help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, R. K.
Right arrow Articles by Wolf, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, R. K.
Right arrow Articles by Wolf, J.
(American Journal of Pathology. 2002;160:1521-1528.)
© 2002 American Society for Investigative Pathology


Regular Articles

Constitutive Expression of c-FLIP in Hodgkin and Reed-Sternberg Cells

Roman Kurt Thomas*, Anne Kallenborn*, Claudia Wickenhauser{dagger}, Joachim Ludwig Schultze{ddagger}, Andreas Draube*, Martina Vockerodt*, Daniel Re*, Volker Diehl* and Jürgen Wolf*

From the Department of Internal Medicine I* andInstitute of Pathology,{dagger} University of Cologne,Cologne, Germany; and the Department of AdultOncology,{ddagger} Dana-Farber Cancer Institute, andthe Department of Medicine,{ddagger} HarvardMedical School, Boston, Massachusetts


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Crosslinking of the transmembrane receptor CD95/Fas leads to activation of a signaling cascade resulting in apoptosis. c-FLIP is a recently described protein that potently inhibits Fas-mediated apoptosis and has been shown to be a key factor in germinal center B cell survival. Because Hodgkin and Reed-Sternberg cells in classical Hodgkin’s disease (cHD) are also resistant to Fas-mediated apoptosis we studied the role of c-FLIP in classical HD. High levels of c-FLIP protein were identified in two Fas-resistant Hodgkin-derived cell lines. In contrast to other tumor cells, inhibition of protein synthesis by cycloheximide did not lead to down-regulation of c-FLIP protein in these HD cell lines. Furthermore, Fas-mediated apoptosis was only partially restored suggesting that normal regulation of c-FLIP was disrupted. The in vivo relevance of these findings was supported by demonstration of significant c-FLIP expression by immunohistochemistry in 18 of 19 evaluable cases of primary HD. Taken together, c-FLIP is constitutively expressed in HD and may therefore be a major mechanism responsible for Fas-resistance in HD.


CD95/Fas protein is a 45-kd transmembrane protein that belongs to the tumor necrosis factor superfamily type of receptors.1 Crosslinking of the receptor leads to the clustering of an oligomolecular signaling platform, termed death-inducing signaling complex (DISC) that consists of the death domain of the intracellular part of Fas, the adapter molecule Fas-associated-death domain, and the cysteine protease caspase-8. Autoproteolytical cleavage of caspase-8 at the DISC leads to activation of the caspase cascade resulting in the cleavage of DNA and finally, cell death.2,3 CD95/Fas plays a critical role in the elimination of autoreactive T and B cells and inactivation of Fas by mutation or deletion in humans results in the production of autoreactive antibodies, accumulation of activated lymphocytes, splenomegaly, and a high risk for the development of B cell neoplasms.4-6

One downstream key player in CD95/Fas-mediated apoptosis is a protein that has recently been described as the cellular homologue of the viral protein v-Flip termed c-FLIP.7,8 A long and a short splice variant of c-FLIP protein are synthesized, c-FLIPl and c-FLIPs, respectively.8 In cells expressing high levels of c-FLIPl Fas-mediated apoptosis is blocked by inhibition of the recruitment of caspase-8 to the DISC, thus preventing its autoproteolytical cleavage and subsequent activation of downstream caspases.8,9 c-FLIP overexpression thereby causes resistance to Fas-mediated apoptosis in vitro and in vivo leading to the accumulation of autoreactive T cells and the development of autoimmune disease.10 Furthermore, high-level expression of the c-FLIP protein has recently been shown to contribute to a more aggressive phenotype of B lymphoma cells in vivo and could be correlated with tumor progression.11,12 More recently, evidence has emerged that c-FLIP plays a role in the regulation of apoptosis in naïve B cells.13,14 Current work suggests that c-FLIP may be the central factor for survival of germinal center (GC) B cells.15,16

Hodgkin/Reed-Sternberg (HRS) cells represent the malignant cell population in classical Hodgkin’s disease (cHD). In most cases, they derive from GC or post-GC B cells.17 Physiologically, B cells are selected for expression of high-affinity antibody (Ab) in the GC. GC B cells with self-reactive or low-affinity antibody die by CD95/Fas-mediated apoptosis, whereas cells that express immunoglobulin (Ig) with increased affinity for the corresponding antigen are stimulated to proliferate and exit the GC as memory B cells or plasma cells.18-20 In contrast, although HRS cells harbor rearranged Ig genes, they do not express a B cell receptor (BCR), partly because of crippling mutations in their somatically mutated Ig gene rearrangements leading to a nonfunctional rearrangement, or by loss of transcription factors important for Ig-transcription, namely Oct2 and Bob1.21-24 Thus, HRS cells are crippled GC B cells that physiologically are to be eliminated during the GC reaction. Instead, they survive, clonally expand, and lead to disseminated tumor growth and clonal relapse.25,26

Several studies have shown CD95/Fas expression by HRS cells.27,28 However, cultured HRS cells are resistant to Fas-mediated apoptosis.29 Mutations in the Fas gene occur only rarely in cHD and because these mutations are observed in GC B cells, too, it is likely that they merely reflect the GC origin of HRS cells.30,31 Consequently, it might be conceivable that the defect that rescues HRS cells from apoptosis in the GC is located downstream of the CD95/Fas receptor.

Here, we show that c-FLIP is expressed in the HRS cells in 18 of 19 primary cases of cHD. Using two Fas-resistant HD cell lines as a model, we also demonstrate significant c-FLIP expression and show that treatment with the protein synthesis inhibitor cycloheximide (CHX) fails to down-regulate c-FLIP protein. Consequently, the known Fas-sensitizing effect of CHX was not observed.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines

L1236 is an Epstein-Barr virus (EBV)-negative cell line that has been derived from the HRS cells of a patient with mixed cellularity subtype of HD.32,33 L428 is an EBV-negative cell line.34 L428 cells are CD15- and CD30-positive and harbor clonally rearranged and mutated Ig genes, making a HRS cell derivation probable.35,36 Both cell lines are Fas-resistant, although they express wild-type Fas mRNA.29 The human T-lymphoblastic leukemia cell line Jurkat, known to be sensitive toward CD95/Fas-mediated apoptosis, served as a positive control in apoptosis assays. K562, a myeloid cell line derived from a patient with chronic myeloid leukemia during blast crisis is known to express c-FLIP.37 BJAB is a B cell lymphoma cell line that has been shown to down-regulate c-FLIP protein by incubation with CHX. All cell lines were grown in RPMI 1640 (Gibco, Karlsruhe, Germany) supplemented with 10% heat-inactivated fetal calf serum, penicillin (100 IU/ml), streptomycin (100 µg/ml), and glutamine (2 mmol/L) at 37°C in an atmosphere containing 5% CO2 under sterile conditions.

Induction of Apoptosis

For induction of apoptosis, cells were seeded in 24-well plates at a concentration of 5 x 105 cells/well, suspended in 1 ml of medium supplemented with various concentrations of a mouse anti-Fas monoclonal antibody (mAb) (clone CH11; Coulter Immunotech, Marseille, France) or an isotype-matched control mAb (mouse IgM; Alexis Corp., San Diego, CA). CHX (Sigma Aldrich, St. Louis, MO) was added, depending on the respective experiment. For dose finding of Fas-agonistic antibody, CH11 was used in the following concentrations: 50 ng/ml, 100 ng/ml, 200 ng/ml, and 500 ng/ml. In the subsequent experiments, CH11 was used at 100 ng/ml. For dose finding of CHX, the following concentrations were used: 1 µg/ml, 10 µg/ml, and 100 µg/ml. In the following analyses CHX was used at 10 µg/ml on L428 and L1236, and at 1 µg/ml for treatment of Jurkat cells. Cells were incubated overnight and apoptosis was measured after 24 hours of incubation, or at various time points, depending on the experiment performed.

Measurement of Apoptosis

Apoptosis was detected by fluorescence-activated cell sorting (FACS) analysis using phycoerythrin-coupled Annexin-V (Pharmingen, BD, Heidelberg, Germany) and Propidium iodide on a FACScan flow-cytometer (BD). Analyses were performed using CellQuest software (BD).

Western Blot

Cells were incubated with or without various doses of CHX. For extraction of proteins, 1 x 106 cells were harvested, washed twice in ice-cold phosphate-buffered saline, and then lysed in 50 µl of RIPA buffer. Forty µg of protein per slot were separated by discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the gel containing 10% acrylamide. After blotting onto nitrocellulose filters (Hybond C Extra; Amersham-Pharmacia, Freiburg, Germany), a 1-hour incubation with blocking reagent was done to inhibit unspecific binding of antibodies. The blots were incubated overnight with the polyclonal rabbit anti-human c-FLIPl antibody (raised against the C-terminus of human c-FLIPl protein, concentration 1:1000; Sigma) or with a monoclonal mouse anti-human actin antibody (Chemicon, Hofheim, Germany), to document equal loading of the gel. Subsequently, the blots were washed three times with Tris-buffered saline containing 0.05% Tween and a second goat anti-rabbit antibody coupled to horseradish peroxidase (concentration 1:2000; DAKO, Hamburg, Germany) was added. The Enhanced Chemiluminescence system (Amersham-Pharmacia) was used for development of the blots, according to the manufacturer’s instructions.

Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

mRNA was extracted from cultured cells using the µMacs mRNA Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany), following the recommendations of the manufacturer. cDNA synthesis was performed using an oligo-dT oligonucleotide and Superscript reverse transcriptase (Life Technologies, Karlsruhe, Germany). Oligonucleotides were intron-spanning to differentiate between amplificated genomic DNA and cDNA sequences; they were designed to hybridize to the 3'-end of the human c-FLIPl transcript (c-FLIP.S.: acagttcaccgagaagctgact; c-FLIP.AS.: tccttggcagaaactctgctgt). Amplification was performed in a 50-µl assay containing 50 mmol/L KCl, 2.5 mmol/L MgCl2, 200 µmol/L of each dNTP, and 25 pmol of each oligonucleotide. c-FLIP templates were amplified in 35 cycles of denaturation, annealing and synthesis (95°C for 30 seconds; 61°C for 30 seconds; 72°C for 60 seconds). After a final extension step at 72°C for 6 minutes, products were cooled to 10°C, analyzed by agarose gel electrophoresis, and visualized by ethidium bromide staining and UV light. Representative bands were excised, extracted using the Jetsorb kit (Genomed, Bad Oeynhausen, Germany), and directly sequenced using the Ready Reaction DyeTerminator cycle-sequencing kit (Perkin Elmer, Weiterstadt, Germany) on an automated sequencing apparatus (ABI 377, Applied Biosystems/Perkin Elmer). Sequences were compared to published c-FLIP sequences applying the BLAST software from the National Center for Biotechnology Information.

Pathological Specimen

Twenty-three primary cases of classical HD, two nonneoplastic lymph nodes, and one specimen of striated muscle tissue infiltrated by a B cell non-Hodgkin’s lymphoma were analyzed by immunohistochemistry. All cases were classified according to the World Health Organization classification and diagnoses were reviewed by the pathologist reference panel of the German Hodgkin’s Lymphoma Study Group. Characteristics are listed in Table 1 .


View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of Pathological Specimen

 
Immunohistochemistry

Formalin-fixed paraffin-embedded tissue sections and two nonneoplastic lymph nodes used as positive controls were stained. Rabbit-anti-human c-FLIP polyclonal antibody (Sigma), directed against the long isoform of c-FLIP or the monoclonal mouse anti-human CD30 antibody Ber-H2 (DAKO) were used in these experiments. Six-µm sections were mounted on glass slides, deparaffinized in xylene, rehydrated in graded alcohol, and washed in water. The slides were stained following standard procedures. The antibody reaction was detected using avidin-biotin-complex (ABC)-bound alkaline phosphatase (DAKO) and FastRed (DAKO) or NBT (Sigma) as chromogen. After immunostaining, slides were counterstained with hemalaun (Merck, Darmstadt, Germany). Sections from hyperplastic tonsils, striated muscle tissue, reactive lymph nodes containing GCs, and endothelial cells in all analyzed specimen served as external and internal positive controls, respectively. The percentage of c-FLIP-positive cells was estimated by comparing serial sections of most cases, stained either with an anti-CD30 mAb or the polyclonal anti-c-FLIP antibody. Four cases could not be evaluated because of lack of CD30-positive HRS cells in the control sections or overstaining, and were therefore categorized as "not informative." However, it cannot be excluded that the HRS cells in the "not informative" cases did not express c-FLIP protein. A case was categorized as + when 25 to 75% of HRS cells showed at least weak to moderate c-FLIP staining, as compared to CD30-positive cells. When 75 to 100% of HRS cells showed a moderate to strong staining, a case was categorized as ++.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
HRS Cells Are Resistant to Fas-Mediated Apoptosis

The two HRS cell lines, L1236 and L428, and the T-cell leukemia cell line Jurkat have recently been shown to express wild-type Fas mRNA and protein.29 These cell lines were incubated with the agonistic anti-Fas mAb CH11 or isotype control at concentrations ranging from 50 to 500 ng/ml and apoptotic cells were determined after 24 hours using Annexin-V and propidium iodide staining. As shown in Figure 1 , significant apoptosis was only induced in Jurkat cells (mean ± SD = 80.5 ± 8.7% of three independent experiments) whereas the portion of apoptotic cells for L1236 and L428 did not differ significantly when cells were treated with CH11 mAb or isotype control. These data clearly demonstrate that the HRS cell lines L1236 and L428 are resistant to Fas-mediated apoptosis.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. HD cell lines L428 and L1236 are resistant to Fas-mediated apoptosis. Jurkat, L1236, and L428 cells (5 x 105) were incubated for 24 hours with 100 ng/ml of agonistic anti-Fas mAb CH11 or the IgM-isotype control mAb. Apoptosis was assessed after 24 hours of incubation as described in Materials and Methods. Results are shown as percentages of apoptotic cells (MV of three independent experiments; bars, SD).

 
c-FLIPl mRNA and Protein Are Highly Expressed in Fas-Resistant Cultivated HRS Cells

To elucidate potential mechanisms for the observed Fas resistance in HRS cells we studied the expression of c-FLIP by RT-PCR and Western blotting. K562 cells and freshly isolated CD77+-CD38+ GC B cells served as positive controls. RT-PCR from L428, L1236, and controls using intron-spanning c-FLIP-specific primers yielded a strong signal of the expected size of 192 bp (Figure 2) . Using identical PCR conditions, attempts to amplify c-FLIP sequences from genomic DNA of L428 and L1236 cells failed because of a large intron between the two primer binding sites (data not shown).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 2. c-FLIP mRNA is expressed in Fas-resistant HRS cell lines L1236 and 428, and in their physiological counterpart, the GC B cells. cDNAs from L1236, L428, and freshly isolated GC B cells were submitted to 35 cycles of RT-PCR amplification using oligonucleotides specific for the long isoform of c-FLIP. Products were analyzed by agarose gel electrophoresis and ethidium bromide staining. cDNA from K562 was co-amplified as a positive control. Equal amounts of cDNAs were verified by amplifying GAPDH transcripts.

 
Direct sequencing of the 192-bp RT-PCR fragment and comparison with published c-FLIPl sequences under www.ncbi.nlm.nih.gov/blast/ confirmed c-FLIPl amplification corresponding to bp 1605 to 1707 of accession no. u97074 (data not shown). Thus, c-FLIPl m-RNA is expressed in Fas-resistant cultured HRS cells L428 and L1236, similar to CD77+-CD38+ centroblasts. Western blotting of cell lysates of L1236, L428, and K562 cells was performed and yielded bands of the expected size of 55 kd for all cell lines, thereby demonstrating c-FLIP protein expression of cultured HRS cells (data not shown).

Blockage of Protein Synthesis in Fas-Resistant HRS Cell Lines by CHX Does Not Lead to Down-Regulation of c-FLIP Protein

To determine whether c-FLIP expression is normally regulated in HRS cells, protein synthesis was blocked using CHX because CHX blockade was recently described to down-regulate c-FLIP expression in several cell lines.37 Western blot analyses of lysates of cell lines L1236 and L428 were performed to study c-FLIP protein levels in L428 and L1236 cells treated with doses from 1 to 10 µg/ml of CHX. Cell lysates were prepared of L428 and L1236 cells at different time points (0 hours, 12 hours, 24 hours) of CHX treatment and submitted to Western blotting. Cell lysates prepared from BJAB cells served as controls because down-regulation of c-FLIP by CHX in these cells has been documented.38 Surprisingly, c-FLIP levels in both L428 and L1236 cells remained unaltered throughout the whole time period (24 hours) of CHX treatment whereas c-FLIP levels decreased in BJAB cells at a CHX dose of 1 µg/ml (Figure 3) . Augmentation of the CHX dose up to 10 µg/ml had no effect on c-FLIP protein levels in L428 and L1236 cells. Thus, CHX fails to down-regulate anti-apoptotic c-FLIP protein in L428 and L1236 cells.



View larger version (75K):
[in this window]
[in a new window]
 
Figure 3. c-FLIP protein is not down-regulated in cultured HRS cells after treatment with CHX. Cells were incubated with 1 or 10 µg/ml of CHX. At time points of 0 hours, 12 hours, and 24 hours, 1 x 106 cells were harvested, lysed, and cell lysates were submitted to Western blotting using polyclonal c-FLIPl antibody. Time points are indicated. A: Western blots from BJAB, L428, and L1236 cells at various time points of treatment with 1 µg/ml of CHX. The 55-kd band represents c-FLIPl, the 42-kd band represents ß-actin. B: Western blots from BJAB, L428, and L1236 cells at various time points of treatment with 10 µg/ml of CHX.

 
Fas-Sensitivity Is Moderately Restored by CHX Treatment in L428 but Not in L1236 Cells

CHX is known to sensitize tumor cells to Fas-mediated apoptosis.38,39 To test whether CHX treatment would increase Fas-mediated apoptosis in HD cells, L1236 and L428 cells were incubated with the Fas-agonistic mAb CH11 (100 ng/ml) or an isotype control antibody in the presence of increasing concentrations of CHX. Induction of apoptosis was assessed between 12 and 24 hours. As expected, significant apoptosis was induced in the positive control cell line Jurkat as early as 12 hours after treatment with the Fas agonistic mAb in the presence of 1 µg/ml of CHX (82.4%; Figure 4 ) and stayed similarly high throughout the observation period (Figures 4 and 5) . Higher concentrations of CHX showed toxic effects as demonstrated by increased apoptotic cells in the isotype control cultures (data not shown). In contrast, neither L1236 nor L428 showed a significant increase in the percentage of apoptotic cells compared to incubation with isotype control mAb under these experimental conditions (data not shown). Only when increasing the concentration of CHX to 10 µg/ml did the number of apoptotic L428 cells increase to 35.1% at 12 hours and 58.9% at 24 hours (Figures 4 and 5) . L1236 were still insensitive to Fas-mediated apoptosis under these conditions. Further increasing the concentration of CHX revealed a toxic effect because apoptotic cells increased similarly in the isotype control cultures. Thus, Fas-mediated apoptosis is not induced in L1236 and shows a delayed onset and is of much lower magnitude in L428 cells as compared to Jurkat cells after blocking protein synthesis with CHX.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Treatment with 10 µg/ml of the protein synthesis inhibitor CHX leads to a moderate sensitization to Fas-mediated apoptosis in L428 cells. Jurkat, L1236 and L428 cells (5 x105) were incubated for 24 hours with varying concentrations of CHX (1 µg/ml for Jurkat cells, 10 µg/ml for both L1236 and L428 cells), 100 ng/ml of agonistic anti-Fas mAb CH11 or the IgM-isotype control mAb. Apoptosis was assessed at indicated time points as described in Materials and Methods. Results are shown as percentages of apoptotic cells (MV of three independent experiments; bars, SD). {square}, Jurkat, 1 µg/ml CHX, 100 ng/ml isotype; {blacksquare}, Jurkat, 1 µg/ml CHX, 100 ng/ml CH11; {triangleup}, L428, 10 µg/ml CHX, 100 ng/ml isotype; {blacktriangleup}, L428, 10 µg/ml CHX, 100 ng/ml CH11; {circ}, L1236, 10 µg/ml CHX, 100 µg/ml isotype; •, L1236, 10 µg/ml CHX, 100 ng/ml CH11.

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. FACS analyses of Jurkat, L428, and L1236 cells after 24 hours of combined treatment with CHX and Fas-agonistic mAb CH11. Jurkat, L1236, and L428 cells (5 x 105) were incubated for 24 hours with varying concentrations of CHX (1 µg/ml for Jurkat cells, 10 µg/ml for both L1236 and L428 cells), 100 ng/ml agonistic anti-Fas mAb CH11 or the IgM-isotype control mAb. The cells were incubated with phycoerythrin-labeled Annexin V stained with propidium iodide and submitted to FACS analyses. 10,000 events were recorded. Twenty percent of dots are shown. Percentages of apoptotic cells are indicated. A: Jurkat cells after a 24-hour treatment with 1 µg/ml of CHX and an isotype mAb. B: Jurkat cells after a 24-hour treatment with 1 µg/ml of CHX and 100 ng/ml of CH11. C: L428 cells after a 24-hour treatment with 10 µg/ml of CHX and an isotype mAb. D: L428 cells after a 24-hour treatment with 10 µg/ml of CHX and 100 ng/ml of CH11. E: L1236 cells after a 24-hour treatment with 10 µg/ml of CHX and an isotype-matched control mAb. F: L1236 cells after a 24-hour treatment with 10 µg/ml of CHX and 100 ng/ml of CH11.

 
c-FLIP Protein Is Expressed in HRS Cells of Primary Cases of cHD

While demonstrating expression and altered regulation of c-FLIP in HD cell lines it was critical to demonstrate expression of c-FLIP protein in primary HRS cells by immunohistochemistry. Of the 19 informative cases (see Materials and Methods), 11 cases showed a strong cytoplasmic c-FLIP staining in more than 75% of the HRS cells (Figure 6) , whereas 7 showed a positive cytoplasmic staining in 25 to 75% of HRS cells. Only one case was found to be negative for c-FLIP protein expression. No correlation was found between histological subtype, clinical characteristics, and c-FLIP expression levels (data not shown). As expected, GC B cells in hyperplastic tonsils and in reactive lymph nodes, striated muscle cells, as well as vascular endothelial cells in the diseased tissue were also positive, thereby demonstrating sensitivity and specificity of the immunohistochemistry procedure used. Thus, c-FLIP protein was synthesized by HRS cells of HD-involved tissue in 18 of 19 informative cases analyzed.



View larger version (137K):
[in this window]
[in a new window]
 
Figure 6. c-FLIP protein is expressed in HRS cells in HD-involved tissue. Serial sections from HD-involved tissues were stained either with a polyclonal anti-c-FLIP antibody or an anti-CD30 mAb to show HRS cells and then counterstained with hemalaun. The number of c-FLIP+ cells was estimated and compared to the number of CD30+ cells. Cases with 75 to 100% of HRS cells being positive for c-FLIP were categorized as ++, whereas cases with 25 to 75% of c-FLIP+ HRS cells were classified as +. Striated muscle tissue and GCs served as positive controls. A: Primary HD case stained with c-FLIP Ab showing one HRS cell. B: Primary HD case stained with a polyclonal c-FLIP Ab showing two HRS cells surrounded by lymphoid cells. C: Specimen of striated muscle tissue infiltrated by a B cell non-Hodgkin’s lymphoma stained with polyclonal c-FLIP Ab. D: Reactive lymph node with three GCs and vascular endothelial cells stained with polyclonal c-FLIP Ab. Original magnifications: x200 (A); x400 (B); x100 (C and D).

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
We demonstrate here that the anti-apoptotic factor c-FLIP is expressed at high levels in HRS cells in the majority of patients with HD. Furthermore, in contrast to normal GC B cells c-FLIP is likely to be dissociated from normal regulatory circuits in cultivated HRS cells. This was demonstrated by treatment of HRS cells in vitro with CHX, which is known to inhibit protein synthesis in eukaryontae thereby significantly reducing the levels of c-FLIP protein. In contrast to other tumor cells c-FLIP protein levels remained unaltered in the HRS cell lines L428 and L1236 upon treatment with CHX, which was also associated with unaltered resistance to Fas-mediated apoptosis. Constitutive expression of c-FLIP might therefore be an important mechanism for the survival advantage of HRS cells.

The normal counterparts of HRS cells, namely GC B cells, have recently been demonstrated to enter the GC with an activated apoptosis program.15,16 Activation of the Fas pathway and subsequent clustering of the DISC seem to be critical events in this process. Although it is clearly demonstrated that HRS cells derive from crippled GC B cells, the mechanisms by which these cells are prevented from apoptotic elimination remain elusive. The high-level expression of c-FLIP in HRS cells might play a central role because other mechanisms of inactivation of the CD95/Fas pathway such as mutation or deletion of the CD95/Fas receptor do not seem to be a dominant feature of HRS cells.29-31 p53 mutations or bcl-2 rearrangements in HRS cells, both of which could explain Fas resistance have also not been closely associated with the pathogenesis of HD.40,41

Although both HD cell lines tested showed high levels of c-FLIP expression, and a stringent correlation between Fas resistance and c-FLIP protein levels was eminent in L1236 cells, we were able to demonstrate a residual but delayed Fas sensitivity of L428 cells, however only when challenged with close to toxic concentrations of CHX. It is therefore not ruled out that additional unknown pathways also contribute to resistance to apoptosis in HD.

Whether the dissociation of c-FLIP regulation in HRS cells is because of exogenous or endogenous signals will be an important question for further investigation. Because c-FLIP levels in isolated GC B cells decrease rapidly after the isolation procedure, a stimulatory surrounding might be essential for the maintenance of c-FLIP levels. Survival of GC B cells is restricted to those cells that bear high-affinity BCR on their cell surface. Because HRS cells do not present a BCR on their cell surface, c-FLIP protein expression in these cells is likely disconnected from this physiological regulatory pathway. Another exogenous signal could be delivered via CD40. Primary HRS cells express CD40 in most if not all cases and are surrounded by CD40L-expressing T cells.42,43 One might therefore argue that the CD40 pathway is active in at least primary HRS cells. Indeed, normal human and murine B cells up-regulate c-FLIP on stimulation via the BCR and CD40.13-15 However in normal primary human B cells c-FLIP expression on separate or concomitant CD40 and BCR signaling is transient and begins to disappear after 24 hours of stimulation.14 In the absence of BCR expression on HRS cells and CD40L in the culture system, an autocrine signaling loop leading to prolonged c-FLIP expression through chronic stimulation can be excluded.42,43 Therefore, other mechanisms must account for the high-level expression in up to 100% of primary HRS cells demonstrated here.

Constitutive NF{kappa}B expression by HRS cells could explain activation of HRS cells that are destined to die.44,45 I{kappa}B{alpha} mutations in primary and cultured HRS cells have been reported and might underlie activation of NF{kappa}B in a minority of cases, rescuing the HRS cells from programmed cell death.46,47 However, a percentage of cases remains for which the causes of apoptosis resistance have to be elucidated. NF{kappa}B activation may be explained by I{kappa}B{alpha} mutations or by Epstein-Barr virus-encoded latent membrane proteins (LMP1 and LMP2a). Because c-FLIP is also a potent NF{kappa}B activator, it is tempting to speculate that this represents a putative mechanism for constitutive NF{kappa}B expression.48 The precise interaction, however, between c-FLIP and NF{kappa}B in HRS cells remains to be elucidated.

In summary, we demonstrate constitutive expression of anti-apoptotic c-FLIP protein in a panel of primary cHD cases. Furthermore, we demonstrate the failure of two Fas-resistant HRS cell lines to down-regulate c-FLIP in response to CHX treatment. We conclude that constitutive c-FLIP expression may be a central mechanism rescuing HRS cells from Fas-mediated apoptosis.


    Acknowledgements
 
We thank Ines Schwering for kindly providing the cDNA from GC B cells.


    Footnotes
 
Address reprint requests to Dr. Jürgen Wolf, University of Cologne, Department of Internal Medicine I, Joseph-Stelzmann-Str.9, 50924 Cologne, Germany. E-mail: juergen.wolf{at}medizin.uni-koeln.de

Supported by the Deutsche Forschungsgemeinschaft SFB 502, TP1; and Köln Fortune (doctoral fellowship to A. K.).

R. K. T. and A. K. both contributed equally to this work.

Accepted for publication January 18, 2002.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagata S, Golstein P: The Fas death factor. Science 1995, 267:1449-1456[Abstract/Free Full Text]
  2. Muzio M, Chinnaiyan AM, Kischkel FC, O’Rourke K, Shevchenko ANJ, Scaffidi C, Bretz JD, Zhang M, Gentz R, Mann M, Krammer PH, Peter ME, Dixit VM: FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex. Cell 1996, 85:817-827[Medline]
  3. Medema JP, Scaffidi C, Kischkel FC, Shevchenko ANJ, Mann M, Krammer PH, Peter ME: FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). EMBO J 1997, 16:2794-2804[Medline]
  4. Fisher GH, Rosenberg FJ, Straus SE, Dale JK, Middelton LA, Lin AY, Strober W, Lenardo MJ, Puck JM: Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative disorder. Cell 1995, 81:935-946[Medline]
  5. Drappa J, Vaishnaw AK, Sullivan KE, Chu JL, Elkon KB: Fas gene mutations in the Canale-Smith syndrome, an inherited lymphoproliferative disorder associated with autoimmunity. N Engl J Med 1996, 335:1643-1649[Abstract/Free Full Text]
  6. Bettinardi A, Brugnoni D, Quiros-Roldan E, Malagoli A, La Grutta S, Correra A, Notarangelo LD: Missense mutations in the Fas gene resulting in autoimmune lymphoproliferative syndrome: a molecular and immunological analysis. Blood 1997, 89:902-909[Abstract/Free Full Text]
  7. Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, Neipel F, Mattmann C, Burns K, Bodmer JL, Schroter M, Scaffidi C, Krammer PH, Peter ME, Tschopp J: Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 1997, 386:517-521[Medline]
  8. Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, Bodmer JL, Schroter M, Burns K, Mattmann C, Rimoldi D, French LE, Tschopp J: Inhibition of death receptor signals by cellular FLIP. Nature 1997, 388:190-195[Medline]
  9. Scaffidi C, Schmitz I, Krammer PH, Peter ME: The role of c-FLIP in modulation of CD95-induced apoptosis. J Biol Chem 1999, 274:1541-1548[Abstract/Free Full Text]
  10. Van Parijs L, Refaeli Y, Abbas AK, Baltimore D: Autoimmunity as a consequence of retrovirus-mediated expression of C-FLIP in lymphocytes. Immunity 1999, 11:763-770[Medline]
  11. Medema JP, de Jong J, van Hall T, Melief CJ, Offringa R: Immune escape of tumors in vivo by expression of cellular FLICE-inhibitory protein. J Exp Med 1999, 190:1033-1038[Abstract/Free Full Text]
  12. Djerbi M, Screpanti V, Catrina AI, Bogen B, Biberfeld P, Grandien A: The inhibitor of death receptor signaling, FLICE-inhibitory protein defines a new class of tumor progression factors. J Exp Med 1999, 190:1025-1032[Abstract/Free Full Text]
  13. Wang J, Lobito AA, Shen F, Hornung F, Winoto A, Lenardo MJ: Inhibition of Fas-mediated apoptosis by the B cell antigen receptor through c-FLIP. Eur J Immunol 2000, 30:155-163[Medline]
  14. Hennino A, Berard M, Casamayor-Palleja M, Krammer PH, Defrance T: Regulation of the Fas death pathway by FLICE-inhibitory protein in primary human B cells. J Immunol 2000, 165:3023-3030[Abstract/Free Full Text]
  15. Hennino A, Berard M, Krammer P, Defrance T: Flice-inhibitory protein is a key regulator of germinal center B cell apoptosis. J Exp Med 2001, 193:447-458[Abstract/Free Full Text]
  16. van Eijk M, Medema JP, de Groot C: Cutting edge: cellular Fas-associated death domain-like IL-1-converting enzyme-inhibitory protein protects germinal center B cells from apoptosis during germinal center reactions. J Immunol 2001, 166:6473-6476[Abstract/Free Full Text]
  17. Küppers R, Rajewsky K: The origin of Hodgkin and Reed/Sternberg cells in Hodgkin’s disease. Annu Rev Immunol 1998, 16:471-493[Medline]
  18. Rajewsky K: Clonal selection and learning in the antibody system. Nature 1996, 381:751-758[Medline]
  19. Rothstein TL, Wang JK, Panka DJ, Foote LC, Wang Z, Stanger B, Cui H, Marshak-Rothstein A: Protection against Fas-dependent Th1 mediated apoptosis by antigen receptor engagement in B-cells. Nature 1995, 374:163-165[Medline]
  20. Schattner E, Friedman SM: Fas expression and apoptosis in human B cells. Immunol Res 1996, 15:246-257[Medline]
  21. Kanzler H, Küppers R, Hansmann ML, Rajewsky K: Hodgkin and Reed Sternberg cells in Hodgkin’s disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells. J Exp Med 1996, 184:1495-1505[Abstract/Free Full Text]
  22. Marafioti T, Hummel M, Foss HD, Laumen H, Korbjuhn P, Anagnostopoulos I, Lammert H, Demel G, Theil J, Wirth T, Stein H: Hodgkin and Reed-Sternberg cells represent an expansion of a single clone originating from a germinal center B-cell with functional immunoglobulin gene rearrangements but defective immunoglobulin transcription. Blood 2000, 95:1443-1450[Abstract/Free Full Text]
  23. Re D, Müschen M, Ahmadi T, Wickenhauser C, Staratschek-Jox A, Holtick U, Diehl V, Wolf J: Oct-2 and Bob-1 deficiency in Hodgkin and Reed Sternberg cells. Cancer Res 2001, 61:2080-2084[Abstract/Free Full Text]
  24. Stein H, Marafioti T, Foss HD, Laumen H, Hummel M, Anagnostopoulos I, Wirth T, Demel G, Falini B: Down-regulation of BOB1/OBF1 and Oct2 in classical Hodgkin disease but not in lymphocyte predominant Hodgkin disease correlates with immunoglobulin transcription. Blood 2001, 97:496-501[Abstract/Free Full Text]
  25. Jox A, Zander T, Kornacker M, Kanzler H, Kuppers R, Diehl V, Wolf J: Detection of identical Hodgkin-Reed Sternberg cell specific immunoglobulin gene rearrangements in a patient with Hodgkin’s disease of mixed cellularity subtype at primary diagnosis and in relapse two and a half years later. Ann Oncol 1998, 9:283-287[Abstract/Free Full Text]
  26. Jox A, Zander T, Diehl V, Wolf J: Clonal relapse in Hodgkin’s disease. N Engl J Med 1997, 337:499[Free Full Text]
  27. Xerri L, Carbuccia N, Parc P, Hassoun J, Birg F: Frequent expression of FAS/APO-1 in Hodgkin’s disease and anaplastic large cell lymphomas. Histopathology 1995, 27:235-241[Medline]
  28. Metkar SS, Naresh KN, Redkar AA, Soman CS, Advani SH, Nadkarni JJ: Expression of Fas and Fas ligand in Hodgkin’s disease. Leuk Lymphoma 1999, 33:521-530[Medline]
  29. Re D, Hofmann A, Wolf J, Diehl V, Staratschek-Jox A: Cultivated H-RS cells are resistant to CD95L-mediated apoptosis despite expression of wild-type CD95. Exp Hematol 2000, 28:31-35
  30. Muschen M, Re D, Brauninger A, Wolf J, Hansmann ML, Diehl V, Kuppers R, Rajewsky K: Somatic mutations of the CD95 gene in Hodgkin and Reed-Sternberg cells. Cancer Res 2000, 60:5640-5643[Abstract/Free Full Text]
  31. Muschen M, Re D, Jungnickel B, Diehl V, Rajewsky K, Kuppers R: Somatic mutation of the CD95 gene in human B cells as a side-effect of the germinal center reaction. J Exp Med 2000, 192:1833-1840[Abstract/Free Full Text]
  32. Wolf J, Kapp U, Bohlen H, Kornacker M, Schoch C, Stahl B, Mücke S, von Kalle C, Fonatsch C, Schaefer HE, Hansmann ML, Diehl V: Peripheral blood mononuclear cells of a patient with advanced Hodgkin’s lymphoma gives rise to permanently growing Hodgkin-Reed Sternberg cells. Blood 1996, 87:3418-3428[Abstract/Free Full Text]
  33. Kanzler H, Hansmann ML, Kapp U, Wolf J, Diehl V, Rajewsky K, Kuppers R: Molecular single cell analysis demonstrates the derivation of a peripheral blood-derived cell line (L1236) from the Hodgkin/Reed-Sternberg cells of a Hodgkin’s lymphoma patient. Blood 1996, 87:3429-3436[Abstract/Free Full Text]
  34. Schaadt M, Fonatsch C, Kirchner H, Diehl V: Establishment of a malignant, Epstein-Barr-virus (EBV)-negative cell-line from the pleural effusion of a patient with Hodgkin’s disease. Blut 1979, 38:185-190[Medline]
  35. Messineo C, Coupland R, Bakhshi A, Raffeld M, Irving SG, Bagg A, Cossman J: Rearrangement, hypermutation, and possible preferential use of a VH5 gene, VH32, in a Hodgkin’s cell line. Hematopathol Mol Hematol 1997–1998, 11:19–28
  36. Falk MH, Tesch H, Stein H, Diehl V, Jones DB, Fonatsch C, Bornkamm GW: Phenotype versus immunoglobulin and T-cell receptor genotype of Hodgkin-derived cell lines: activation of immature lymphoid cells in Hodgkin’s disease. Int J Cancer 1987, 40:262-269[Medline]
  37. Hu S, Vincenz C, Ni J, Gentz R, Dixit VM: I-FLICE, a novel inhibitor of tumor necrosis factor receptor-1- and CD-95-induced apoptosis. J Biol Chem 1997, 272:17255-17257[Abstract/Free Full Text]
  38. Fulda S, Meyer E, Debatin KM: Metabolic inhibitors sensitize for CD95 (APO-1/Fas)-induced apoptosis by down-regulating Fas-associated death domain-like interleukin 1-converting enzyme inhibitory protein expression. Cancer Res 2000, 60:3947-3956[Abstract/Free Full Text]
  39. Natoli G, Ianni A, Costanzo A, De Petrillo G, Ilari I, Chirillo P, Balsano C, Levrero M: Resistance to Fas-mediated apoptosis in human hepatoma cells. Oncogene 1995, 11:1157-1164[Medline]
  40. Montesinos-Rongen M, Roers A, Kuppers R, Rajewsky K, Hansmann ML: Mutation of the p53 gene is not a typical feature of Hodgkin and Reed-Sternberg cells in Hodgkin’s disease. Blood 1999, 94:1755-1760[Abstract/Free Full Text]
  41. Gravel S, Delsol G, Al Saati T: Single-cell analysis of the t(14;18)(q32;q21) chromosomal translocation in Hodgkin’s disease demonstrates the absence of this translocation in neoplastic Hodgkin and Reed-Sternberg cells. Blood 1998, 91:2866-2874[Abstract/Free Full Text]
  42. Gruss HJ, Hirschstein D, Wright B, Ulrich D, Caligiuri MA, Barcos M, Strockbine L, Armitage RJ, Dower SK: Expression and function of CD40 on Hodgkin and Reed-Sternberg cells and the possible relevance for Hodgkin’s disease. Blood 1994, 84:2305-2314[Abstract/Free Full Text]
  43. Carbone A, Gloghini A, Gattei V, Aldinucci D, Degan M, De Paoli P, Zagonel V, Pinto A: Expression of functional CD40 antigen on Reed-Sternberg cells and Hodgkin’s disease cell lines. Blood 1995, 85:780-789[Abstract/Free Full Text]
  44. Bargou RC, Leng C, Krappmann D, Emmerich F, Mapara MY, Bommert K, Royer HD, Scheidereit C, Dorken B: High-level nuclear NF-kappa B and Oct-2 is a common feature of cultured Hodgkin/Reed-Sternberg cells. Blood 1996, 87:4340-4347[Abstract/Free Full Text]
  45. Bargou RC, Emmerich F, Krappmann D, Bommert K, Mapara MY, Arnold W, Royer HD, Grinstein E, Greiner A, Scheidereit C, Dorken B: Constitutive nuclear factor-kappaB-RelA activation is required for proliferation and survival of Hodgkin’s disease tumor cells. J Clin Invest 1997, 100:2961-2969[Medline]
  46. Emmerich F, Meiser M, Hummel M, Demel G, Foss HD, Jundt F, Mathas S, Krappmann D, Scheidereit C, Stein H, Dorken B: Overexpression of I kappa B alpha without inhibition of NF-kappaB activity and mutations in the I kappa B alpha gene in Reed-Sternberg cells. Blood 1999, 94:3129-3134[Abstract/Free Full Text]
  47. Jungnickel B, Staratschek-Jox A, Braüninger A, Spieker T, Wolf J, Diehl V, Hansmann ML, Rajewsky K, Küppers R: Clonal deleterious mutations in the IkappaBalpha gene in the malignant cells in Hodgkin’s lymphoma. J Exp Med 2000, 191:395-402[Abstract/Free Full Text]
  48. Hu WH, Johnson H, Shu HB: Activation of NF-kappaB by FADD, Casper, and caspase-8. J Biol Chem 2000, 275:10838-10844[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Pathol.Home page
G Kapatai and P Murray
Contribution of the Epstein Barr virus to the molecular pathogenesis of Hodgkin lymphoma
J. Clin. Pathol., December 1, 2007; 60(12): 1342 - 1349.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
I. A. Mawji, C. D. Simpson, R. Hurren, M. Gronda, M. A. Williams, J. Filmus, J. Jonkman, R. S. Da Costa, B. C. Wilson, M. P. Thomas, et al.
Critical Role for Fas-Associated Death Domain-Like Interleukin-1-Converting Enzyme-Like Inhibitory Protein in Anoikis Resistance and Distant Tumor Formation
J Natl Cancer Inst, May 16, 2007; 99(10): 811 - 822.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kashkar, A. Deggerich, J.-M. Seeger, B. Yazdanpanah, K. Wiegmann, D. Haubert, C. Pongratz, and M. Kronke
NF-{kappa}B-independent down-regulation of XIAP by bortezomib sensitizes HL B cells against cytotoxic drugs
Blood, May 1, 2007; 109(9): 3982 - 3988.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Kashkar, J.-M. Seeger, A. Hombach, A. Deggerich, B. Yazdanpanah, O. Utermohlen, G. Heimlich, H. Abken, and M. Kronke
XIAP targeting sensitizes Hodgkin lymphoma cells for cytolytic T-cell attack
Blood, November 15, 2006; 108(10): 3434 - 3440.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. K. Thomas, M. L. Sos, T. Zander, O. Mani, A. Popov, D. Berenbrinker, S. Smola-Hess, J. L. Schultze, and J. Wolf
Inhibition of Nuclear Translocation of Nuclear Factor-{kappa}B Despite Lack of Functional I{kappa}B{alpha} Protein Overcomes Multiple Defects in Apoptosis Signaling in Human B-Cell Malignancies
Clin. Cancer Res., November 15, 2005; 11(22): 8186 - 8194.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
D. Re, R. Kuppers, and V. Diehl
Molecular Pathogenesis of Hodgkin's Lymphoma
J. Clin. Oncol., September 10, 2005; 23(26): 6379 - 6386.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Boll, H. Hansen, F. Heuck, K. Reiners, P. Borchmann, A. Rothe, A. Engert, and E. Pogge von Strandmann
The fully human anti-CD30 antibody 5F11 activates NF-{kappa}B and sensitizes lymphoma cells to bortezomib-induced apoptosis
Blood, September 1, 2005; 106(5): 1839 - 1842.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Poukkula, A. Kaunisto, V. Hietakangas, K. Denessiouk, T. Katajamaki, M. S. Johnson, L. Sistonen, and J. E. Eriksson
Rapid Turnover of c-FLIPshort Is Determined by Its Unique C-terminal Tail
J. Biol. Chem., July 22, 2005; 280(29): 27345 - 27355.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Re, R. K. Thomas, K. Behringer, and V. Diehl
From Hodgkin disease to Hodgkin lymphoma: biologic insights and therapeutic potential
Blood, June 15, 2005; 105(12): 4553 - 4560.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. F. Muris, S. A. G. M. Cillessen, W. Vos, I. S. van Houdt, J. A. Kummer, J. H. J. M. van Krieken, N. M. Jiwa, P. M. Jansen, H. C. Kluin-Nelemans, G. J. Ossenkoppele, et al.
Immunohistochemical profiling of caspase signaling pathways predicts clinical response to chemotherapy in primary nodal diffuse large B-cell lymphomas
Blood, April 1, 2005; 105(7): 2916 - 2923.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
S. Poppema
Immunobiology and Pathophysiology of Hodgkin Lymphomas
Hematology, January 1, 2005; 2005(1): 231 - 238.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. S. Ricci, Z. Jin, M. Dews, D. Yu, A. Thomas-Tikhonenko, D. T. Dicker, and W. S. El-Deiry
Direct Repression of FLIP Expression by c-myc Is a Major Determinant of TRAIL Sensitivity
Mol. Cell. Biol., October 1, 2004; 24(19): 8541 - 8555.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Dutton, J. D. O'Neil, A. E. Milner, G. M. Reynolds, J. Starczynski, J. Crocker, L. S. Young, and P. G. Murray
Expression of the cellular FLICE-inhibitory protein (c-FLIP) protects Hodgkin's lymphoma cells from autonomous Fas-mediated death
PNAS, April 27, 2004; 101(17): 6611 - 6616.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
S. Mathas, A. Lietz, I. Anagnostopoulos, F. Hummel, B. Wiesner, M. Janz, F. Jundt, B. Hirsch, K. Johrens-Leder, H.-P. Vornlocher, et al.
c-FLIP Mediates Resistance of Hodgkin/Reed-Sternberg Cells to Death Receptor-induced Apoptosis
J. Exp. Med., April 19, 2004; 199(8): 1041 - 1052.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Schmitz, H. Weyd, A. Krueger, S. Baumann, S. C. Fas, P. H. Krammer, and S. Kirchhoff
Resistance of Short Term Activated T Cells to CD95-Mediated Apoptosis Correlates with De Novo Protein Synthesis of c-FLIPshort
J. Immunol., February 15, 2004; 172(4): 2194 - 2200.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. M. Maggio, A. van den Berg, D. de Jong, A. Diepstra, and S. Poppema
Low Frequency of FAS Mutations in Reed-Sternberg Cells of Hodgkin's Lymphoma
Am. J. Pathol., January 1, 2003; 162(1): 29 - 35.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
V. Diehl, H. Stein, M. Hummel, R. Zollinger, and J. M. Connors
Hodgkin's Lymphoma: Biology and Treatment Strategies for Primary, Refractory, and Relapsed Disease
Hematology, January 1, 2003; 2003(1): 225 - 247.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, R. K.
Right arrow Articles by Wolf, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, R. K.
Right arrow Articles by Wolf, J.


HOME