| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Internal Medicine I* andInstitute of Pathology, University of Cologne,Cologne, Germany; and the Department of AdultOncology, Dana-Farber Cancer Institute, andthe Department of Medicine, HarvardMedical School, Boston, Massachusetts
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
One downstream key player in CD95/Fas-mediated apoptosis is a protein that has recently been described as the cellular homologue of the viral protein v-Flip termed c-FLIP.7,8 A long and a short splice variant of c-FLIP protein are synthesized, c-FLIPl and c-FLIPs, respectively.8 In cells expressing high levels of c-FLIPl Fas-mediated apoptosis is blocked by inhibition of the recruitment of caspase-8 to the DISC, thus preventing its autoproteolytical cleavage and subsequent activation of downstream caspases.8,9 c-FLIP overexpression thereby causes resistance to Fas-mediated apoptosis in vitro and in vivo leading to the accumulation of autoreactive T cells and the development of autoimmune disease.10 Furthermore, high-level expression of the c-FLIP protein has recently been shown to contribute to a more aggressive phenotype of B lymphoma cells in vivo and could be correlated with tumor progression.11,12 More recently, evidence has emerged that c-FLIP plays a role in the regulation of apoptosis in naïve B cells.13,14 Current work suggests that c-FLIP may be the central factor for survival of germinal center (GC) B cells.15,16
Hodgkin/Reed-Sternberg (HRS) cells represent the malignant cell population in classical Hodgkin’s disease (cHD). In most cases, they derive from GC or post-GC B cells.17 Physiologically, B cells are selected for expression of high-affinity antibody (Ab) in the GC. GC B cells with self-reactive or low-affinity antibody die by CD95/Fas-mediated apoptosis, whereas cells that express immunoglobulin (Ig) with increased affinity for the corresponding antigen are stimulated to proliferate and exit the GC as memory B cells or plasma cells.18-20 In contrast, although HRS cells harbor rearranged Ig genes, they do not express a B cell receptor (BCR), partly because of crippling mutations in their somatically mutated Ig gene rearrangements leading to a nonfunctional rearrangement, or by loss of transcription factors important for Ig-transcription, namely Oct2 and Bob1.21-24 Thus, HRS cells are crippled GC B cells that physiologically are to be eliminated during the GC reaction. Instead, they survive, clonally expand, and lead to disseminated tumor growth and clonal relapse.25,26
Several studies have shown CD95/Fas expression by HRS cells.27,28 However, cultured HRS cells are resistant to Fas-mediated apoptosis.29 Mutations in the Fas gene occur only rarely in cHD and because these mutations are observed in GC B cells, too, it is likely that they merely reflect the GC origin of HRS cells.30,31 Consequently, it might be conceivable that the defect that rescues HRS cells from apoptosis in the GC is located downstream of the CD95/Fas receptor.
Here, we show that c-FLIP is expressed in the HRS cells in 18 of 19 primary cases of cHD. Using two Fas-resistant HD cell lines as a model, we also demonstrate significant c-FLIP expression and show that treatment with the protein synthesis inhibitor cycloheximide (CHX) fails to down-regulate c-FLIP protein. Consequently, the known Fas-sensitizing effect of CHX was not observed.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
L1236 is an Epstein-Barr virus (EBV)-negative cell line that has been derived from the HRS cells of a patient with mixed cellularity subtype of HD.32,33 L428 is an EBV-negative cell line.34 L428 cells are CD15- and CD30-positive and harbor clonally rearranged and mutated Ig genes, making a HRS cell derivation probable.35,36 Both cell lines are Fas-resistant, although they express wild-type Fas mRNA.29 The human T-lymphoblastic leukemia cell line Jurkat, known to be sensitive toward CD95/Fas-mediated apoptosis, served as a positive control in apoptosis assays. K562, a myeloid cell line derived from a patient with chronic myeloid leukemia during blast crisis is known to express c-FLIP.37 BJAB is a B cell lymphoma cell line that has been shown to down-regulate c-FLIP protein by incubation with CHX. All cell lines were grown in RPMI 1640 (Gibco, Karlsruhe, Germany) supplemented with 10% heat-inactivated fetal calf serum, penicillin (100 IU/ml), streptomycin (100 µg/ml), and glutamine (2 mmol/L) at 37°C in an atmosphere containing 5% CO2 under sterile conditions.
Induction of Apoptosis
For induction of apoptosis, cells were seeded in 24-well plates at a concentration of 5 x 105 cells/well, suspended in 1 ml of medium supplemented with various concentrations of a mouse anti-Fas monoclonal antibody (mAb) (clone CH11; Coulter Immunotech, Marseille, France) or an isotype-matched control mAb (mouse IgM; Alexis Corp., San Diego, CA). CHX (Sigma Aldrich, St. Louis, MO) was added, depending on the respective experiment. For dose finding of Fas-agonistic antibody, CH11 was used in the following concentrations: 50 ng/ml, 100 ng/ml, 200 ng/ml, and 500 ng/ml. In the subsequent experiments, CH11 was used at 100 ng/ml. For dose finding of CHX, the following concentrations were used: 1 µg/ml, 10 µg/ml, and 100 µg/ml. In the following analyses CHX was used at 10 µg/ml on L428 and L1236, and at 1 µg/ml for treatment of Jurkat cells. Cells were incubated overnight and apoptosis was measured after 24 hours of incubation, or at various time points, depending on the experiment performed.
Measurement of Apoptosis
Apoptosis was detected by fluorescence-activated cell sorting (FACS) analysis using phycoerythrin-coupled Annexin-V (Pharmingen, BD, Heidelberg, Germany) and Propidium iodide on a FACScan flow-cytometer (BD). Analyses were performed using CellQuest software (BD).
Western Blot
Cells were incubated with or without various doses of CHX. For extraction of proteins, 1 x 106 cells were harvested, washed twice in ice-cold phosphate-buffered saline, and then lysed in 50 µl of RIPA buffer. Forty µg of protein per slot were separated by discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the gel containing 10% acrylamide. After blotting onto nitrocellulose filters (Hybond C Extra; Amersham-Pharmacia, Freiburg, Germany), a 1-hour incubation with blocking reagent was done to inhibit unspecific binding of antibodies. The blots were incubated overnight with the polyclonal rabbit anti-human c-FLIPl antibody (raised against the C-terminus of human c-FLIPl protein, concentration 1:1000; Sigma) or with a monoclonal mouse anti-human actin antibody (Chemicon, Hofheim, Germany), to document equal loading of the gel. Subsequently, the blots were washed three times with Tris-buffered saline containing 0.05% Tween and a second goat anti-rabbit antibody coupled to horseradish peroxidase (concentration 1:2000; DAKO, Hamburg, Germany) was added. The Enhanced Chemiluminescence system (Amersham-Pharmacia) was used for development of the blots, according to the manufacturer’s instructions.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
mRNA was extracted from cultured cells using the µMacs mRNA Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany), following the recommendations of the manufacturer. cDNA synthesis was performed using an oligo-dT oligonucleotide and Superscript reverse transcriptase (Life Technologies, Karlsruhe, Germany). Oligonucleotides were intron-spanning to differentiate between amplificated genomic DNA and cDNA sequences; they were designed to hybridize to the 3'-end of the human c-FLIPl transcript (c-FLIP.S.: acagttcaccgagaagctgact; c-FLIP.AS.: tccttggcagaaactctgctgt). Amplification was performed in a 50-µl assay containing 50 mmol/L KCl, 2.5 mmol/L MgCl2, 200 µmol/L of each dNTP, and 25 pmol of each oligonucleotide. c-FLIP templates were amplified in 35 cycles of denaturation, annealing and synthesis (95°C for 30 seconds; 61°C for 30 seconds; 72°C for 60 seconds). After a final extension step at 72°C for 6 minutes, products were cooled to 10°C, analyzed by agarose gel electrophoresis, and visualized by ethidium bromide staining and UV light. Representative bands were excised, extracted using the Jetsorb kit (Genomed, Bad Oeynhausen, Germany), and directly sequenced using the Ready Reaction DyeTerminator cycle-sequencing kit (Perkin Elmer, Weiterstadt, Germany) on an automated sequencing apparatus (ABI 377, Applied Biosystems/Perkin Elmer). Sequences were compared to published c-FLIP sequences applying the BLAST software from the National Center for Biotechnology Information.
Pathological Specimen
Twenty-three primary cases of classical HD, two nonneoplastic
lymph nodes, and one specimen of striated muscle tissue infiltrated by
a B cell non-Hodgkin’s lymphoma were analyzed by immunohistochemistry.
All cases were classified according to the World Health Organization
classification and diagnoses were reviewed by the pathologist
reference panel of the German Hodgkin’s Lymphoma Study Group.
Characteristics are listed in Table 1
.
|
Formalin-fixed paraffin-embedded tissue sections and two nonneoplastic lymph nodes used as positive controls were stained. Rabbit-anti-human c-FLIP polyclonal antibody (Sigma), directed against the long isoform of c-FLIP or the monoclonal mouse anti-human CD30 antibody Ber-H2 (DAKO) were used in these experiments. Six-µm sections were mounted on glass slides, deparaffinized in xylene, rehydrated in graded alcohol, and washed in water. The slides were stained following standard procedures. The antibody reaction was detected using avidin-biotin-complex (ABC)-bound alkaline phosphatase (DAKO) and FastRed (DAKO) or NBT (Sigma) as chromogen. After immunostaining, slides were counterstained with hemalaun (Merck, Darmstadt, Germany). Sections from hyperplastic tonsils, striated muscle tissue, reactive lymph nodes containing GCs, and endothelial cells in all analyzed specimen served as external and internal positive controls, respectively. The percentage of c-FLIP-positive cells was estimated by comparing serial sections of most cases, stained either with an anti-CD30 mAb or the polyclonal anti-c-FLIP antibody. Four cases could not be evaluated because of lack of CD30-positive HRS cells in the control sections or overstaining, and were therefore categorized as "not informative." However, it cannot be excluded that the HRS cells in the "not informative" cases did not express c-FLIP protein. A case was categorized as + when 25 to 75% of HRS cells showed at least weak to moderate c-FLIP staining, as compared to CD30-positive cells. When 75 to 100% of HRS cells showed a moderate to strong staining, a case was categorized as ++.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The two HRS cell lines, L1236 and L428, and the T-cell leukemia
cell line Jurkat have recently been shown to express wild-type Fas mRNA
and protein.29
These cell lines were incubated with the
agonistic anti-Fas mAb CH11 or isotype control at concentrations
ranging from 50 to 500 ng/ml and apoptotic cells were determined after
24 hours using Annexin-V and propidium iodide staining. As shown in
Figure 1
, significant apoptosis was only
induced in Jurkat cells (mean ± SD = 80.5 ± 8.7% of
three independent experiments) whereas the portion of apoptotic cells
for L1236 and L428 did not differ significantly when cells were treated
with CH11 mAb or isotype control. These data clearly demonstrate that
the HRS cell lines L1236 and L428 are resistant to Fas-mediated
apoptosis.
|
To elucidate potential mechanisms for the observed Fas resistance
in HRS cells we studied the expression of c-FLIP by RT-PCR and Western
blotting. K562 cells and freshly isolated
CD77+-CD38+ GC B cells
served as positive controls. RT-PCR from L428, L1236, and controls
using intron-spanning c-FLIP-specific primers yielded a strong signal
of the expected size of 192 bp (Figure 2)
. Using identical PCR conditions,
attempts to amplify c-FLIP sequences from genomic DNA of L428 and L1236
cells failed because of a large intron between the two primer binding
sites (data not shown).
|
Blockage of Protein Synthesis in Fas-Resistant HRS Cell Lines by CHX Does Not Lead to Down-Regulation of c-FLIP Protein
To determine whether c-FLIP expression is normally regulated
in HRS cells, protein synthesis was blocked using CHX because CHX
blockade was recently described to down-regulate c-FLIP expression in
several cell lines.37
Western blot analyses of lysates of
cell lines L1236 and L428 were performed to study c-FLIP protein levels
in L428 and L1236 cells treated with doses from 1 to 10 µg/ml of CHX.
Cell lysates were prepared of L428 and L1236 cells at different time
points (0 hours, 12 hours, 24 hours) of CHX treatment and submitted to
Western blotting. Cell lysates prepared from BJAB cells served as
controls because down-regulation of c-FLIP by CHX in these cells has
been documented.38
Surprisingly, c-FLIP levels in both
L428 and L1236 cells remained unaltered throughout the whole time
period (24 hours) of CHX treatment whereas c-FLIP levels decreased in
BJAB cells at a CHX dose of 1 µg/ml (Figure 3)
. Augmentation of the CHX dose up to 10
µg/ml had no effect on c-FLIP protein levels in L428 and L1236 cells.
Thus, CHX fails to down-regulate anti-apoptotic c-FLIP protein in L428
and L1236 cells.
|
CHX is known to sensitize tumor cells to Fas-mediated
apoptosis.38,39
To test whether CHX treatment would
increase Fas-mediated apoptosis in HD cells, L1236 and L428 cells were
incubated with the Fas-agonistic mAb CH11 (100 ng/ml) or an isotype
control antibody in the presence of increasing concentrations of CHX.
Induction of apoptosis was assessed between 12 and 24 hours. As
expected, significant apoptosis was induced in the positive control
cell line Jurkat as early as 12 hours after treatment with the Fas
agonistic mAb in the presence of 1 µg/ml of CHX (82.4%; Figure 4
) and stayed similarly high throughout
the observation period (Figures 4 and 5)
.
Higher concentrations of CHX showed toxic effects as demonstrated by
increased apoptotic cells in the isotype control cultures
(data not shown). In contrast, neither L1236 nor L428 showed a
significant increase in the percentage of apoptotic cells compared to
incubation with isotype control mAb under these experimental conditions
(data not shown). Only when increasing the concentration of CHX to 10
µg/ml did the number of apoptotic L428 cells increase to 35.1% at 12
hours and 58.9% at 24 hours (Figures 4 and 5)
. L1236 were still
insensitive to Fas-mediated apoptosis under these conditions. Further
increasing the concentration of CHX revealed a toxic effect
because apoptotic cells increased similarly in the isotype
control cultures. Thus, Fas-mediated apoptosis is not induced in L1236
and shows a delayed onset and is of much lower magnitude in L428 cells
as compared to Jurkat cells after blocking protein synthesis with CHX.
|
|
While demonstrating expression and altered regulation of c-FLIP in
HD cell lines it was critical to demonstrate expression of c-FLIP
protein in primary HRS cells by immunohistochemistry. Of the 19
informative cases (see Materials and Methods), 11 cases showed a strong
cytoplasmic c-FLIP staining in more than 75% of the HRS cells (Figure 6)
, whereas 7 showed a positive
cytoplasmic staining in 25 to 75% of HRS cells. Only one case was
found to be negative for c-FLIP protein expression. No correlation was
found between histological subtype, clinical characteristics, and
c-FLIP expression levels (data not shown). As expected, GC B cells in
hyperplastic tonsils and in reactive lymph nodes, striated muscle
cells, as well as vascular endothelial cells in the diseased tissue
were also positive, thereby demonstrating sensitivity and specificity
of the immunohistochemistry procedure used. Thus, c-FLIP protein was
synthesized by HRS cells of HD-involved tissue in 18 of 19 informative
cases analyzed.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The normal counterparts of HRS cells, namely GC B cells, have recently been demonstrated to enter the GC with an activated apoptosis program.15,16 Activation of the Fas pathway and subsequent clustering of the DISC seem to be critical events in this process. Although it is clearly demonstrated that HRS cells derive from crippled GC B cells, the mechanisms by which these cells are prevented from apoptotic elimination remain elusive. The high-level expression of c-FLIP in HRS cells might play a central role because other mechanisms of inactivation of the CD95/Fas pathway such as mutation or deletion of the CD95/Fas receptor do not seem to be a dominant feature of HRS cells.29-31 p53 mutations or bcl-2 rearrangements in HRS cells, both of which could explain Fas resistance have also not been closely associated with the pathogenesis of HD.40,41
Although both HD cell lines tested showed high levels of c-FLIP expression, and a stringent correlation between Fas resistance and c-FLIP protein levels was eminent in L1236 cells, we were able to demonstrate a residual but delayed Fas sensitivity of L428 cells, however only when challenged with close to toxic concentrations of CHX. It is therefore not ruled out that additional unknown pathways also contribute to resistance to apoptosis in HD.
Whether the dissociation of c-FLIP regulation in HRS cells is because of exogenous or endogenous signals will be an important question for further investigation. Because c-FLIP levels in isolated GC B cells decrease rapidly after the isolation procedure, a stimulatory surrounding might be essential for the maintenance of c-FLIP levels. Survival of GC B cells is restricted to those cells that bear high-affinity BCR on their cell surface. Because HRS cells do not present a BCR on their cell surface, c-FLIP protein expression in these cells is likely disconnected from this physiological regulatory pathway. Another exogenous signal could be delivered via CD40. Primary HRS cells express CD40 in most if not all cases and are surrounded by CD40L-expressing T cells.42,43 One might therefore argue that the CD40 pathway is active in at least primary HRS cells. Indeed, normal human and murine B cells up-regulate c-FLIP on stimulation via the BCR and CD40.13-15 However in normal primary human B cells c-FLIP expression on separate or concomitant CD40 and BCR signaling is transient and begins to disappear after 24 hours of stimulation.14 In the absence of BCR expression on HRS cells and CD40L in the culture system, an autocrine signaling loop leading to prolonged c-FLIP expression through chronic stimulation can be excluded.42,43 Therefore, other mechanisms must account for the high-level expression in up to 100% of primary HRS cells demonstrated here.
Constitutive NF
B expression by HRS cells could explain activation of
HRS cells that are destined to die.44,45
IB
mutations in primary and cultured HRS cells have been reported and
might underlie activation of NFB in a minority of cases, rescuing
the HRS cells from programmed cell death.46,47
However, a
percentage of cases remains for which the causes of apoptosis
resistance have to be elucidated. NFB activation may be explained by
IB mutations or by Epstein-Barr virus-encoded latent membrane
proteins (LMP1 and LMP2a). Because c-FLIP is also a potent NFB
activator, it is tempting to speculate that this represents a putative
mechanism for constitutive NFB expression.48
The
precise interaction, however, between c-FLIP and NFB in HRS cells
remains to be elucidated.
In summary, we demonstrate constitutive expression of anti-apoptotic c-FLIP protein in a panel of primary cHD cases. Furthermore, we demonstrate the failure of two Fas-resistant HRS cell lines to down-regulate c-FLIP in response to CHX treatment. We conclude that constitutive c-FLIP expression may be a central mechanism rescuing HRS cells from Fas-mediated apoptosis.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Deutsche Forschungsgemeinschaft SFB 502, TP1; and Köln Fortune (doctoral fellowship to A. K.).
R. K. T. and A. K. both contributed equally to this work.
Accepted for publication January 18, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. Ganapathy, R. Ghosh, X. Jianping, X. Zhang, R. Bedolla, J. Schoolfield, I-T. Yeh, D. A. Troyer, A. F. Olumi, and A. P. Kumar Involvement of FLIP in 2-Methoxyestradiol-Induced Tumor Regression in Transgenic Adenocarcinoma of Mouse Prostate Model Clin. Cancer Res., March 1, 2009; 15(5): 1601 - 1611. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Kapatai and P Murray Contribution of the Epstein Barr virus to the molecular pathogenesis of Hodgkin lymphoma J. Clin. Pathol., December 1, 2007; 60(12): 1342 - 1349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. A. Mawji, C. D. Simpson, R. Hurren, M. Gronda, M. A. Williams, J. Filmus, J. Jonkman, R. S. Da Costa, B. C. Wilson, M. P. Thomas, et al. Critical Role for Fas-Associated Death Domain-Like Interleukin-1-Converting Enzyme-Like Inhibitory Protein in Anoikis Resistance and Distant Tumor Formation J Natl Cancer Inst, May 16, 2007; 99(10): 811 - 822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kashkar, A. Deggerich, J.-M. Seeger, B. Yazdanpanah, K. Wiegmann, D. Haubert, C. Pongratz, and M. Kronke NF-{kappa}B-independent down-regulation of XIAP by bortezomib sensitizes HL B cells against cytotoxic drugs Blood, May 1, 2007; 109(9): 3982 - 3988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kashkar, J.-M. Seeger, A. Hombach, A. Deggerich, B. Yazdanpanah, O. Utermohlen, G. Heimlich, H. Abken, and M. Kronke XIAP targeting sensitizes Hodgkin lymphoma cells for cytolytic T-cell attack Blood, November 15, 2006; 108(10): 3434 - 3440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. Thomas, M. L. Sos, T. Zander, O. Mani, A. Popov, D. Berenbrinker, S. Smola-Hess, J. L. Schultze, and J. Wolf Inhibition of Nuclear Translocation of Nuclear Factor-{kappa}B Despite Lack of Functional I{kappa}B{alpha} Protein Overcomes Multiple Defects in Apoptosis Signaling in Human B-Cell Malignancies Clin. Cancer Res., November 15, 2005; 11(22): 8186 - 8194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Re, R. Kuppers, and V. Diehl Molecular Pathogenesis of Hodgkin's Lymphoma J. Clin. Oncol., September 10, 2005; 23(26): 6379 - 6386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Boll, H. Hansen, F. Heuck, K. Reiners, P. Borchmann, A. Rothe, A. Engert, and E. Pogge von Strandmann The fully human anti-CD30 antibody 5F11 activates NF-{kappa}B and sensitizes lymphoma cells to bortezomib-induced apoptosis Blood, September 1, 2005; 106(5): 1839 - 1842. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Poukkula, A. Kaunisto, V. Hietakangas, K. Denessiouk, T. Katajamaki, M. S. Johnson, L. Sistonen, and J. E. Eriksson Rapid Turnover of c-FLIPshort Is Determined by Its Unique C-terminal Tail J. Biol. Chem., July 22, 2005; 280(29): 27345 - 27355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Re, R. K. Thomas, K. Behringer, and V. Diehl From Hodgkin disease to Hodgkin lymphoma: biologic insights and therapeutic potential Blood, June 15, 2005; 105(12): 4553 - 4560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. F. Muris, S. A. G. M. Cillessen, W. Vos, I. S. van Houdt, J. A. Kummer, J. H. J. M. van Krieken, N. M. Jiwa, P. M. Jansen, H. C. Kluin-Nelemans, G. J. Ossenkoppele, et al. Immunohistochemical profiling of caspase signaling pathways predicts clinical response to chemotherapy in primary nodal diffuse large B-cell lymphomas Blood, April 1, 2005; 105(7): 2916 - 2923. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Poppema Immunobiology and Pathophysiology of Hodgkin Lymphomas Hematology, January 1, 2005; 2005(1): 231 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Ricci, Z. Jin, M. Dews, D. Yu, A. Thomas-Tikhonenko, D. T. Dicker, and W. S. El-Deiry Direct Repression of FLIP Expression by c-myc Is a Major Determinant of TRAIL Sensitivity Mol. Cell. Biol., October 1, 2004; 24(19): 8541 - 8555. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Dutton, J. D. O'Neil, A. E. Milner, G. M. Reynolds, J. Starczynski, J. Crocker, L. S. Young, and P. G. Murray Expression of the cellular FLICE-inhibitory protein (c-FLIP) protects Hodgkin's lymphoma cells from autonomous Fas-mediated death PNAS, April 27, 2004; 101(17): 6611 - 6616. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mathas, A. Lietz, I. Anagnostopoulos, F. Hummel, B. Wiesner, M. Janz, F. Jundt, B. Hirsch, K. Johrens-Leder, H.-P. Vornlocher, et al. c-FLIP Mediates Resistance of Hodgkin/Reed-Sternberg Cells to Death Receptor-induced Apoptosis J. Exp. Med., April 19, 2004; 199(8): 1041 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Schmitz, H. Weyd, A. Krueger, S. Baumann, S. C. Fas, P. H. Krammer, and S. Kirchhoff Resistance of Short Term Activated T Cells to CD95-Mediated Apoptosis Correlates with De Novo Protein Synthesis of c-FLIPshort J. Immunol., February 15, 2004; 172(4): 2194 - 2200. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Maggio, A. van den Berg, D. de Jong, A. Diepstra, and S. Poppema Low Frequency of FAS Mutations in Reed-Sternberg Cells of Hodgkin's Lymphoma Am. J. Pathol., January 1, 2003; 162(1): 29 - 35. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Diehl, H. Stein, M. Hummel, R. Zollinger, and J. M. Connors Hodgkin's Lymphoma: Biology and Treatment Strategies for Primary, Refractory, and Relapsed Disease Hematology, January 1, 2003; 2003(1): 225 - 247. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, Jurkat,
1 µg/ml CHX, 100 ng/ml isotype; 
, Jurkat, 1 µg/ml CHX, 100 ng/ml
CH11; 
, L428, 10 µg/ml CHX, 100 ng/ml isotype; 
, L428, 10
µg/ml CHX, 100 ng/ml CH11; 
, L1236, 10 µg/ml CHX, 100 µg/ml
isotype; •, L1236, 10 µg/ml CHX, 100 ng/ml CH11.
