| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Zoophysiological Laboratory, the August Krogh Institute,*and the Structural Cell Biology Unit, Department of Medical Anatomy A, the Panum Institute,the University of Copenhagen, Copenhagen, Denmark; and St. Louis Veterans Administration Medical Center,St. Louis, Missouri
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
-smooth muscle (-sm) actin-containing myofibroblasts in response to specific stimuli.1-3 Whereas myofibroblasts are only transiently present in normal wound healing, continuous conversion of fibroblasts into myofibroblasts followed by myofibroblast proliferation are chronic processes in numerous fibrotic lesions including the desmoplastic response to invading breast carcinoma.4-6
We have previously demonstrated that expression of -sm actin in breast myofibroblasts is triggered by transforming growth factor (TGF)-ß1,7
and TGF-ß1 is now considered as a key molecule and a master switch for the general fibrotic program.8
Beyond the level of cytoskeletal modulation, little is known about which genes are regulated during the induction of myofibroblast differentiation. The aim of the present study was to identify such genes. Using fibroblasts from normal primary breast biopsies isolated under chemically defined conditions, which support the in situ G0 phenotype, differential display-reverse transcription PCR (DD-RT-PCR) was used to unravel transcriptional changes after TGF-ß1 stimulation. Our data indicate that independently of cell cycle, TGF-ß1 regulates transcription factors, cytoskeletal proteins, extracellular matrix molecules, cytokines and receptors, and transport proteins, including a member of the chloride intracellular channel (CLIC) gene family, CLIC4. The human genes of the CLIC protein family so far includes five members: CLIC1/NCC27, CLIC2/XAP121, CLIC3, CLIC4, and CLIC5,9-14
whose expression have been described in various tissues. It has been a matter of debate if the proteins are subunits of a chloride channel complex rather than channels themselves.12
It has, however, recently been demonstrated that members of the CLIC gene family indeed function as chloride transporters15,16
but the functional significance of CLIC expression per se has hitherto not been addressed. In this work, we show that a possible function of CLIC4 in breast myofibroblasts is to retard cell motility.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Normal breast biopsies (n = 3) were cut and rotated for 24 hours in serum-free medium, Dulbecco’s modified Eagle’s medium–Ham’s F12 (DME-F12) supplemented with 2 mmol/L glutamine (Sigma-Aldrich, Vallensbæk Strand, Denmark) and 50 µg gentamicin/ml (Garamycin, Schering, Kenilworth, NJ) and 900 IU collagenase/ml (CLS III, Worthington Biochemical Corporation, purchased from Medinova, Hellerup, Denmark). The fibroblasts were isolated by differential centrifugation of the collagenase digest and plated in DME-F12 in Primaria T-25 flasks (Falcon 3813, Becton Dickinson, Albertslund, Denmark) as previously described.7 Within the first week of cultivation, the cultures were stimulated with 100 pg of TGF-ß1/ml (T-1654, Sigma-Aldrich) or vehicle for 6 days7 before RNA extraction. RNA was extracted with TRIZOL Reagent (Gibco BRL, Life Technologies, Tåstrup, Denmark) according to the manufacturer’s instructions. The yield was 7 to 18 µg of total RNA per subconfluent T-25 flask.
Differential Display and Sequencing
Before RT-PCR and DD, total RNA samples were treated with DNase I (18068–015, Gibco BRL) to remove any possible DNA contamination. DD-RT-PCR was performed using the HIEROGLYPH mRNA profile kit (Genomyx Corporation, Foster City, CA) which includes 12 oligo(dT) anchored T7 3' primers (5'-ACGACTCACTATAGGGCTT-TTTTTTTTTTXX-3') and 20 arbitrary M13r 5' primers (5'-ACAATTTCACACAGGA(10X)-3') which in combination cover up to 95% of the entire mRNA pool. For reverse transcription, 2 µl of total RNA (0.1 µg/µl) was mixed with 2 µl of anchored primer (2 µmol/L), and incubated at 65°C for 5 minutes in a thermal cycler with a heated lid (PTC-100, MJ Research), and cooled on ice. 16 µl of a core mix containing a final concentration of 1X SuperScript II RT buffer (18064–14, Gibco BRL), 25 µmol/L dNTP mix (Boehringer Mannheim purchased from Ercopharm Roche, Hvidovre, Denmark), 10 mmol/L DTT (Gibco BRL), 1 unit/µl RNasin (N2511, Promega, purchased from Bie & Berntsen, Rødovre, Denmark) and 2 units/µl SuperScript II RT enzyme (Gibco BRL) was added per tube, and RT was run in the thermal cycler at 25°C for 10 minutes, 42°C for 60 minutes, 70°C for 15 minutes, followed by hold at 4°C. In each experiment two control samples without RT enzyme were included. The following DD-PCR was carried out in duplicate. For each sample, 2 µl of the arbitrary primer (2 µmol/L) was mixed with 2 µl RT mix, and a PCR core mix was prepared for each anchored primer containing a final concentration of 1X PCR buffer (15 mmol/L MgCl2), 20 µmol/L dNTP mix, 0.2 µmol/L anchored primer, 0.05 unit/µl Tag DNA polymerase (Boehringer Mannheim), and 0.125 µCi/µl [-33P]dATP (AH9904, Amersham Pharmacia Biotech, Hørsholm, Denmark). 16 µl PCR core mix was added per tube, and DD-PCR was performed at 95°C for 2 minutes, 4 cycles at 92°C for 15 seconds, 46°C for 30 seconds, 72°C for 2 minutes, 25 cycles at 92°C for 15 seconds, 60°C for 30 seconds, 72°C for 2 minutes, followed by 7 minutes at 72°C and hold at 4°C. Samples were mixed with Stop Solution (US70724, USB Corporation, purchased from Amersham), heat denatured and loaded on a 6% denaturing polyacrylamide gel (HR-1000, Genomyx), and run in a GenomyxLR programmable DNA sequencer apparatus (Genomyx) at 40°C, 800 V, 100 W for 16 hours. After washing and drying, the gel was exposed overnight to a Kodak Biomax MR film (Kodak, Glostrup, Denmark). Differentially expressed bands were cut out, reamplified with the Expand High Fidelity PCR System (Boehringer Mannheim) and purified with QIAquick Gel Extraction Kit (Struers KEBO Lab, Albertslund, Denmark) before automatic sequencing in an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Nærum, Denmark) using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit. The cDNA fragments were sequenced with M13 (-48) 24-mer reverse sequencing primer resulting in sequence information corresponding to the 3' end of the mRNA.
Nucleotide sequences were used to search the National Center for Biotechnology Information database with the use of the BLAST program.17 Multiple sequence alignment was performed with the Clustal W multiple alignment program (v. 1.7) and shaded with Boxshade 3.2.1.
Hybridization Array
The sequences derived from the selected DD bands were used to design specific 5' primers of 20–23 bases for use with the appropriate 3'-anchor primers allowing PCR-reamplification of homogeneous gene tags for the verification of expression patterns by hybridization analysis.18 Bands, which were not differentially expressed, and subsequently identified as KIAA1007 protein mRNA, were treated as described above and included as a control. After PCR, the products were run on an agarose gel, purified with QIAquick Gel Extraction Kit (Qiagen, Struers KEBO Lab) and spotted onto nylon membranes (Zeta-Probe GT, BioRad Laboratories, Copenhagen, Denmark) in duplicate by using a 96-well slot blot manifold (Bio-Dot, BioRad Laboratories). Following denaturation, each gene tag was applied in a dilution series of three (1, 1/5, 1/25); the starting amount for each tag was determined empirically.
Five µg total RNA from activated and non-activated fibroblasts were used as template for the generation of 32P-labeled cDNA. Reverse transcription was performed with Superscript Preamplification System (Gibco BRL) using oligo(dT) primers and dNTP(÷C) mix, in the presence of 50 µCi of [32P]dCTP (NEN, Dupharma, Kastrup, Denmark). Unincorporated nucleotides were removed with QIAquick Nucleotide Removal Kit (Qiagen, Struers Kebo Lab) Ten million cpm of each labeled cDNA preparation was hybridized to the duplicate membranes in 10 ml of hybridization solution (50% formamide, 5X SSPE, 2X Denhardt’s solution, 0.1% SDS) overnight at 42°C. After washing (once in 1X SSC/0.1% SDS for 30 minutes at room temperature, and three times in 0.2X SSC/0.1% SDS for 30 minutes at 65°C), the membranes were exposed to x-ray film (BioMax MS & TranScreen HE, Kodak) for 1 to 3 days. The developed films were scanned on a SHARP JX-330/FSU and the signal intensities were measured using Gel-Pro Analyzer 3.0 (Media Cybernetics, Silver Spring, MD).
Reverse Transcription PCR
Two µg of total RNA from fibroblasts with or without serum or TGF-ß1 stimulation were DNase treated (DNase I Amp Grade, Gibco BRL) and used as template for first strand synthesis with oligo(dT) primers (SuperScript Preamplification System, Gibco BRL) in a 30 µl volume.
A volume of 1 µl from this cDNA served as template for the subsequent PCR amplifications, using primers specific for CLIC1, CLIC2, CLIC3, CLIC4, CLIC5, KIAA1007 protein mRNA, and GAPDH (Table 1)
, or primers specific for metallothionein (FW: GTGGGCTGTGCCAAGTGT and RV: GGTCACGGTCAGGGTTGT) and WBSCR9 (FW: TGGACGTGCAAGAGTACTGG and RV: TCCCACAGCAT-ATTTGGTCA) using 56°C as annealing temperature (TA) and 28 and 35 PCR cycles, respectively.
|
for 1 minute, and extension at 72°C for 1 minute, followed by a final extension step at 72°C for 7 minutes.
Each reaction was performed in a 50 µl volume using Expand High Fidelity PCR System (Roche Molecular Biochemicals) with 1.5 mmol/L MgCl2, 200 µmol/L dNTP, and 200 nmol/L of forward and reverse primers. For RT-PCR on total RNA from CLIC4-transfected MEF/3T3 fibroblasts (see below), mouse-specific primers (-sm actin, FW: ACTGGGACGACATGGAAAAG and RV: AGAGGCATAGAGGGACAGCA, TA: 56°C, 26 cycles; GAPDH, FW: CACTCTTCCACCTTCGATGC and RV: CGAGTTGGGATAGGGCCTC, TA: 57°C, 25 cycles) were used. Control amplification was performed on RNA samples not subjected to reverse transcription to verify that no contaminating genomic DNA was present (data not shown). The PCR products were analyzed by electrophoresis in 1.5% agarose gels.
Cloning and Transfection
The coding region of CLIC4 was inserted into pRevTRE (Clontech, BD Biosciences, Brøndby, Denmark) and stably transfected into MEF/3T3 Tet-Off (Clontech) using the RetroMax retroviral transfection assay as described by the manufacturer (Imgenex, San Diego, CA).
MEF/3T3 Tet-Off cells were cultured in DMEM 11885 containing 10% Tet System Approved Fetal Bovine Serum (Clontech) supplemented with 2 mmol/L L-glutamine and 100 µg/ml G418 (Gibco BRL, purchased from Invitrogen, Tåstrup, Denmark). Clones containing the pRevTRE-CLIC4 vector were selected by adding 400 µg/ml hygromycin B (Gibco BRL).
The resulting pRevTRE-CLIC4 containing cell line was cultured using the culture medium described above, with the addition of 10 ng/ml of the tetracycline derivative, doxycycline (Sigma-Aldrich, purchased from Gerner Jensen, Charlottenlund, Denmark), and CLIC4 expression was induced by removing doxycycline from the culture medium.
Immunohistochemistry
Cryosections (8 µm) of normal or neoplastic breast (diagnosed and kindly provided by Dr. Fritz Rank, Rigshospitalet) were fixed in methanol for 5 minutes at - 20°C, blocked in 10% normal goat serum in phosphate-buffered saline, and incubated in the primary sequence for 2 hours with affinity-purified antiserum AP1058 raised against recombinant CLIC4/huH1(1:5;13
) washed in 10% normal goat serum, and incubated for 30 minutes in the second sequence with FITC-conjugated goat anti-rabbit IgG (1:25, 4050–02, Southern Biotechnology Associates, Birmingham, AL). For double staining fluorescence of CLIC4 and -sm actin, an affinity-purified antiserum raised against purified GST-p64H1 (1:100, CUMC29, kindly provided by Dr. C-H Sung, Weill Medical College of Cornell University, New York, NY12
) and monoclonal anti--sm actin (clone 1A4, A-2547, 1:1000; Sigma-Aldrich) were used in the primary sequence followed by FITC-conjugated goat anti-rabbit IgG (1:25, 4050–02) and Texas Red-labeled goat anti-mouse IgG2a (1:50, 1080–07, Southern Biotechnology Associates) in the second sequence. Preimmune serum was included as a control for CUMC29. After rinsing, the sections were mounted in Fluoromount-G (Southern Biotechnology Associates) containing 2.5 mg/ml freshly prepared n-propyl gallate (Sigma-Aldrich). Images were obtained using a Zeiss LSM 510 laser scanning microscope (Carl Zeiss, Jena GmbH).
CLIC4-MEF/3T3 fibroblasts were fixed in methanol, incubated with AP1058 (1:5) or anti--smooth muscle actin (1:1000; 1A4, Sigma-Aldrich), and peroxidase immunocytochemistry was performed essentially as previously described19
with the inclusion of mouse anti-rabbit antibodies (M737, Dako, Glostrup, Denmark) between the primary and secondary antibody for AP1058. Affinity-purified antiserum AP95 raised against a ß-galactosidase p64 fusion protein, which recognizes native bovine p64, but not p64 homologues in human or mouse tissue13,20
was included as a control.
Migration Assay
Migratory activity was assessed using 8 µm pore size polyethylene terephthalate (PET) filter inserts in a 12-well companion plate (catalog nos. 3182 and 3503, Falcon, Becton Dickinson). 1.5 ml of culture medium with or without doxycycline was added to the wells, the filter inserts were placed in the wells and the culture plate was placed in the incubator, while the cells were prepared. Subconfluent cultures of CLIC4-MEF/3T3 or MEF/3T3 Tet-Off fibroblasts (control without CLIC4 insert) with or without 3 days of exposure to 10 ng/ml of doxycycline were trypsinized and counted. 2 x 105 were pelleted by centrifugation (125 x g for 5 minutes), resuspended in 0.5 ml of medium with or without doxycycline, and plated on the filters. After 6 hours of incubation, the cells on the upper side of the filter were removed with a cotton swab, and the filter inserts were transferred to a well containing a cell stain solution (part no. 20294 of catalog no. ECM502, Chemicon International, Inc. purchased from AHdiagnostics, Aarhus, Denmark), stained for 20 minutes, rinsed in H2O, and dried. The average number of migrated cells/field was counted using an ocular grid at 20x magnification. The relative percentage of migrated cells is given as the average of four sets of experiments ± SEM.
To study migration at the individual cell level, time lapse video microscopy was used as previously described21 in three sets of paired measurements ± SD. Significance was tested by Student’s t-test.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
To identify TGF-ß1-specific changes in gene expression during conversion of fibroblasts to myofibroblasts, total RNA was extracted from three sets of primary breast fibroblasts, which were either untreated or stimulated for 6 days with TGF-ß1.7
DD-RT-PCR was performed using the HIEROGLYPH mRNA profile kit (Figure 1)
. Ninety-five differentially expressed transcripts were isolated, reamplified, purified and automatically sequenced. Seventy-seven successfully sequenced nucleotide sequences were used to search the NCBI BLASTN database. Thirty-five of the transcripts represented known genes (Table 2)
, and 42 represented unknown genes of which 17 resembled PAC/BAC clones (not shown). The major part of the known genes (11/35) represented enzymes, of which nine were up-regulated in myofibroblasts. Three of the up-regulated messages were identified as transport molecules, including a member of the CLIC family of chloride channel proteins. Twenty-eight of the 95 transcripts that were differentially expressed in fibroblasts from at least two of the three biopsies were selected for further verification by hybridization array using gene-specific primers.18
Of these, nine turned out to be truly differentially expressed (Figure 2)
. Normal breast biopsies are limited in supply and experiments requiring larger quantities of cells are further hampered by the difficulty of expanding the cell population without extensive selection. We and others have previously demonstrated that fetal calf serum and TGF-ß1 both readily convert fibroblasts to myofibroblasts.7,22
Therefore, to obtain sufficient RNA for verification in the present study, we routinely used RNA from serum-generated myofibroblasts, which may explain why the expression pattern of metallothionein and WBSCR9 was opposite of that observed in DD of the TGF-ß1-generated myofibroblasts. Thus, that TGF-ß1 indeed up-regulates metallothionein was further confirmed by RT-PCR (data not shown), and others have shown that >24 hours of exposure of fibroblasts to FCS as used here leads to down-regulation of metallothionein.23
In contrast, regulation of WBSCR9 by TGF-ß1 could not be confirmed by RT-PCR (data not shown). The transcripts showing the highest ratios of differential expression in the hybridization array were the TGF-ß3 receptor, down-regulated 24.8-fold, and the CLIC message, up-regulated 16.8-fold (Figure 2)
. TGF-ß3R has been shown by others24
to be regulated in serum-stimulated fibroblasts. Therefore, the CLIC transcript was chosen for further analysis.
|
|
|
When searched against the BLAST database our cDNA clone of approximately 1 kb (represented by two differentially expressed cDNAs in Figure 1
) showed the highest similarity to Homo sapiens mRNA, cDNA DKFZp566G223; and an intracellular chloride channel p64H1 mRNA (GenBank accession numbers AL117424.1 and AF109196.1, respectively). The first cloned intracellular chloride channel, p64, was originally purified from bovine kidney microsomes and has been proposed to function as a chloride channel.25,26
A p64 homologue, described as CLIC4/huHl and p64H1(H), respectively, by two independent groups has recently been described in human tissue.12,13
The DKFZ clone has been submitted as part of the cDNA sequencing consortium of the German Genome Project, and has not been characterized further.
The clone we have isolated is almost identical to DKFZp566G223 in the nucleotide sequence except for one position (A/G at position 488), where it resembles CLIC4/huH1 (data not shown). The predicted translated sequence is identical to that of DKFZp566G223, which differs from the reported sequences of both CLIC4 and p64H1(H) at positions 133 and 134 (RP versus SA) (Figure 3)
. This difference is entirely due to an alternate reading of the sequence through a small GC cluster (Figure 3)
. Critical review of the old sequencing gels used to generate the original CLIC4 sequence, and the observation that the current predicted amino acid sequence at these positions is conserved among bovine, rat, and mouse CLIC4, lead us to conclude that this isolated cloned sequence does indeed represent human CLIC4 and that the correct nucleotide sequence through these two codons is AGG CCA with the correct amino acid sequence of RP (Figure 3)
.
|
It is generally accepted that myofibroblasts may be generated by either serum or TGF-ß1 stimulation and exhibit essentially the same phenotype.7,22,27,28
However, the hybridization analysis in the present study revealed that one of the genes, metallothionein, displayed the opposite expression pattern in serum-stimulated fibroblasts as compared to TGF-ß1-stimulated fibroblasts. We therefore speculated that the CLIC gene expression profile might serve to uncover different programs of myofibroblast differentiation. Since the CLIC protein family includes five human members: CLIC1/NCC27, CLIC2/XAP121, CLIC3, CLIC4, and CLIC5 of high level of similarity,9-14
we hypothesized that their expression profile in fibroblasts/myofibroblasts may resolve the underlying differentiation program. We therefore broadened our analysis to include the expression of the different CLICs in primary breast fibroblasts and myofibroblasts. KIA1007 protein mRNA and GAPDH (not shown) served as internal controls and gave similar results. Whereas CLIC4 was up-regulated in serum-stimulated fibroblasts as expected, CLIC2 displayed the opposite pattern and was down-regulated under the same conditions (Figure 4)
. The expression pattern of CLIC3 resembled that of CLIC4, whereas CLIC1 was not differentially expressed, and the CLIC5 transcript could not be detected at all (Figure 4)
. Moreover, the regulating factor in (myo)fibroblasts was narrowed down to TGF-ß1 for CLIC4 and CLIC2, whereas CLIC3 apparently is regulated by other factors in serum (Figure 4)
. Thus, CLIC4 is the only CLIC which is up-regulated by TGF-ß1. Moreover, the CLIC gene expression profile delineates three levels of fibroblast differentiation: non-activated fibroblasts with a low expression of CLIC4 and a high expression of CLIC2; TGF-ß1-stimulated fibroblasts with an increased expression of CLIC4, and low expression of CLIC2; and serum-stimulated fibroblasts with high expression of CLIC4, a low expression of CLIC2 and a very high expression of CLIC3.
|
We next investigated by immunohistochemistry whether the observed induction of CLIC4 on TGF-ß1- or serum-mediated conversion of fibroblasts to myofibroblasts in culture reflected CLIC4 expression in stromal myofibroblasts in situ. Staining of breast tissue with the affinity-purified antibody, AP105813
showed that whereas normal breast stroma as well as normal, non-involved stroma peripheral to the neoplastic lesion in carcinomas (not shown, n = 4) were devoid of CLIC4, a subset of stromal -sm actin-positive myofibroblasts in 9 of 10 breast carcinomas expressed the protein (Figure 5)
. Co-localization of CLIC4 and -sm actin in myofibroblasts was further confirmed by double staining with another affinity-purified antibody, CUMC2912
(Figure 5C)
.
|
. To measure migratory activity of CLIC4-on and CLIC4-off fibroblasts, equal numbers of cells were plated on a porous filter, and the number of cells, which had migrated through the filter over a 6 hour period was counted. As shown in Figure 6B
, CLIC4 expression significantly inhibited migration by 27% (73 ± 5%) as compared to the control (100 ± 1%). No significant difference in migratory activity was induced by doxycycline in MEF/3T3 Tet-Off fibroblasts without CLIC4 insert (100 ± 0% versus 96.3 ± 6.0%, n = 3). Finally, also at the individual cell level CLIC4-on fibroblasts exhibited reduced migration as compared to CLIC4-off fibroblasts (7.9 ± 2.0 µm/h and 11.7 ± 0.6 µm/h, respectively, P < 0.05). Since we have previously shown that filamentous -sm actin inhibits cell motility,21
we speculated that the mechanism by which CLIC4 reduces cell motility might involve -sm actin induction. However, induction of CLIC4 did not affect -sm actin expression neither at the messenger nor at the protein level (Figure 7)
.
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-smooth muscle actin-positive myofibroblasts. We have previously shown that in the breast, the predominant contribution to myofibroblast generation comes from resident fibroblasts, and we and others have identified TGF-ß1 as the key molecular switch in myofibroblast generation.6,7,22,27,31
However, whereas the significance of TGF-ß1 in fibrotic processes is well recognized8
its role in gene regulation during myofibroblast conversion is not fully understood. To approach this issue, we combined a previously described chemically defined model system for conversion of fibroblasts to myofibroblasts7
with a DD-RT-PCR protocol to identify differentially expressed transcripts.
The main outcome of our study is the hitherto unknown differential expression of CLIC4 in myofibroblasts and fibroblasts. CLIC4 is a member of a family of closely related proteins, which all show high homology to the C-terminal half of p64. p64 was originally discovered by purification of chloride channel activity from bovine kidney microsomes.20
More recently, a rat p64 homologue, p64H1, was cloned and suggested to be associated with intracellular chloride transport.32
Subsequently the human homologue, described as CLIC4/huH1 or p64H1 (H)12,26
and a mouse homologue, mc3s5/mtCLIC,33
have been identified. The deduced amino acid sequence of the differentially expressed transcript identified in the present study differs from both CLIC4/huH1 and p64H1 (H) at positions 133 and 134 (RP versus SA; ie, AGG CCA versus AGC GCA). However, since this difference appears in a GC region, which can be difficult to resolve by manual sequencing, and since the RP composition is also found in the bovine, rat, and mouse homologues, we find it likely that the correct amino acid composition of human CLIC4 indeed is RP. This RP composition clearly distinguishes CLIC4 from the other CLICs, and the underlying nucleotide sequence apparently signifies species specificity (Figure 3)
.
In general, little is known about the regulation of CLIC proteins. We show here that TGF-ß1, which is also responsible for activation of the myofibroblast phenotype, up-regulates CLIC4 but not other CLICs. Moreover, our data suggest that CLIC4 expression is a feature of myofibroblasts in situ as well. As opposed to normal breast stroma, which is devoid of CLIC4 expression, CLIC4 is localized to -smooth muscle actin-positive myofibroblasts in the stroma of invasive breast carcinomas. Whether CLIC4 expression in other tissues is also contributed by stromal cells remains to be elucidated. It has been shown recently by Berryman and Bretscher,14
that in placenta, CLIC4 is localized to the trophoblast epithelium as well as "cells associated with blood vessels." The latter may, however, represent myofibroblasts as has been described by others.34
Chloride channels in general are involved in several crucial cell processes regulating cell volume, membrane potential, transepithelial transport, signal transduction, and acidification of organelles, and evidence is accumulating that members of the CLIC family represent voltage-gated channel proteins. It has been a matter of speculation whether p64/CLICs act as ion channels themselves or form part of an ion complex. However, recent data on bacterial expression of CLIC1 and CLIC4 demonstrate that both proteins are capable of forming novel, chloride-selective channels in the absence of other subunits or proteins.15,16
Hitherto, there have been two reports in the literature on differential expression of CLIC. Thus, exposure of a human histiocytic lymphoma cell line to phorbol 12-myristate 13-acetate or interleukins up-regulates CLIC1, and the regulation was found to be associated with the maturational state of the cell.9
Likewise, expression of mc3s5/mtCLIC is up-regulated during keratinocyte maturation and following treatment with tumor necrosis factor-.33
The present study shows that human CLIC4 is significantly higher expressed in myofibroblasts versus fibroblasts. Collectively, these findings suggest a role for CLIC4 in cell differentiation. The present study is the first to demonstrate that a function of CLIC4 is to inhibit cell motility. The cellular mechanism responsible for this remains to be elucidated, but it has been suggested by others that members of the CLIC family, including CLIC4, are associated with the actin cytoskeleton.14,35
We have shown previously that the cytoskeletal remodeling accompanying myofibroblast differentiation, ie, induction of filamentous -sm actin, inhibits cell motility,21
and the presence of larger focal contacts in -sm actin-positive cells may promote the adhesiveness of these cells.21,36
The present study suggests that simultaneous induction of CLIC4 may further support a stationary phenotype of myofibroblasts. The hierarchy of events in the myofibroblast differentiation program has not been established, but CLIC4 expression per se does not trigger increased -sm actin expression, and the two proteins may, thus, act independently. A most recent study has shown that rat CLIC4 binds directly to dynamin I in a complex containing ß-actin, tubulin and 14–3-3.35
Whereas CLIC4 did not bind directly to F-actin, it may bind to non-polymerized G-actin,35
and as such may reduce the pool of G-actin available for polymerization.21,37
Other ion channels including a Ca2+-activated chloride channel, CLCA2, have been associated with inhibition of breast cancer growth and metastasis.30,38 Thus, when reintroduced into CLCA2-negative breast carcinoma cell lines, CLCA2 inhibits migration and reduces tumorigenicity and invasion of human breast carcinoma cells, and as such may act as a tumor suppressor in breast cancer.30 These studies have, however, focused mainly on the epithelium, and the functional implications of chloride channel expression in breast stroma has yet to be established.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Danish Research Council, the Danish Cancer Society, the Novo Nordic Foundation, the Meyer Foundation, the Friis Foundation, Fru Astrid Thaysens Legat for Lægevidenskabelig Grundforskning (to L.R.-J., R.V. and O.W.P.), Weimanns Legat (to L.R.-J.), National Institutes of Health grant CA-64786-02 (to O.W.P.), National Institutes of Health grant 44838, and a Merit Award from the Department of Veterans Affairs (to J.C.E.).
Accepted for publication April 29, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-smooth muscle actin by transforming growth factor-ß1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia. Lab Invest 1993, 68:696-707[Medline]
-smooth muscle actin: retardation of motility in fibroblasts. J Cell Biol 1996, 134:67-80-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol 1993, 122:103-111 regulate the expression of a mitochondrial chloride channel protein. J Biol Chem 1999, 274:36488-36497-smooth muscle actin expression, cytoskeletal pattern, and adhesive structure organization. Exp Cell Res 1998, 238:481-490[Medline]
This article has been cited by other articles:
 |
|
 |
|
  Y. Liu, Y. Su, M. Wiznitzer, O. Epifano, and S. Ladisch Ganglioside depletion and EGF responses of human GM3 synthase-deficient fibroblasts Glycobiology, August 1, 2008; 18(8): 593 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Suh, M. Mutoh, T. Mutoh, L. Li, A. Ryscavage, J. M. Crutchley, R. A. Dumont, C. Cheng, and S. H. Yuspa CLIC4 mediates and is required for Ca2+-induced keratinocyte differentiation J. Cell Sci., August 1, 2007; 120(15): 2631 - 2640. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Komori, N. Takemori, H. K. Kim, A. Singh, S.-H. Hwang, R. D. Foreman, K. Chung, J. M. Chung, and H. Matsumoto Proteomics study of neuropathic and nonneuropathic dorsal root ganglia: altered protein regulation following segmental spinal nerve ligation injury Physiol Genomics, April 24, 2007; 29(2): 215 - 230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Villadsen, A. J. Fridriksdottir, L. Ronnov-Jessen, T. Gudjonsson, F. Rank, M. A. LaBarge, M. J. Bissell, and O. W. Petersen Evidence for a stem cell hierarchy in the adult human breast J. Cell Biol., April 9, 2007; 177(1): 87 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Sheffer, O. Leon, J. H. Pinthus, A. Nagler, Y. Mor, O. Genin, M. Iluz, N. Kawada, K. Yoshizato, and M. Pines Inhibition of fibroblast to myofibroblast transition by halofuginone contributes to the chemotherapy-mediated antitumoral effect Mol. Cancer Ther., February 1, 2007; 6(2): 570 - 577. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Suh, J. M. Crutchley, A. Koochek, A. Ryscavage, K. Bhat, T. Tanaka, A. Oshima, P. Fitzgerald, and S. H. Yuspa Reciprocal Modifications of CLIC4 in Tumor Epithelium and Stroma Mark Malignant Progression of Multiple Human Cancers Clin. Cancer Res., January 1, 2007; 13(1): 121 - 131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bohman, T. Matsumoto, K. Suh, A. Dimberg, L. Jakobsson, S. Yuspa, and L. Claesson-Welsh Proteomic Analysis of Vascular Endothelial Growth Factor-induced Endothelial Cell Differentiation Reveals a Role for Chloride Intracellular Channel 4 (CLIC4) in Tubular Morphogenesis J. Biol. Chem., December 23, 2005; 280(51): 42397 - 42404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yin and M. A. Watsky Chloride channel activity in human lung fibroblasts and myofibroblasts Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1110 - L1116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Suh, M. Mutoh, M. Gerdes, J. M. Crutchley, T. Mutoh, L. E. Edwards, R. A. Dumont, P. Sodha, C. Cheng, A. Glick,, et al. Antisense Suppression of the Chloride Intracellular Channel Family Induces Apoptosis, Enhances Tumor Necrosis Factor {alpha}-Induced Apoptosis, and Inhibits Tumor Growth Cancer Res., January 15, 2005; 65(2): 562 - 571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Larsen, E. Tufvesson, J. Malmstrom, M. Morgelin, M. Wildt, A. Andersson, A. Lindstrom, A. Malmstrom, C.-G. Lofdahl, G. Marko-Varga, et al. Presence of Activated Mobile Fibroblasts in Bronchoalveolar Lavage from Patients with Mild Asthma Am. J. Respir. Crit. Care Med., November 15, 2004; 170(10): 1049 - 1056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Suh, M. Mutoh, K. Nagashima, E. Fernandez-Salas, L. E. Edwards, D. D. Hayes, J. M. Crutchley, K. G. Marin, R. A. Dumont, J. M. Levy, et al. The Organellular Chloride Channel Protein CLIC4/mtCLIC Translocates to the Nucleus in Response to Cellular Stress and Accelerates Apoptosis J. Biol. Chem., February 6, 2004; 279(6): 4632 - 4641. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
1 kb transcripts (box) that were eventually identified as representing CLIC4.
