| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology,* Weill Medical Collegeof Cornell University, New York; the Departments of MolecularGenetics and CellBiology, Albert Einstein College of Medicine,Bronx; and the Institute of Cancer Genetics,College of Physicians and Surgeons, Columbia University, New York,New York
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
20 to 25% of mice at 40 weeks. In an
attempt to expand this mouse model of endometrial tumorigenesis and to
further our understanding of the association betweenPten mutations and DNA mismatch repair
deficiency, we generated Ptenheterozygous, Mlh1-null (mismatch repair
deficient) mice. Significantly, the majority ofPten+/-/Mlh1-/-mice developed polypoid lesions in the endometrium at 6 to 9 weeks of
age. By 14 to 18 weeks, all of the double-mutant mice had
lesions histologically similar to those seen inPten+/- mice, and two of them
exhibited invasive disease. Moreover, the frequency of loss of
the wild-type Pten allele in the double-mutant mice at
14 to 18 weeks was similar to that seen in lesions from
40-week-old Pten+/- mice. Taken
together, our results indicate that DNA mismatch repair
deficiency can accelerate endometrial tumorigenesis inPten heterozygous mice and suggests that loss of the
wild-type Pten allele is involved in the
development/progression of tumors in this setting.
In this and previous studies it has been shown that 100% of
32-week-old female mice lacking one wild-type copy of Pten
spontaneously develop lesions that closely resemble CAH in humans. Of
note, 20 to 25% of mice at 40 weeks of age develop invasive
carcinoma with morphological similarities to UEC.12,13
To
exploit this mouse model of endometrial tumorigenesis and to further
our understanding of the association between Pten mutations
and DNA MMR deficiency, we developed
Pten+/-/Mlh1-/-
double-mutant mice. Here we present data showing that DNA mismatch
repair deficiency can accelerate endometrial tumorigenesis in
Pten heterozygous mice and that it is associated with loss
of the wild-type Pten allele.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Male Pten heterozygous C57BL6/129SvJ mice were obtained from R. Parsons (Institute of Cancer Genetics, College of Physicians and Surgeons, Columbia University, New York, NY)12 and bred to C57BL6 wild-type female mice (The Jackson Laboratory, Bar Harbor, ME). Mlh1 heterozygous C57BL6 mice were provided by R. Kucherlapati (Department of Molecular Genetics, Albert Einstein College of Medicine, Bronx, NY)14 and interbred to increase the colony size. Mlh1+/- and Pten+/- mice were bred to generate double heterozygotes that were then interbred to produce Pten+/-/Mlh1-/- mice and appropriate littermate controls.
Genotyping
Animals were genotyped using multiplex polymerase chain reaction (PCR) on genomic DNA prepared from tail samples. Mlh1 genotyping was performed as described previously.14 For Pten genotyping the following primers were used: mPTEN EX/I, GGGATTATCTTTTTGCAACAGT; mPTEN R, GGGCCTCTTGTGCCTTTA; and PGK6: AGAAAGCGAAGGAGCAAAG. The reaction conditions were: 5 minutes at 95°C, 1 minute at 95°C, 1 minute at 60°C, and 1 minute at 72°C for 40 cycles followed by 5 minutes at 72°C. The amplified product from the wild-type allele is 222 bp (mPTEN Ex/I and mPTEN R) and the product from mutant allele is 467 bp (mPTEN Ex/I and PGK6).
Analysis of Tumors
Animals were sacrificed according to guidelines and the vagina was flushed with saline, sampled with a cotton swab and the exfoliated cells were spread on glass slides, stained, and examined by light microscopy to determine the phase of the estrus cycle. The entire female genital tract was removed, representative sections of each horn were fixed in 10% buffered formalin and paraffin embedded. Routine hematoxylin and eosin (H&E)-stained sections were reviewed by the same gynecological pathologist (LHE). The remaining representative sections of uteri were frozen in liquid nitrogen and stored at -80°C.
Microdissection and DNA Extraction
Tissue sections were deparaffinized and lightly stained with hematoxylin. Distinct areas of CAH and endometrial carcinoma were microdissected using a 26-gauge needle under light microscopic guidance to at least 90% purity. Normal tissue was microdissected for each mouse in a similar manner for isolation of control DNA for both loss of heterozygosity (LOH) and MI analysis. DNA extraction was performed as previously described.1
LOH Analysis
PCR-based LOH analysis of Pten was performed using a common 5' primer within the intron of exon 5 and two 3' primers. Wild-type primers: GGGATTATCTTTTTGCAACAGT and GGGCCTCTTGTGCCTTTA; mutant primers: GGGATTATCTTTTTGCAACAGT and TTCCTGACTAGGGGAGGAGT. DNA was prepared from either microdissected normal or lesional tissue or from tails of Pten+/- and wild-type mice. PCR was performed in 50-µl reactions containing 10 mmol/L Tris-HCl (pH 9.2), 1.5 mmol/L MgCl2, 75 mmol/L KCl, 0.4 µmol/L of each 3' primer, 0.8 µmol/L 5' primer, 160 µmol/L each dNTP, and 2.5 U of Taq polymerase (Life Technologies, Inc., Gaithersburg, MD). Forty cycles of PCR were performed, each cycle consisted of 1 minute at 95°C, 1 minute at 57°C, and 1 minute at 72°C, followed by a single 5-minute extension at 72°C. The products were separated on 2% agarose gel, stained with ethidium bromide, and the relative intensities of the bands were visually scored. A mutant to wild-type ratio greater than 2:1 was scored as a LOH of the wild-type Pten allele. Each sample was repeated and scored separately in a blinded manner by two individuals.
MI Analysis
Six microsatellite loci were amplified with incorporation of
[
-32P]dCTP (10 mCi/ml; Amersham Pharmacia
Biotech Inc., Piscataway, NJ) as described previously15
using dinucleotide repeats (Research Genetics, Huntsville, AL) D1Mit36,
D7Mit91, and D10Mit2; and mononucleotide repeats U12235, MBAT25, and
MBAT37.16,17
Amplified PCR products were separated on
denaturing polyacrylamide gels and visualized by autoradiography.
Immunohistochemistry
Five-µm sections on glass slides were prepared from formalin-fixed, paraffin-embedded tissue. The slides were baked at 60°C for 1 hour, and the tissue was rehydrated. Antigen retrieval was performed in 1 mmol/L of ethylenediaminetetraacetic acid (pH 7.5) solution and heated in a microwave oven for 10 minutes. Tissue was incubated in 10% normal goat serum at room temperature, followed by incubation in a 1:200 dilution of Pten Ab-2 (Lab Vision Corporation, Fremont, CA) in Tris-buffered saline (TBS) for 1 hour at room temperature, or phospho-Akt (Ser473) (Cell Signaling Technology, Beverly, MA) at a 1:50 dilution overnight at room temperature. The sections were washed in TBS-T (0.01% Tween 20 in TBS) and then incubated with biotinylated goat anti-rabbit IgG (Vector Laboratories, Burlingame, CA). Endogenous peroxidase was blocked by incubation in 0.3% hydrogen peroxide for 12 minutes. Immunoenzymatic reaction for Pten staining was developed using avidin-biotinylated horseradish-peroxidase complex and 3,3'-diaminobenzidine as substrate (Vector Laboratories). The reactions for phospho-Akt staining were performed using avidin peroxidase and 3-amino-9-ethyl-carbazole (Sigma Chemical Co., St. Louis, MO). The slides were counterstained with Methyl Green or hematoxylin, respectively. Negative controls lacking primary antibody were performed on each section. Staining for Pten was scored as following: 0 for negative staining, 1+ for weak staining, 3+ for strong staining, and 2+ for those staining with an intensity between 1+ and 3+. Only membrane staining for phosphorylated Akt was scored as positive.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
We first analyzed the uteri in a series of female
Pten+/- mice at 16, 24, 32, and 40 weeks.
Light microscopic evaluation of H&E-stained sections revealed
endometrial lesions characterized by increased architectural complexity
and cytological atypia of endometrial glands and surface luminal
epithelium. The lesions were multifocal and closely resembled CAH in
humans (Figure 1b)
. The number and size
of individual lesions were determined in each mouse. The incidence,
number, and size of endometrial lesions increased with age in
Pten+/- mice (Table 1)
. All of the
Pten+/- female mice that were 32 weeks of age
had extensive CAH. Two of eight (25%) mice at 40 weeks of age had
endometrial carcinoma with stromal invasion.
These lesions, similar to
well-differentiated UEC in humans, consisted of cribriform, confluent
glands without intervening stroma (Figure 1c)
. Notably, age-matched
wild-type mice did not develop lesions in any of the age groups (Figure 1a)
.
|
|
To assess the role of DNA mismatch repair in endometrial
tumorigenesis in the setting of Pten mutations, we developed
Pten+/-/Mlh1-/-
double-mutant mice. MLH1 encodes a protein involved in DNA
mismatch repair and the absence of its expression is associated with MI
in the vast majority of MI-positive sporadic human UECs.18
Pten+/-/Mlh1-/-
mice were sacrificed at two time points, 6 to 9 weeks and 14 to 18
weeks. In the 6- to 9-week-old age group, six of seven (85.7%) mice
developed polypoid lesions that protruded into the endometrial cavity
and appeared to arise from the luminal surface epithelium (Table 1)
.
Although the lesions were architecturally distinct from the
hyperplastic lesions, the cells showed an increase in size and nuclear
atypia, similar to those of CAH (Figure 1d)
. None of the
Pten+/- or
Mlh1-/- littermates developed any
lesions at this early age. By 14 to 18 weeks all of the double-mutant
mice had lesions histologically similar to the CAH seen in
Pten+/- mice (Figure 1e)
, and two of them
exhibited invasive disease (Table 1)
. One of the invasive tumors
maintained its glandular differentiation, mimicking infiltrating
well-differentiated carcinomas in humans, and extensively invaded the
myometrium with extension onto the serosal surface of the uterus
(Figure 1f)
. The other carcinoma exhibited only stromal invasion, as
seen in the Pten+/- mice at 40 weeks old.
Compared to the Pten+/- mice of the same
age, the number and the size of lesions in
Pten+/-/Mlh1-/-
mice were increased 10-fold. None of the age-matched
Mlh1-/- littermates developed any
endometrial lesions (Table 1)
. Thus,
Pten+/-/Mlh1-/-
mice showed a decrease in the age of onset of disease and an increase
in the severity of the disease.
The MI phenotype of the
Pten+/-/Mlh1-/-
mice was confirmed in both tail DNA (diluted to 1 to 3 genomes) and DNA
prepared from microdissected endometrial lesions (invasive and
noninvasive) (Figure 2, a and b)
. MI was
detected in 4 of 10 (40%) microdissected lesions from
Pten+/-/Mlh1-/-
mice, whereas it was detected in 1 of 7 (14.3%) lesions in
Pten+/- mice. In
Pten+/-/Mlh1-/-
mice each MI-positive endometrial lesion showed instability at one to
two mononucleotide repeat tracts (U12235 and MBAT37) yet instability
was not detected in any of the dinucleotide repeats. Only one lesion
from a Pten+/- mice displayed instability
where it was seen in two dinucleotide repeats (D7Mit91 and D10Mit2).
These results indicate that mismatch repair deficiency, because of lack
of Mlh1, accelerates endometrial tumorigenesis in
Pten heterozygous mice.
|
Immunohistochemical analysis of uterine sections demonstrated
reduced Pten expression in most of the endometrial lesions. Overall, we
found that histologically normal epithelium in uteri from
Pten heterozygous mice stained less strongly (2+) than
age-matched wild-type controls (3+). Histologically normal endometrial
glands never demonstrated a complete lack of Pten expression. In both
Pten+/- mice and
Pten+/-/Mlh1-/-
mice at all age groups, the lesions showed a spectrum of staining
patterns with the majority of the lesions showing reduced (1+) or
negative (0) staining (Figure 1g)
. However, occasional endometrial
lesions showed 2+ to 3+ staining that may be secondary to alterations
in the remaining allele of Pten that result in elevated
levels of abnormal Pten protein. On the other hand, phosphorylated Akt
(P-Akt) was expressed in every lesion that was detected on H&E-stained
sections (Figure 1h)
and was absent in intervening normal endometrium
of Pten+/-,
Pten+/-/Mlh1-/-
mice and in normal endometrium of wild-type mice. The
immunohistochemical studies support an inverse relationship between
Pten expression and phosphorylated Akt levels in endometrial
tumorigenesis. In addition, we have analyzed expression of p27, cyclin
D1, and cyclin D3 by immunohistochemistry in
Pten+/- mice and have failed to detect
any correlation with morphological changes and Pten or P-Akt expression
(data not shown). Clearly, additional studies are required to determine
in vivo, at the molecular level, the consequence of
aberrations in Pten alone or in conjunction with MI that
result in endometrial lesions.
LOH Analysis
To determine the status of the wild-type Pten allele we
performed LOH analysis at the Pten locus on DNA from
microdissected endometrial lesions. In
Pten+/-/Mlh1-/- double
mutants at 14 to 18 weeks of age, 60% of microdissected CAH and
endometrial carcinoma showed LOH of the wild-type Pten
allele (Figure 2c)
, whereas 30%, 30%, and 60% of lesions in the
Pten+/- mice at 24, 32, and 40 weeks showed
LOH, respectively (Table 1)
. Thus, the frequency of loss of the
wild-type allele increased with age in Pten+/-
mice and was increased at 14 to 18 weeks in the double-mutant mice.
This finding suggests that tumor development/progression in both
backgrounds involves loss of the wild-type Pten allele and
that this is accelerated in the
Pten+/-/Mlh1-/-
mice. All of the lesions with LOH had either markedly decreased or
absent staining for Pten. In addition, the majority of lesions without
detectable LOH also showed decreased or absent staining, however some
lesions without LOH maintained normal or even elevated levels of
expression. The lesions with decreased Pten expression but without LOH
suggest that Pten may be inactivated in these lesions by
other mechanisms, such as intragenic mutations, epigenetic alterations
(eg, by methylation), and posttranscriptional or posttranslational
regulation. We are in the process of sequencing Pten in
those lesions that lack LOH.
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
35 to 50% of sporadic human UECs1-4
in
several independent studies and in 83% in one study.5
Moreover, mutations have been identified in 20% of noninvasive
precursor lesions called hyperplasias8,9
and in 55% in
one study.5
Here, and in previous studies, it has been
shown that mice carrying a germline mutation in one allele of
Pten spontaneously develop preinvasive and invasive
endometrial neoplastic lesions that are morphologically similar to the
human disease. These findings support a fundamental role for
PTEN in the control of endometrial epithelial
growth/proliferation. An additional observation from studies on primary human tumors is the significant association of PTEN mutations and MI.1-3,10,11 In studies from our laboratory and others, PTEN mutations were detected in 75 to 85% of MI-positive UECs, compared to only 30 to 35% in MI-negative UECs.1,2 Furthermore, the majority of MI-positive sporadic UECs demonstrates hypermethylation of the hMLH1 promoter and lack expression of the protein product.18-22 In this study we have shown that Pten+/-/Mlh1-/- mice demonstrate an accelerated onset and increased severity of endometrial tumorigenesis compared to Pten+/- mice. Importantly, aged matched Mlh1-/- littermates did not develop any endometrial lesions.14,23-26 Our results, in conjunction with the association of these genetic alterations in human UECs, indicate an important relationship between aberrations in the PTEN pathway and mismatch repair deficiency in the pathogenesis of endometrial tumorigenesis. Although the causal mechanism of this relationship and its contribution to the development and/or progression of endometrial cancer are not completely elucidated by the present studies they do provide some preliminary insights. In mice with both mutations, LOH of the wild-type Pten allele was seen in 60% of the hyperplastic lesions at 14 to 18 weeks of age. In Pten+/- mice this frequency of LOH was not seen until 40 weeks of age. These findings suggest that inactivation of the remaining Pten allele promotes the progression of hyperplastic lesions and that mismatch repair deficiency may hasten this event.
Previous studies showed that the spectrum of mutations in PTEN was similar in both MI+ and MI- human UECs.2,7 Moreover, 100% of Pten mutant mice develop CAH, but MMR-deficient mice lack any endometrial lesions. These observations suggest that PTEN mutations are not directly attributable to MI in endometrial carcinoma. In contrast, in human colorectal tumors the mutational spectrum of APC, a gene thought to initiate colorectal tumorigenesis, is substantially different in MI+ tumors when compared to MI- tumors.27 Furthermore, in Apc mutant mice loss of Apc gene function is mediated through loss of wild-type Apc, whereas tumors in Apc+/-/Mlh1-/- mice reveal an increase in intragenic mutations in the wild-type copy of Apc.26 These findings suggest that Apc is a target of MMR deficiency in colorectal tumorigenesis in both humans and mice. Our data show that the majority of endometrial lesions from Pten+/-/Mlh1-/- mice at 14 to 18 weeks of age display LOH of wild-type Pten allele at a frequency similar to that in Pten+/- mice at 40 weeks. This result, along with the studies on the human tumors, implies that the mechanism involved in acceleration of endometrial tumorigenesis in Pten+/-/Mlh1-/- mice may be distinct from that described for colorectal carcinoma. Although the coding region of Pten contains two [A]6 tracts that represent potential mutational targets in tumors with defective mismatch repair, repeat tract mutation in PTEN is an uncommon event in MI+ endometrial cancers.7,28 Based on the above observations, PTEN may not be a direct target of MI and mutations may not be attributable to MI in endometrial carcinoma.
In addition, numerous studies have demonstrated the ability of Pten to negatively influence cellular-survival signaling via regulation of PKB/Akt and implicated PKB/Akt activation by phosphorylation in the development of Pten-related tumors.13,29-31 Our studies also support a critical role for elevated levels of P-Akt in the development of endometrial lesions. In every lesion detectable by light microscopic evaluation, irrespective of size or architecture, P-Akt was detected in both Pten+/- and Pten+/-/Mlh1-/- mice by immunohistochemical analysis. Although other downstream targets in the Pten pathway may play a role in the development/progression of endometrial tumorigenesis these studies suggest a central role for P-Akt.
Genetic mouse models of human disease are often limited by the fact that the phenotype produced in the mouse does not recapitulate the human disease. In the studies presented here we have shown that mice with germline mutations in two of the most commonly altered genes in human UEC spontaneously develop neoplastic endometrial lesions that morphological resemble the human disease. Moreover, the mice reveal a spectrum of changes from preinvasive to invasive disease mimicking the progression model that has been developed through studies on the human disease. Future studies of this mouse model should lead to an understanding of this disease process at the molecular level. In addition, it offers a potential experimental system for the development of clinically relevant diagnostic and treatment modalities for this common disease of women.
|
Footnotes |
|---|
Supported by grants from The Mary Kay Ash Charitable Foundation, the Dorothy Rodbell Cohen Foundation for Sarcoma Research (to L. H. E.), and the National Cancer Institute (CA84301 to R. K.).
Accepted for publication January 22, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Related articles in Am J Pathol:
This article has been cited by other articles:
 |
|
 |
|
  E. A. Akbay, C. M. Contreras, S. A. Perera, J. P. Sullivan, R. R. Broaddus, J. O. Schorge, R. Ashfaq, H. Saboorian, K.-K. Wong, and D. H. Castrillon Differential Roles of Telomere Attrition in Type I and II Endometrial Carcinogenesis Am. J. Pathol., August 1, 2008; 173(2): 536 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. V. Lacey Jr., G. L. Mutter, B. M. Ronnett, O. B. Ioffe, M. A. Duggan, B. B. Rush, A. G. Glass, D. A. Richesson, N. Chatterjee, B. Langholz, et al. PTEN Expression in Endometrial Biopsies as a Marker of Progression to Endometrial Carcinoma Cancer Res., July 15, 2008; 68(14): 6014 - 6020. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Contreras, S. Gurumurthy, J. M. Haynie, L. J. Shirley, E. A. Akbay, S. N. Wingo, J. O. Schorge, R. R. Broaddus, K.-K. Wong, N. Bardeesy, et al. Loss of Lkb1 Provokes Highly Invasive Endometrial Adenocarcinomas Cancer Res., February 1, 2008; 68(3): 759 - 766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C. Dowdy, S. Jiang, X. C. Zhou, X. Hou, F. Jin, K. C. Podratz, and S.-W. Jiang Histone deacetylase inhibitors and paclitaxel cause synergistic effects on apoptosis and microtubule stabilization in papillary serous endometrial cancer cells. Mol. Cancer Ther., November 1, 2006; 5(11): 2767 - 2776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Vilgelm, Z. Lian, H. Wang, S. L. Beauparlant, A. Klein-Szanto, L. H. Ellenson, and A. Di Cristofano Akt-Mediated Phosphorylation and Activation of Estrogen Receptor {alpha} Is Required for Endometrial Neoplastic Transformation in Pten+/- Mice. Cancer Res., April 1, 2006; 66(7): 3375 - 3380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. Chao and S. M. Lipkin Molecular models for the tissue specificity of DNA mismatch repair-deficient carcinogenesis Nucleic Acids Res., February 6, 2006; 34(3): 840 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Ward and D. E. Devor-Henneman Mouse Models of Human Familial Cancer Syndromes Toxicol Pathol, January 1, 2004; 32(1_suppl): 90 - 98. [Abstract] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
