20 buffer, sections were incubated with one of the following mouse monoclonal antibodies: MAP-2 (1:1500, SMI 52; Sternberger Monoclonals Inc., Lutherville, MD), synaptophysin (1:100, SY 38; DAKO), or GFAP (1:500, 6F2; DAKO). Sections were incubated with Cy5-conjugated goat anti-mouse IgG and Cy3-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.) (1:200, room temperature, 1 hour).
The fluorogen tags used to detect synaptic proteins are noted in the figure legends. Slides were mounted in gelvatol64 and fluorescence quantified as described below in the laser confocal microscopy quantification section.
Peroxidase Immunohistochemical Staining
Paraffin-embedded tissue sections were deparaffinized by incubation at 60°C for 15 minutes, immersion in xylenes twice for 8 minutes each, and dehydration in graded ethanols. Tissues were pretreated by microwaving at 2-minute intervals for a total of 10 minutes at settings between 60 to 20% maximal power in 0.01 mol/L of citrate buffer (pH 6.0). The buffer was replenished as needed to ensure that the tissue sections did not dry out. Slides were then blocked in 5% nonfat dry milk in 1x phosphate-buffered saline (PBS) for 1 hour. Tissue sections were then incubated with a CD68-specific monoclonal antibody at a 1:50 dilution for 45 minutes and washed with 1x PBS three times, 5 minutes each. The bound monoclonal antibody was then detected using the avidin-biotin complex approach with the Vectastain Elite System (Vector Laboratories, Burlingame, CA). Sections were incubated with biotinylated goat anti-mouse secondary antibody for 30 minutes and washed as before. They were then incubated with an avidin/horseradish peroxidase conjugate for 30 minutes and again washed as before. All incubations were performed at room temperature. Immunohistochemical signal (brown staining) was provided by the action of horseradish peroxidase on the substrate 3,3'-diaminobenzidine. Slides were counterstained with propidium iodide to stain the nuclei by incubating in 1x PBS containing 10 mg/ml of propidium iodide for 30 minutes at room temperature in the dark. Slides were then washed by rinsing in 1x PBS and double-distilled water, dehydrated in graded ethanols, cleared in xylenes, and mounted with Permount (Fisher).
Laser Confocal Microscopy Quantification
Consecutive sections were stained with H&E or immunohistochemically stained as described above. A dissecting microscope was used to identify anatomical regions on the H&E-stained section. Five regions of the SIV-infected macaque brains containing putamen, caudate, neocortical frontal gray and white matter, and hippocampus were identified on the immunofluorescent stained slides. The marked H&E tissue section was matched with the consecutive, immunostained tissue section, and the marked regions were traced on the immunofluorescent section. Immunohistochemically stained sections containing regions of interest were analyzed by laser confocal microscopy (Molecular Dynamics, Sunnyvale, CA). The illumination was provided by an argon/krypton laser with 488-, 568-, and 647-nm primary emission lines. Each image was scanned along the z-axis and the middle sectional plane was found (262,144 pixels per plane; 1 pixel, 0.25 µm2). Images were collected on a Silicon Graphics Inc. computer (Operating System Release 5.3, Farmington, MI) and analyzed using the Image Space software (Version 3.2, Molecular Dynamics). All multiple-label immunofluorescent images are 10-section projections.
Each brain region from every macaque was randomly scanned in 10 microscopic areas (40x). The specimen was first scanned for fluorescein isothiocyanate (FITC) and Cy3 signals. Subsequently, the specimen was rescanned for Cy5 signal in the same sectional plane. All specimens were scanned at the same laser power aperture, gain, and photomultiplier tube settings for each wavelength. The number of pixels emitted by each signal was counted using the same collection parameters. Each area scanned encompasses an area of 67,600 µm2.
For quantification of SIV-gp110 or CD68 pixels, pixel counts were obtained from 10 microscopic areas within five brain regions. To compare the pixel counts collected in each brain region, the average pixel count was determined for each brain region within the three SIV-infected macaques without encephalitis. Then for every macaque, each pixel value in a brain region was divided by the average pixel count in the analogous brain region of the SIV-infected macaques. The means of the normalized values were then calculated for each brain region in the SIV-infected macaques with and without encephalitis and control macaques and reported as fold difference in pixel counts. The fold difference in pixel counts for SIV-infected macaques with and without encephalitis each represent three macaques in which 10 areas in each brain region/macaque were scanned, giving a fold pixel count from 30 total areas. Fold difference in pixel counts for control macaques represent two macaques in which 10 areas in each brain region/macaque were scanned, giving a fold pixel count from 20 total areas.
For quantification of MAP-2, synaptophysin, or GFAP pixels, pixel counts were obtained from 10 microscopic areas within five brain regions. To compare the pixel counts collected in each brain region, the average pixel count was determined for each brain region within the three SIV-infected macaques without encephalitis. Then for every macaque, each pixel value in a brain region was divided by the average pixel count in the analogous brain region of the normal, control macaques. The medians of the normalized values were then determined for each brain region in the SIV-infected macaques with and without encephalitis and control macaques, averaged, and reported as fold difference in pixel counts. The fold difference in pixel counts for SIV-infected macaques with and without encephalitis each represent three macaques in which 10 areas in each brain region/macaque were scanned, giving a fold pixel count from 30 total areas. Fold difference in pixel counts for control macaques represent two macaques in which 10 areas in each brain region/macaque were scanned, giving a fold pixel count from 20 total areas.
Image Capture and Peroxidase Immunohistochemistry Quantitation
Quantitation of the CD68-specific immunoreactivity of stained tissue sections was performed by capturing bright-field microscopic images in five random fields for each microanatomic location. Images were captured with a Spot RT Camera mounted on a Nikon E600 fluorescence microscope using a 60x Plan Apochromat objective. Image capture and analysis was performed using the Metaview software package (Universal Imaging Corporation). Each image was subjected to red, green, and blue color separation and the green signal was converted to monochrome. The image was then thresholded to highlight immunoreactive areas of the field and the percentage of surface area that was CD68-immunoreactive was measured. For each image the corresponding propidium iodide-stained image was captured using a FITC filter cube and the number of nuclei in each field was counted manually.
Statistical Analysis
Comparisons of pixel count, SIV RNA, and clinical parameter variances among groups were analyzed by two-way, unpaired Students t-test. A P value of <0.05 was considered significant. Correlation coefficients and t-tests were determined using Microsoft Excel:Mac 2001.
| Results |
|---|
|
|
|---|
Tables 1 and 2
summarize clinical data from the six SIV-infected
and two noninfected rhesus macaques evaluated in this study. Macaques
that developed neurological signs had to be euthanized because of
declining health after shorter periods of infection
(P = 0.004) (Table 1)
. The two macaques
(macaques 603 and 221) with neurological signs had SIVE, however, we
had no direct means of determining how long they had encephalitis. The
plasma viral loads at time of sacrifice for each macaque in the severe
SIVE group were 2 to 5 orders of magnitude higher than those measured
in SIV-infected macaques without encephalitis (P
= 0.2) (Table 2
, Figure 1B
). Absolute CD4
counts between SIV-infected macaques with and without encephalitis were
similar (Table 2)
. However, because of the heterogeneity of the
peripheral infection in these macaques (eg, length of infection) these
observations have no direct reflection on the CNS infection in these
macaques.
|
Most brain regions analyzed in macaques with SIVE
contained 106
to 107
copies
of SIV RNA/mg brain tissue (Figure 1A)
. Nonencephalitic SIV-infected
macaques with mild perivascular chronic inflammation contained <4
x 102
SIV RNA copies/mg brain tissue (Figure 1A)
. Most brain regions from these macaques had significantly less SIV
RNA concentrations (101
to
102
SIV RNA copies/mg brain tissue)
(P < 0.03) (Figure 1A)
than macaques with SIVE.
High Concentrations of SIV RNA in Brains of Macaques with SIVE Correlated with Profuse Microglial Nodules and Multinucleated Giant Cells
H&E staining and immunohistochemical staining for SIV envelope
protein gp110 (SIVgp110) and macrophage/microglia-related molecule CD68
were performed on paraffin sections to determine the histological
presence of encephalitis. Noninfected macaques showed no
histopathological changes or cells stained positively for SIV proteins.
Macaques with high CNS tissue concentrations of SIV RNA had profuse
microglial nodules, severe perivascular chronic inflammation, and
multiple multinucleated giant cells (Figure 2
; A, B, and C). SIV-infected macrophages
were observed in both parenchymal and perivascular locations.
|
CD68 Staining Was Most Abundant in the Putamen, Caudate, Hippocampus, and Frontal Cortex of Macaques with SIVE
All brain regions of macaques with SIVE showed increased CD68
staining. Quantitation of pixels corresponding to CD68 immunostaining
showed the greatest fold increase in the caudate and midfrontal
neocortical gray matter (16- and 25-fold increase, respectively)
(Figure 3C)
. SIV-infected macaques
without encephalitis showed more pixels corresponding to CD68 than the
noninfected control macaques, but this increase was not statistically
significant (Figure 3C)
. Using an enzymatic colorimetric method to
quantitate CD68 staining in the same brain regions of the same
macaques, we observed that
1% of the surface area in each brain
region was stained for CD68 in macaques with SIVE. The putamen showed
the largest percentage of surface area stained for CD68 (1.4%). In
SIV-infected macaques without encephalitis, <0.4% of surface area was
stained for CD68 in all brain regions (Figure 3A)
. Compared to
SIV-infected macaques without SIVE, all brain regions analyzed in
macaques with SIVE showed a 3- to 11-fold increase in the percentage of
surface area stained for CD68 (Figure 3, A and B)
.
|
Figure 2
shows representative fields used
to quantify CD68 and SIVgp110 in five brain regions of SIV-infected
macaques with and without encephalitis. Quantitation of pixels
corresponding to SIVgp110 staining was 2- to 13-fold higher in the
caudate, hippocampus, and white matter of macaques with SIVE compared
to nonencephalitic macaques (P < 0.005) (Figure 3D)
. The midfrontal neocortical gray matter exhibited a 25-fold
increase in SIVgp110 staining in macaques with SIVE, however, because
of large variations in SIVgp110 staining the difference in this region
was not statistically significant (P < 0.05).
SIVE Is a Multifocal Disease with Tight Correlation between the Presence of Macrophages and SIV Antigen
Wide variation within all brain regions analyzed demonstrated the
multifocal nature of SIVE. As an example, the mean ± SD of the
fold increase in SIVgp110 and CD68 staining within the midfrontal
neocortical gray matter was 25 ± 86 and 25 ± 60,
respectively. In macaques with SIVE, the majority of cells that were
immunostained for CD68 also stained for SIVgp110 (Figure 2C)
. Pixel
quantification of CD68 and SIVgp110 staining showed a correlation
coefficient of 0.91 in the putamen, 0.99 in the midfrontal neocortical
gray matter, and 0.97 in the hippocampus.
Macaques with SIVE Showed Less Abundant Postsynaptic Protein MAP-2 Staining in the Caudate, Hippocampus, and Frontal Cortical Gray Matter than Macaques without Encephalitis
To determine the relationship between postsynaptic damage and
SIVE, quantification of postsynaptic protein MAP-2 staining was
performed in gray matter regions from all macaque groups. A
representative histological section from the caudate of a macaque with
SIVE showed decreased MAP-2 staining (Figure 4A)
compared to equivalent sections from
SIV-infected macaques without encephalitis (Figure 4E)
. MAP-2 staining
in the caudate, hippocampus, and midfrontal neocortical gray matter was
66 to 70% lower in macaques with SIVE than in both SIV-infected and
noninfected macaques without encephalitis (Figure 5A)
. MAP-2 staining was also 37% lower
in the putamen of macaques with SIVE, but this decrease did not achieve
statistical significance. SIV-infected macaques without encephalitis
exhibited significantly lower staining for MAP-2 in the midfrontal
cortical gray matter than noninfected macaques (50% lower), however,
the decrease was not as great as that observed in macaques with SIVE
(Figure 5A)
.
|
|
To determine the relationship between presynaptic damage and SIVE,
quantification of presynaptic protein synaptophysin staining was
performed in gray matter regions from all macaque groups. A
representative histological section from the hippocampus of a macaque
with SIVE showed decreased synaptophysin staining (Figure 4I)
compared
to a noninfected macaque without encephalitis (Figure 4M)
. In contrast
to MAP-2 staining, the number of pixels corresponding to synaptophysin
was decreased in both SIV-infected macaques with and without
encephalitis compared to noninfected macaques (Figure 5B)
. The putamen
and hippocampus of SIV-infected macaques with and without encephalitis
showed 60 to 80% lower synaptophysin staining than noninfected
macaques without encephalitis (Figure 5B)
. Macaques with SIVE exhibited
similar fold staining for synaptophysin in the caudate and frontal
neocortical gray matter as noninfected controls, whereas SIV-infected
macaques without encephalitis showed a significant decrease in
synaptophysin staining in the frontal neocortical gray matter compared
to noninfected controls (Figure 5B)
.
Quantitative Immunostaining for GFAP Showed Prominent Gliosis in the Putamen, Caudate, and Frontal Cortex of Macaques with SIVE
To determine the relationship between nonspecific CNS damage and
SIVE, quantification of GFAP staining was performed in gray and white
matter regions from all macaque groups. SIV-infected and noninfected
macaques without encephalitis showed 2- to 100-fold lower GFAP staining
than macaques with SIVE (Figure 5C)
. The greatest fold increase in GFAP
staining in macaques with SIVE compared to SIV-infected macaques
without encephalitis was present in caudate and white matter (100-fold
and 8-fold, respectively) (Figure 5C)
. Surprisingly, the hippocampus
showed similar GFAP staining in all macaques. SIV-infected macaques
without encephalitis showed up to fivefold higher GFAP staining in
putamen, caudate, and white matter than noninfected macaques.
| Discussion |
|---|
|
|
|---|
We have confirmed that the histological presence of encephalitis is associated with high concentrations of SIV RNA in most brain regions. Brains of SIV-infected macaques with histological findings of SIVE contained 5 orders of magnitude greater concentrations of SIV RNA than SIV-infected macaques without encephalitis. Because the macaque brains used in this study were not perfused with buffer after sacrifice, brain tissue extracts were necessarily contaminated with blood. Whether blood contamination contributed to the amount of SIV RNA quantified in brain tissue extracts depends on two factors: the level of virus in blood and the amount of blood in the tissue. Blood-borne SIV could be cell-associated or within the plasma. Because CD4 counts in these SIV-infected macaques were low, the amount of viral RNA derived from infected CD4+ T cells would not be expected to significantly contribute to the levels of SIV RNA measured in the brain. The SIV RNA load in plasma of macaques with SIVE was 5.3 x 108 SIV RNA copies/ml plasma or less. If we assume the blood contaminating brain tissue extracts contained an upper limit of 1 x 106 SIV RNA copies/ml plasma, we would estimate that blood contamination of brain extracts would account for less than 1 x 104 copies/mg. Thus, the high RNA concentrations observed in most brain regions must be attributed to virus in brain tissue rather than blood contamination. Lastly, we are assured blood contamination was not a factor in quantification of viral RNA in brain tissue extracts because the SIV-infected macaques without encephalitis had greater than 105 SIV RNA copies/ml plasma but less than 102 SIV RNA copies/mg brain tissue.
It is interesting that regions such as the cerebellum that traditionally have been reported to lack overt histopathology have similar concentrations of SIV RNA as regions with more abundant pathology. It has been reported that cerebellar cortex is not as affected histopathologically as the basal ganglia structures during lentiviral encephalitis.62 We have observed such a pattern in patients with HIV encephalitis.32 It has been reported that the deep cerebellar gray nuclei have abundant macrophages that stained for HIVgp41 (transmembrane protein), whereas infected cells are rare in the cerebellar cortex.71 In the animals used in this study, cerebellar white matter was also heavily infiltrated with SIV-infected macrophages (data not shown). Seemingly conflicting observations in cerebellar viral RNA concentrations might result from sampling different portions of the cerebellum.
Vast differences in viral RNA concentrations between SIV-infected
macaques with and without encephalitis makes the readily quantifiable
RNA assay an unbiased tool for diagnosing lentiviral encephalitis.
However, this approach quantifies the average amount of RNA within 100
mg of brain tissue that contains
500 million cells with abundant
microenvironments potentially disparate in lentiviral presence.
Defining proximal relationships between macrophage and viral factors
requires more selective analysis than averages derived from
measurements of 500 million cells. Using confocal microscopy, we
quantified markers of virus and macrophages within discrete
microenvironments and assessed the relationship of these markers to
neuronal damage.
There are three potential drawbacks to microscopy-based quantification of viral and host cell markers: necessity of using fixed tissue, observer bias in selecting regions for quantitation, and variability within individual microscopic fields. All of the macaque CNS tissues were fixed by immersion in 10% formalin. To control for any potential differences in antigen preservation during immersion fixation, we compared MAP-2 fluorescent staining in cerebellar cortical gray matter (data not shown). No significant interspecimen variation was observed for this control antigen. To prevent observer bias, brain regions were defined by gross inspection of the slide and then circled. Random selection of microscopic regions within the encircled areas was performed by an observer blinded to animal disease status. Finally, to accommodate variability encountered within individual microenvironments (eg, presence of vessels of various calibers, presence of white matter tracts within basal ganglia structures, intranuclear histological variability), we acquired optical images within 10 fields for each brain region. Individual microenvironments showed the expected variability, however, comparison of the fluorescent-labeling averages between macaques with and without encephalitis showed significant differences.
We compared our technique of quantifying fluorescent markers in microscopic fields to an enzymatic colorimetric quantification method. Using the colorimetric method, white matter of macaques with SIVE had the greatest fold increase in surface area stained for CD68, whereas with the confocal method frontal neocortical gray matter showed the greatest fold increase in fluorescent pixels stained for CD68. However, overall the two methods showed parallel trends in quantifying macrophages.
Both CD68 and SIVgp110 staining were elevated in all brain regions of macaques with SIVE compared to SIV-infected macaques without SIVE. The greatest increases were seen in the midfrontal cortical gray matter and caudate suggesting that neurons in these regions are at greater risk of damage from soluble products secreted by activated and infected macrophages. Regions receiving projections from the caudate and midfrontal cortical gray matter would be at risk of secondary damage because of downstream events initiated at the soma of these neurons.
The majority of activated macrophages in the brains of macaques with
SIVE were infected with SIV. Examining individual microscopic fields,
we estimated
70 to 80% of macrophages stain for SIVgp110. This
observation is different from some previous reports. For instance, it
has been reported that 16 to 25% of brain macrophages stained for HIV
antigen.72
However, this study analyzed a wide variety of
neuropathological conditions (eg, opportunistic cytomegalovirus,
Toxoplasma, cryptococcus) and was not restricted to assessment of
lentiviral encephalitis. Other studies have also suggested that the
majority of CD68-positive macrophages did not stain for SIV
gp41.62
Some of the discrepancy between previous studies
and ours might be attributed to differing sensitivities of antibodies
for transmembrane (gp41) and surface unit glycoprotein (gp110).
Additionally, in our studies raw pixel counts indicate that CD68
staining corresponded to more pixels than SIV staining in most
microscopic foci. Because CD68 is a marker of lysosomes and the
antibody we used to stain SIV-infected cells is specific for viral
envelope protein, it may not be appropriate to directly compare
absolute CD68 and SIVgp110 pixel counts. Perhaps more meaningful is to
compare fold changes in CD68 and SIV immunostaining between
encephalitic and nonencephalitic brains.
Lentiviral encephalitis is a multifocal process with significant variation between microscopic regions. This is best shown by the large standard deviations in CD68 and SIVgp110 quantification seen within all brain regions. To assess an individual brain nucleus, an average of numerous fields is required to compensate for microscopic variation. Microscopic foci within brain regions of macaques with abundant macrophage infiltration and viral infection show loss of synaptic proteins. Compared to macaques without encephalitis, macaques with SIVE had significant decreases in MAP-2 staining in the caudate, midfrontal cortical gray matter, and hippocampus suggesting primary postsynaptic damage. Others have also reported decreases in dendritic proteins in SIV-infected cynomologus macaques soon after infection, but these decreases were independent of concentrations of SIV DNA in the brain.26 It is surprising that staining for MAP-2 was increased in the putamen of SIV-infected macaques without encephalitis compared to both encephalitic and noninfected controls. It is possible to hypothesize that neurons that have postsynaptic processes in the putamen generate a temporary response to acute damage by dilating postsynaptic processes, but ultimately undergo atrophy because of the chronic insult of encephalitis.
Staining for the presynaptic protein, synaptophysin, was also decreased in the putamen and hippocampus of macaques with SIVE and the putamen, caudate, midfrontal cortical gray matter, and hippocampus of SIV-infected macaques without encephalitis. This finding is consistent with a recent report showing decreased synaptophysin immunoreactivity in macaque brains soon after infection with SIV.45 However, it is puzzling that greater decreases in synaptophysin staining were not observed in the encephalitic macaques in this study. The vast interconnectivity of the brain complicates this analysis by requiring some means of dissecting out synaptic damage distal to affected neuronal soma. In support of indirect mechanisms leading to decreases in synaptic proteins, we have shown that GFAP staining is increased in most brain regions in macaques with SIVE. As we and others have observed, SIV-infected macaques without encephalitis also showed increases in GFAP staining compared to noninfected controls although far less than that observed with encephalitis.45 As the hippocampus is particularly sensitive to hypoxia/ischemia, the absence of increased gliosis in the region suggests that the neuropathological damage observed in SIVE is not related to diffuse ischemic injury, but more specifically related to the encephalitis itself.
Finding presynaptic damage in SIV-infected macaques independent of encephalitis and postsynaptic damage dependent on local presence of encephalitis suggests the following hypothesis: presynaptic components are susceptible to systemic toxins generated as a result of lentiviral infection, whereas postsynaptic elements are susceptible to degradation by products of locally activated and infected macrophages within the CNS. In support of this hypothesis, we observed less synaptophysin staining in neocortical gray matter, caudate, and putamen of SIV-infected macaques without encephalitis than in SIV-infected macaques with encephalitis. The SIV-infected macaques had longer periods of infection, raising the possibility that presynaptic damage is a consequence of longer peripheral infection. Because synaptophysin is a functional protein and MAP-2 is a structural protein, this hypothesis may extend to functional proteins being susceptible to systemic toxins produced during lentiviral infection, whereas structural proteins are damaged by CNS lentiviral infection. Presynaptic and postsynaptic damage may progress to neuronal loss in the brains of lentiviral encephalitic macaques. MAP-2 functions are modulated by phosphorylation through NMDA receptor-associated signal transduction pathways and subsequent activation of nitric oxide synthase and MAP kinase.73 Secretion of NMDA receptor agonists such as quinolinic acid by activated macrophages might result in hyperphosphorylation of MAP-2 and subsequent destabilization of microtubules leading to neuronal degeneration.74
In the current study we have attempted to examine the hypothesis that loss of synaptic proteins may spatially correlate with the presence of pathology in macaques with SIVE. We quantified increases in CD68, SIV envelope protein gp110, and GFAP in encephalitic macaques. Presynaptic proteins were decreased in SIV-infected macaques independent of encephalitis, whereas loss of postsynaptic proteins was linked to encephalitis. Quantitation of synaptic proteins in brain regions with abundant SIV-infected and -activated macrophages points to indirect mechanisms of neuronal damage. Future studies to elucidate mechanisms of neural damage will require compensating for the high degree of microregional variability in neuropathology of lentiviral encephalitis.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by the National Cancer Institute (contract no. NO1-CO-56000) and by the National Institutes of Health (grants MH61205, NS35731, MH46790, and MH01717).
Accepted for publication November 29, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Bonneh-Barkay, S. J. Bissel, G. Wang, K. N. Fish, G. C.B. Nicholl, S. W. Darko, R. Medina-Flores, M. Murphey-Corb, P. A. Rajakumar, J. Nyaundi, et al. YKL-40, a Marker of Simian Immunodeficiency Virus Encephalitis, Modulates the Biological Activity of Basic Fibroblast Growth Factor Am. J. Pathol., July 1, 2008; 173(1): 130 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Venneti, D. Bonneh-Barkay, B. J. Lopresti, S. J. Bissel, G. Wang, C. A. Mathis, M. Piatak Jr., J. D. Lifson, J. O. Nyaundi, M. Murphey-Corb, et al. Longitudinal in Vivo Positron Emission Tomography Imaging of Infected and Activated Brain Macrophages in a Macaque Model of Human Immunodeficiency Virus Encephalitis Correlates with Central and Peripheral Markers of Encephalitis and Areas of Synaptic Degeneration Am. J. Pathol., June 1, 2008; 172(6): 1603 - 1616. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Bissel, G. Wang, D. Bonneh-Barkay, A. Starkey, A. M. Trichel, M. Murphey-Corb, and C. A. Wiley Systemic and Brain Macrophage Infections in Relation to the Development of Simian Immunodeficiency Virus Encephalitis J. Virol., May 15, 2008; 82(10): 5031 - 5042. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Bissel, G. Wang, A. M. Trichel, M. Murphey-Corb, and C. A. Wiley Longitudinal Analysis of Monocyte/Macrophage Infection in Simian Immunodeficiency Virus-Infected, CD8+ T-Cell-Depleted Macaques that Develop Lentiviral Encephalitis Am. J. Pathol., May 1, 2006; 168(5): 1553 - 1569. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. O'Neil, C. Suwyn, D. C. Anderson, G. Niedziela, J. Bradley, F. J. Novembre, J. G. Herndon, and H. M. McClure Correlation of Acute Humoral Response with Brain Virus Burden and Survival Time in Pig-Tailed Macaques Infected with the Neurovirulent Simian Immunodeficiency Virus SIVsmmFGb Am. J. Pathol., April 1, 2004; 164(4): 1157 - 1172. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |