| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |



From the Division of Nephrology,*Baylor College of Medicine, Houston, Texas; the Division of Nephrology,
University of Washington, Seattle, Washington; and the Division of Nephrology,
Ewha Womens University College of Medicine, Ewha Medical Research Center, Seoul, Korea
| Abstract |
|---|
|
|
|---|
Recently an important role for nitric oxide (NO) has been shown in progressive renal disease.6-9 Specifically, Fujihara et al6 reported that inhibition of nitric oxide (NO) accelerates renal progression in the remnant kidney model. The mechanism responsible for the worsening of renal disease by NO inhibition is not known, but may relate to the increased systemic and glomerular blood pressure in these rats.6 The increase in blood pressure observed with NO inhibition results from both loss of NO and increased angiotensin II and endothelin-1,10,11 and is likely to have as a primary target the vascular endothelium. In addition to pressure-related vascular injury, NO is a major trophic and survival factor for endothelium, and a decrease in local NO could also potentiate endothelial cell loss by both increasing endothelial cell apoptosis and by decreasing endothelial cell proliferation and repair.12-14 Indeed, we have recently documented a critical role for NO in mediating endothelial cell integrity in a rat model of thrombotic microangiopathy.15
Given the importance of the endothelium in progressive renal disease and the critical role of NO in maintaining its integrity, we hypothesized that blockade of NO synthesis in the remnant kidney model would be associated with more severe endothelial cell loss and that this would correlate with both the deterioration in renal function and with the severity of the renal injury. We now report that inhibition of NO synthesis markedly accelerates progression in association with impairment of the angiogenic response and loss of the capillary endothelium which is greater than expected for the increase in systolic blood pressure, suggesting the important role of NO in maintaining renal microvasculature. We also found a marked difference in the response of the preglomerular arterial (macrovascular) endothelium when compared to the microvascular endothelium. In contrast to the loss of the capillary endothelium that occurs with blockade of NO synthesis in the remnant kidney model, the preglomerular arterial endothelium remained preserved, possibly due to a pronounced proliferation of adjacent vascular smooth muscle cells with local expression of VEGF.
| Materials and Methods |
|---|
|
|
|---|
All animal procedures were approved by the Animal Care Committee of the University of Washington. Male Sprague-Dawley rats (weight 200240 g) underwent baseline measurement of blood pressure and renal function, and underwent a remnant kidney (RK) operation. The RK operation was performed by a right subcapsular nephrectomy and surgical resection of the upper and lower thirds of the left kidney. Four weeks after the RK operation, blood pressure and renal function were measured, and the animals were divided into three groups. Group 1 (n = 6) received no specific therapy; group 2 (n = 6) received L-arginine (1 g/dl in the drinking water, Sigma Chemical, St Louis, MO); and group 3 (n = 7) received L-NAME (5 mg/dl in the drinking water, Sigma Chemical), all for 4 weeks. These three groups were also compared with a historic group of control RK rats (n = 6) that had systolic blood pressure equivalent to those present in the L-NAME-treated RK rats.3,4
Animals were fed a standard laboratory diet and water ad libitum, and the amount of daily water and diet intake was measured. Mean daily drug intake in RK+L-NAME and RK+L-arginine group was 6.6 ± 1.4 mg/kg/day and 1.23 ± 0.24 g/kg/day, respectively. This resulted in a significant reduction in urinary nitrate/nitrite excretion measured in RK+L-NAME rats by the modified Griess reaction 4 (74 ± 28 vs. 135 ± 75 pmol/day, RK+L-NAME vs. RK alone, P < 0.05) whereas no significant changes were noted in the RK+L-arginine group (210 ± 105 pmol/day).
Renal Morphological Assessment
Tissue was fixed in methyl Carnoys solution, paraffin-embedded, sectioned (4-µm), and stained with periodic acid Schiff (PAS) reagent or by indirect immunoperoxidase as reported previously.16
Endothelial cells were detected with monoclonals JG-12 (gift of D. Kerjaschki, Univeristy of Vienna, Austria) and RECA-1 (Serotec, Indianapolis, IN); VEGF with rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA);
-smooth muscle actin with mouse monoclonal
-SM-1 (Sigma, St. Louis, MO), collagen type III with goat anti-human antibody (Southern Biotechnology, Birmingham, AL), osteopontin with goat anti-osteopontin antibody 199 (gift from C. Giachelli, University of Washington, Seattle, WA); and monocyte-macrophages with mouse monoclonal antibody ED-1 (Serotec, Indianapolis, IN). Controls included omitting the primary antibody and substitution of the primary antibody with pre-immune rabbit or mouse serum.
To examine whether there is any evidence of endothelial or smooth muscle proliferation, double immunostaining was performed with
-smooth muscle cell actin and an antibody to the proliferating cell nuclear antigen (PCNA) (PC 10, Cappel, Aurora, OH). Tissue sections were first incubated with PCNA antibody overnight at 4°C, followed sequentially by biotinylated horse anti-mouse IgG serum, peroxidase-conjugated avidin D, and color development with diaminobenzidine (DAB) with nickel chloride. After incubation in 3% H2O2 for 8 minutes to eliminate any remaining peroxidase activity, sections were incubated with primary antibody for
-smooth muscle cell actin for 3 hours at room temperature, followed by biotinylated horse anti-mouse IgG for 30 minutes at room temperature. After incubation in alkaline phosphatase streptavidin (Vector, Burlingame, CA), color was developed using AP-RED substrate kit (Zymed, San Francisco, CA).
All quantification was performed blinded. The numbers of endothelial and smooth muscle cells were counted in the afferent arteriole, interlobular artery, and arcuate artery. Vessels which were not sectioned transversally, providing an asymmetrical wall, were excluded from the present study. To assess smooth muscle cell hypertrophy and/or hyperplasia, the cross-sectional wall area and thickness of each artery was measured by computer image analysis (Optimas 6.2, Media Cybernetics, Silver Spring, MD). Arteries and arterioles were identified by their anatomical location and branching pattern from neighboring vessels, and shape of endothelial and smooth muscle cells described elsewhere.17 Considering the continuous tapering course of interlobular artery, we evaluated the interlobular artery at the same level (proximal one-third from corticomedullary junction) of individual kidneys. Afferent arterioles were carefully distinguished from efferent arteriole by their general characteristics, including the presence of thin and continuous endothelial cells with a thicker smooth muscle wall than the efferent arteriole.17
The number of glomerular capillary loops, glomerular capillary density, peritubular capillary rarefaction index, and density were assessed.3,4 The percent glomerulosclerosis and tubulointerstitial fibrosis score05 were evaluated based on PAS staining previously described.16 The degree of osteopontin expression and type III collagen deposition was determined by computer image analysis of complete sagittal sections.16
In Vitro Studies
Murine thick ascending limb cells (mTAL) (gift of K. Madsen, University of Florida, Gainesville, FL) and rat vascular smooth muscle cells (SMC) (American Type Culture Collection (CRL-2018)) were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS), gentamicin (G418, 50 mg/ml) and L-glutamine. After cells were grown to 70% confluency in multi-well plates (Becton Dickinson, Franklin Lakes, NJ), the culture medium was changed into serum-free media for 24 hours before each experiment. After synchronization of cell growth, cells were washed three times with Hanks Balanced Salt Solution (HBSS) and exposed to L-NAME (2 mmol/L) (Sigma, St. Louis, MO) for 1, 4, 8, and 24 hours. All experiments were also conducted under hypoxic condition to simulate in vivo condition since the normal pO2 in the renal medulla is 2030 mmHg18 and the microvascular loss in the RK model can result in tissue hypoxia and/or ischemia. To achieve hy-poxia, cells with or without L-NAME were incubated in a GasPak anaerobic culture pouch (BBL Microbiology Systems, Kansas City, MO), resulting in partial pressure of oxygen (PaO2) of 2530 mmHg for hypoxic conditions compared to 120130 mmHg in normoxic conditions in the culture medium.3 These conditions did not result in any loss of cell viability as measured by lactate dehydrogenase (LDH) assay (Sigma, St. Louis, MO).
To quantify the level of VEGF protein secretion under the different conditions, VEGF protein was measured in cell culture supernatants using a commercial murine ELISA kit for VEGF (R & D Systems, Minneapolis, MN) which is sensitive to 3 pg/ml. Interassay coefficient of variation is <7% and the intra-assay coefficient of variation is <5% among the standards. All data for VEGF production detected by ELISA are expressed as pg/105 cells.
Generation of Mouse and Rat VEGF Riboprobes for RNase Protection Assay (RPA)
Mouse VEGF Probe
An anti-sense primer (GCGAATTCTATCTCGTCGTCGGGGTACTC, BamHI site is incorporated at the 5'end with three extra nucleotides to guarantee restriction enzyme digestion) and T7 primer (sense primer) were used for polymerase chain reaction (PCR) with a plasmid DNA containing mouse VEGF as a template (the contained VEGF cDNA region is from bp 1 to 290 of NM 009505). The PCR fragment of mouse VEGF was inserted into the pCR-II-TOPO with the TA cloning kit (Invitrogen, CA). After linearization with HindIII, an anti-sense riboprobe was synthesized with T7 RNA polymerase in the presence of [32]P-labeled UTP.
Rat VEGF Probe
The rat VEGF probe (1327 of a EST clone, AA850734) was generated by PCR and subcloned into pGEM4 Z with 3'end toward T7 promoter. After linearization with an appropriate restriction enzyme, an anti-sense riboprobe was synthesized with T7 polymerase in the presence of [32]P-labeled UTP.
RNA Isolation and RPA
Following incubation with L-NAME under normoxic and hypoxic conditions, total RNA was prepared from the mTAL cell and rat vascular SMC monolayers using the RNeasy96 total RNA isolation protocol manufactured by Qiagen (Valencia, CA). After determination of RNA purity and concentration by spectrophotometry, 2 µg of RNA samples were hybridized for 30 minutes at 90°C with a mixture of [32]P-UTP labeled riboprobe and the housekeeping gene (L32) (1 x 105 cpm for each probe), and RPA was performed as described previously using a RPA kit19 (Torrey Pines Biolabs, Houston, TX) according to the manufacturers instruction. The protected hybridized RNA was denatured at 85°C and electrophoresed on 10% polyacrylamide gels. The gels were transferred to 3 mol/L Whatman filter paper, dried, and exposed to Kodak X-O mat film overnight at -70°C.
Statistical Analysis
All data are presented as mean ± standard deviation (SD). Differences in the various parameters between groups were evaluated by unpaired comparisons for non-parametric data. Differences in parameters at each time point after RK surgery were compared by paired t-test. The relation between variables was assessed by Pearson correlation analysis. Significance was defined as a P value <0.05.
| Results |
|---|
|
|
|---|
|
|
L-NAME treatment was associated with more severe endothelial cell loss than that observed with RK alone, with a greater loss of glomerular capillary loops and more peritubular capillary rarefaction (Table 2)
. L-NAME-treated rats also had significantly less capillary endothelial cell proliferation.
|
|
Effects on the Preglomerular (Arterial) Vasculature
While endothelial cell loss characterized the glomerular and postglomerular vasculature, the endothelium in the preglomerular vessels (afferent arteriole and more proximal vessels) in the RK rats was preserved in association with a significant increase in the vascular smooth muscle cell layer (Figure 3)
. There was no significant difference in endothelial cell number in afferent arteriole, interlobular or arcuate artery between RK vs. RK+L-NAME rats (Table 3)
. However, the number of proliferating endothelial cells was higher in arterioles and arteries of RK rats administered L-NAME (Table 4)
in contrast to less endothelial cell proliferation of both glomerular and peritubular capillaries in RK+L-NAME rats. In occasional vessels, nests of proliferating endothelial cells were apparent, which rarely resulted in an obliterative arteriopathy (Figure 4, F)
.
|
|
|
|
|
|
Consistent with our prior study,3
we documented a loss in VEGF expression in both podocytes and in tubular epithelial cells in the RK model, but there was no significant difference among groups in the percent positive area of VEGF expression by immunostaining as assessed by computer image analysis (4.2 ± 1.8 vs. 4.3 ± 1.5 vs. 4.1 ± 1.2%, RK vs. RK+L-arginine vs. RK+L-NAME) or Western blotting (data not shown). However, in L-NAME-treated RK rats, arteriolar SMC showed de novo staining of VEGF, which contrasted with the uniformly negative staining for VEGF in smooth muscle cells of control or L-arginine-treated RK rats (Figure 7, A and B)
.
|
In mTAL cells, L-NAME inhibited VEGF mRNA expression, whereas, in rat vascular SMC, L-NAME increased VEGF expression under hypoxic but not normoxic conditions (Figure 7, C and D)
consistent with the in vivo finding which showed de novo expression of VEGF in SMC of RK+L-NAME rats. The VEGF protein levels in the supernatant of cultured cells as measured by ELISA were consistent with the changes in VEGF mRNA expression (Figure 7, E and F)
. L-NAME treatment of rat vascular SMC resulted in a 2.1-fold increase in VEGF protein secretion under hypoxic conditions whereas L-NAME decreased VEGF protein levels in mTAL cells.
| Discussion |
|---|
|
|
|---|
In this study we examined the changes in endothelial cells that occur in the remnant kidney model in which NO synthesis was stimulated or blocked. Our hypothesis was that endothelial cell injury would be more severe in those rats with NOS blockade due to higher systemic and glomerular pressure leading to greater vascular injury, which could be protected by the stimulation of NO synthesis. More importantly, we also hypothesized that a lack of NO itself might lead to endothelial cell loss, as NO is an endothelial cell survival factor and is important in angiogenesis.12-14 A lack of NO may also accelerate endothelial loss by blocking VEGF action, as NO is required for VEGF-dependent endothelial cell proliferation.12,13 In a recent study, we documented that blocking NO synthesis markedly increases endothelial cell death and worsens renal disease in a model of thrombotic microangiopathy.14
Consistent with the study by Fujihara et al,6 we found that blockade of NO synthesis with L-NAME in the remnant kidney model resulted in higher systemic blood pressure, greater proteinuria, worse renal function, and more severe glomerulosclerosis. We also documented worse interstitial fibrosis with greater tubular osteopontin expression, macrophage infiltration, and type III collagen deposition.
Our first new finding was that blockade of NO synthesis was associated with significantly greater glomerular and peritubular capillary endothelial cell loss in association with a reduced endothelial proliferative response. The loss of the glomerular capillary endothelium may predispose to glomerular capillary loop collapse and glomerulosclerosis,2,17 whereas a loss of the peritubular capillary endothelium could impair oxygen delivery to the tubules which would accentuate ischemic injury and stimulate fibrosis.5 Consistent with these findings, we found a close correlation between the microvascular endothelial cell loss and the degree of glomerulosclerosis (r2 = 0.79, P < 0.05) and tubulointerstitial fibrosis (r2 = 0.78, P < 0.05). These studies are consistent with a critical role for the microvasculature in progressive renal disease.
The loss of the endothelium could be secondary to pressure-mediated injury. However, when a historical control group of remnant kidney rats3,4 were compared to L-NAME-treated RK rats with similar blood pressures (178.3 ± 21.8 vs. 175.7 ± 45.9 mmHg), there was significantly greater glomerular and peritubular capillary loss in the L-NAME-treated rats, suggesting the presence of some blood pressure-independent microvascular injury by NOS blockade. This would be consistent with an additional direct effect of NO as an endothelial cell survival and trophic factor.12-15 An antiangiogenic effect of NOS inhibition has been reported in tumor tissue.14 Ziche et al23 also observed that VEGF-induced angiogenesis was blocked by systemic administration of L-NAME using a rabbit corneal pocket assay.
An interesting contrast was the observation that the preglomerular arterial endothelium was preserved or hyperplastic in L-NAME-treated remnant kidney rats. The preglomerular arterial vessels also showed an increase in the number of total and proliferating smooth muscle cells and an increase in medial wall thickness, a finding consistent with vascular changes associated with hypertension24
and which could also be a consequence of the loss of NO which normally has an inhibitory effect on SMC growth.25
The vascular changes are also consistent with previous studies that have documented medial wall thickening with lipid accumulation and inflammatory changes in the preglomerular vasculature of L-NAME-treated animals.26,27
Interestingly, these changes in preglomerular vessels were also not solely a consequence of an elevation in systemic blood pressure (Figure 6)
as evidenced by more prominent vascular changes (SMC hyperplasia and medial wall thickening) in preglomerular vessels of L-NAME-treated RK rats when compared to RK rats with similar systemic blood pressure. Similarly, the development of the arteriolopathy induced by L-NAME administration has been shown to be independent of blood pressure in normal Wistar rats.28
To better understand the potential mechanisms for the differential response of the preglomerular and microvascular endothelium, we studied the expression and regulation of VEGF, which we have previously found has a key role in maintaining microvascular endothelial cell integrity in the remnant kidney model.3,4 We found that inhibition of NO synthesis blocked VEGF expression in tubules (mTAL cells) under hypoxic conditions, whereas VEGF was up-regulated in hypoxic smooth muscle cells under similar conditions. Consistent with these in vitro findings, we found up-regulated expression of VEGF in the media of preglomerular vessels in L-NAME-treated rats with remnant kidneys whereas arteries in control remnant kidney rats showed minimal expression. It is unclear if this up-regulated VEGF in the media is responsible for maintaining the preglomerular arterial endothelium, however, as numerous studies suggest that the angiogenic effects of VEGF depend on an intact NO system.13,23 Nevertheless, it seems likely that growth factors expressed by the arterial smooth muscle cells may have a role in maintaining survival of the adjacent endothelium29 whereas decreased VEGF expression in renal tubular cells by NOS blockade may contribute to PTC loss via reducing endothelial cell survival signals. This differential regulation of NO inhibition on VEGF expression in tubular cells versus vascular SMC is similar to that which has recently been reported with angiotensin II.30,31 Thus, angiotensin II stimulates VEGF in vascular SMCs but inhibits VEGF in mTAL cells. These studies underscore the importance of considering the different intrarenal compartments when considering the progression of renal disease.
We were not able to confirm the previous report that L-arginine slows progression in the RK model. This may relate to difference in timing and dose of the L-arginine. The level of urinary nitrite/nitrate was higher in the RK+L-arginine group compared to RK rats, but it was not statistically significant. A possible explanation for an inability of L-arginine to provide benefit in our RK model may be related to chronic renal failure per se, as NOS is profoundly decreased at 4 weeks after renal mass reduction,32 and therefore providing substrate may not be effective in this specific model of progressive renal disease. This finding is consistent with a human study by DeNicola et al,33 who was unable to show enhanced NO generation in response to L-arginine in patients with chronic renal disease. They also did not observe any improvement in proteinuria, renal function, or blood pressure after L-arginine treatment. It is possible that starting the L-arginine administration earlier (before the significant decrease in NOS) or treatment with an NO donor rather than with the physiological NO precursor9 might be a more effective way to prevent progressive renal disease.
Inhibition of NO synthesis has been known to exacerbate renal disease in the RK model by hemodynamic changes. Our study supports the hypothesis that blood pressure-independent vascular changes induced by NOS blockade may be an additional mechanism for progression of renal disease. Inhibition of NO synthesis was associated with significant loss of the microvasculature and with an impairment in local angiogenesis. NO blockade also was associated with more severe preglomerular vascular disease. Both of these effects could provide a mechanism for inducing renal ischemia with the stimulation of renal scarring. Furthermore, both effects could not be attributed to the higher blood pressure in the rats in which NO synthesis was blocked. Thus, these studies suggest that the maintenance of adequate NO may be an additional mechanism for the preservation of the renal vasculature in progressive renal disease.
| Footnotes |
|---|
Supported by National Institutes of Health grant RO1 DK52121 (to R.J.J.) and an Intramural Research Grant of Ewha Womens University (to D-H.K.).
Accepted for publication April 15, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Shibata, S. Ueda, S.-i. Yamagishi, Y. Kaida, Y. Matsumoto, K. Fukami, A. Hayashida, H. Matsuoka, S. Kato, M. Kimoto, et al. Involvement of asymmetric dimethylarginine (ADMA) in tubulointerstitial ischaemia in the early phase of diabetic nephropathy Nephrol. Dial. Transplant., April 1, 2009; 24(4): 1162 - 1169. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakayama, W. Sato, T. Kosugi, L. Zhang, M. Campbell-Thompson, A. Yoshimura, B. P. Croker, R. J. Johnson, and T. Nakagawa Endothelial injury due to eNOS deficiency accelerates the progression of chronic renal disease in the mouse Am J Physiol Renal Physiol, February 1, 2009; 296(2): F317 - F327. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yuzawa, I. Niki, T. Kosugi, S. Maruyama, F. Yoshida, M. Takeda, Y. Tagawa, Y. Kaneko, T. Kimura, N. Kato, et al. Overexpression of Calmodulin in Pancreatic {beta} Cells Induces Diabetic Nephropathy J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1701 - 1711. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Stoessel, A. Paliege, F. Theilig, F. Addabbo, B. Ratliff, J. Waschke, D. Patschan, M. S. Goligorsky, and S. Bachmann Indolent course of tubulointerstitial disease in a mouse model of subpressor, low-dose nitric oxide synthase inhibition Am J Physiol Renal Physiol, September 1, 2008; 295(3): F717 - F725. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa, M. Segal, B. Croker, and R. J. Johnson A breakthrough in diabetic nephropathy: the role of endothelial dysfunction Nephrol. Dial. Transplant., October 1, 2007; 22(10): 2775 - 2777. [Full Text] [PDF] |
||||
![]() |
A. Advani, D. J. Kelly, S. L. Advani, A. J. Cox, K. Thai, Y. Zhang, K. E. White, R. M. Gow, S. M. Marshall, B. M. Steer, et al. Role of VEGF in maintaining renal structure and function under normotensive and hypertensive conditions PNAS, September 4, 2007; 104(36): 14448 - 14453. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa Uncoupling of the VEGF-endothelial nitric oxide axis in diabetic nephropathy: an explanation for the paradoxical effects of VEGF in renal disease Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1665 - F1672. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Schmieder, C. Delles, A. Mimran, J. P. Fauvel, and L. M. Ruilope Impact of Telmisartan Versus Ramipril on Renal Endothelial Function in Patients With Hypertension and Type 2 Diabetes Diabetes Care, June 1, 2007; 30(6): 1351 - 1356. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsumoto, S. Ueda, S.-i. Yamagishi, K. Matsuguma, R. Shibata, K. Fukami, H. Matsuoka, T. Imaizumi, and S. Okuda Dimethylarginine Dimethylaminohydrolase Prevents Progression of Renal Dysfunction by Inhibiting Loss of Peritubular Capillaries and Tubulointerstitial Fibrosis in a Rat Model of Chronic Kidney Disease J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1525 - 1533. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Sanchez-Lozada, E. Tapia, R. Lopez-Molina, T. Nepomuceno, V. Soto, C. Avila-Casado, T. Nakagawa, R. J. Johnson, J. Herrera-Acosta, and M. Franco Effects of acute and chronic L-arginine treatment in experimental hyperuricemia Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1238 - F1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa, W. Sato, O. Glushakova, M. Heinig, T. Clarke, M. Campbell-Thompson, Y. Yuzawa, M. A. Atkinson, R. J. Johnson, and B. Croker Diabetic Endothelial Nitric Oxide Synthase Knockout Mice Develop Advanced Diabetic Nephropathy J. Am. Soc. Nephrol., February 1, 2007; 18(2): 539 - 550. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O'Riordan, N. Mendelev, S. Patschan, D. Patschan, J. Eskander, L. Cohen-Gould, P. Chander, and M. S. Goligorsky Chronic NOS inhibition actuates endothelial-mesenchymal transformation Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H285 - H294. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E.J. Reinders, T. J. Rabelink, and D. M. Briscoe Angiogenesis and Endothelial Cell Repair in Renal Disease and Allograft Rejection J. Am. Soc. Nephrol., April 1, 2006; 17(4): 932 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. I. Feig, M. Mazzali, D.-H. Kang, T. Nakagawa, K. Price, J. Kannelis, and R. J. Johnson Serum Uric Acid: A Risk Factor and a Target for Treatment? J. Am. Soc. Nephrol., April 1, 2006; 17(4_suppl_2): S69 - S73. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa, W. Sato, Y. Y. Sautin, O. Glushakova, B. Croker, M. A. Atkinson, C. C. Tisher, and R. J. Johnson Uncoupling of Vascular Endothelial Growth Factor with Nitric Oxide as a Mechanism for Diabetic Vasculopathy J. Am. Soc. Nephrol., March 1, 2006; 17(3): 736 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fliser, F. Kronenberg, J. T. Kielstein, C. Morath, S. M. Bode-Boger, H. Haller, and E. Ritz Asymmetric Dimethylarginine and Progression of Chronic Kidney Disease: The Mild to Moderate Kidney Disease Study J. Am. Soc. Nephrol., August 1, 2005; 16(8): 2456 - 2461. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tanaka, T. Miyata, R. Inagi, T. Fujita, and M. Nangaku Hypoxia in Renal Disease with Proteinuria and/or Glomerular Hypertension Am. J. Pathol., December 1, 2004; 165(6): 1979 - 1992. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakagawa, H. Y. Lan, H. J. Zhu, D.-H. Kang, G. F. Schreiner, and R. J. Johnson Differential regulation of VEGF by TGF-{beta} and hypoxia in rat proximal tubular cells Am J Physiol Renal Physiol, October 1, 2004; 287(4): F658 - F664. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Erdely, G. Freshour, C. Smith, K. Engels, J. L. Olson, and C. Baylis Protection against puromycin aminonucleoside-induced chronic renal disease in the Wistar-Furth rat Am J Physiol Renal Physiol, July 1, 2004; 287(1): F81 - F89. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Kang, E. S. Yu, K.-I. Yoon, and R. Johnson The Impact of Gender on Progression of Renal Disease: Potential Role of Estrogen-Mediated Vascular Endothelial Growth Factor Regulation and Vascular Protection Am. J. Pathol., February 1, 2004; 164(2): 679 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Erdely, L. Wagner, V. Muller, A. Szabo, and C. Baylis Protection of Wistar Furth Rats from Chronic Renal Disease Is Associated with Maintained Renal Nitric Oxide Synthase J. Am. Soc. Nephrol., October 1, 2003; 14(10): 2526 - 2533. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Johnson, B. Rodriguez-Iturbe, J. Herrera-Acosta, W. C. O'Neill, U. Querfeld, P. Niaudet, K. Amann, and E. Ritz Nephron Number and Primary Hypertension N. Engl. J. Med., April 24, 2003; 348(17): 1717 - 1719. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |