| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Short Communication |
vß6 Is Essential for Nematode-Induced Mucosal Mast Cell Hyperplasia and Expression of the Granule Chymase, Mouse Mast Cell Protease-1
From the Department of Veterinary Clinical Studies,* University of Edinburgh, Midlothian, Scotland; and the Lung Biology Center, University of California, San Francisco, California
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
vß6 mediates local activation of TGF-ß1 in the lung and ß6-/- mice exhibit exaggerated pulmonary inflammation, but their response to inflammatory stimuli in the gut has not been investigated. We found that both ß6 and TGF-ß1 are constitutively expressed in the jejunal epithelial compartment in uninfected mice and during infection with the intestinal nematode Nippostrongylus brasiliensis. We also present data showing that ß6-/- mice are seriously compromised in their ability to mount a mucosal mast cell response after infection, and there is a significant reduction in the expression and systemic release of the granule chymase, mouse mast cell protease-1. Because in vitro expression of this chymase is regulated by TGF-ß1, these data indicate that in the absence of vß6 epithelially expressed TGF-ß1 may not be activated, with a consequent absence of expression of mouse mast cell protease-1 and down-regulation of the mucosal mast cell response.
vß6, but the relative contributions of these pathways in vivo have not been fully established.6
Recently, it has been shown that the expression and activation of TGF-ß1 in the lungs may be regulated through a variety of macrophage-dependant pathways that are themselves controlled by interleukin-13.1
The jejunal epithelium is populated by intraepithelial lymphocytes (IELs) and by large numbers of intraepithelial mucosal mast cells (MMCs) during nematode infection.7
Recent in vitro studies on murine MMC homologues have shown that expression and secretion of the gut-specific ß-chymase, mouse mast cell protease-1 (mMCP-1) is induced by TGF-ß1.8,9
This leads to the possibility that in vivo MMC differentiation and mMCP-1 expression are regulated by activation of TGF-ß1 within the epithelial compartment. Experiments with transfected cells have shown effective activation of TGF-ß1 in vitro by the integrin vß6 through cell surface-associated binding of latency-associated peptide.6
This integrin is expressed almost exclusively on epithelial cells;10
is rapidly up-regulated in the lungs and skin in response to injury and inflammation; and is a receptor for the matrix proteins fibronectin, tenascin, and vitronectin.11,12
Furthermore, transgenic mice (ß6-/-) lacking this integrin develop exaggerated inflammation in lungs that is reversed by epithelial expression of the human ß6 transgene.13
These observations indicate that epithelial expression of the integrin ß6 is important for local TGF-ß1 activation during inflammatory responses.
Since the earliest phase of MMC hyperplasia and expression of mMCP-1 occur within the gut epithelium14,15 we wished to test the hypotheses that the integrin ß6 is expressed by jejunal enterocytes and that it is required for mMCP-1 expression during nematode infection. Our results show that ß6 and TGF-ß1 transcripts are co-expressed within the epithelial compartment of the gut and that, in the absence of ß6, mMCP-1 expression and MMC hyperplasia are severely compromised during enteric nematodiasis.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Maintenance of and infections with Nippostrongylus brasiliensis (rat strain) were performed as in previous studies.15 To determine whether the integrin ß6 is expressed by murine enterocytes, S129 mice (Becton and Dickinson, Cowley, UK Ltd.) were infected subcutaneously with 500 N. brasiliensis L3 (rat adapted strain) and groups of three to four mice were killed 5, 7, and 9 days after infection together with uninfected controls. Intact sheets of jejunal epithelium that included both villi and crypts were exfoliated by vascular perfusion with ethylenediaminetetraacetic acid as described by Bjerknes and Cheng16 and modified by Rosbottom and colleagues.17 Isolated epithelium was allowed to settle in ice-cold phosphate-buffered saline (PBS) before transfer into 4% paraformaldehyde for histological examination and into Tri-reagent for RNA analysis to monitor the expression of MMC proteases, integrin ß6, and TGF-ß1. Additional S129 mice were killed at day 7 of infection and samples of intact jejunum collected starting 10 cm from the pylorus for integrin ß6 immunocytochemistry. Jejunum was rolled outermost on villi a pastette, transferred onto labeled cork disks, covered in OCT, and snap-frozen in dry-ice-cooled isopentane.
Fourteen sex-matched ß6+/+ and ß6-/- transgenic S129 mice, 8 to 12 weeks old,18 were each infected subcutaneously with 500 N. brasiliensis L3 (rat adapted strain) and killed on days 5, 7, and 9 after infection (four to five per group) in addition to uninfected controls (four per group). Blood was collected for serum and samples of jejunum were removed starting 10 cm from the pylorus for RNA isolation (0.5 cm), quantification of mMCP-1 by enzyme-linked immunosorbent assay (1 cm), fixation in 4% paraformaldehyde (3 cm) and in Carnoy’s fluid (3 cm), respectively, and the remainder of the small intestine used for adult worm isolation, by modified Baerman’s as described previously.19 Parasites were enumerated from four to five mice/group per time point, and data were compared using the Mann-Whitney nonparametric test (Instat), with a significance level of P < 0.05. The stomach was opened longitudinally on thick filter paper and small samples of the glandular region removed for RNA isolation and mMCP-1 quantification by enzyme-linked immunosorbent assay, before dividing into two longitudinal sections for fixation in 4% paraformaldehyde and Carnoy’s fluid. All experiments were done in accordance with the United Kingdom’s Animals (Scientific Procedures) Act 1986 and the University of California at San Francisco guidelines on animal care.
Histochemistry and Immunocytochemistry
Cryostat sections (10 µm) of the snap-frozen jejunum tissue samples were air-dried for 20 minutes, fixed in absolute methanol for 10 minutes at -20°C, and air-dried for 15 minutes. Sections were blocked with PBS [0.5 mol/L NaCl/0.5% Tween-80 (high-salt)] containing 4% bovine serum albumin for 1 hour at 21°C in a humidified container. Nonspecific immunoglobulin interactions were further blocked by a 2-hour incubation with high-salt-containing 10% normal donkey serum at 4°C in a humidified container. Sections were then incubated overnight at 4°C in a humidified container with rabbit anti-integrin ß6 IgG (B1) tissue culture supernatant13 or 0.5 µg/ml of normal rabbit control IgG (Cambridge Bioscience, Cambridge, UK) in high-salt/10% normal donkey serum. After washing with PBS, slides were incubated with Alexa Fluor-488-conjugated polyclonal donkey anti-rabbit IgG (Cambridge Bioscience) at 2 µg/ml in high-salt/10% normal donkey serum for 2 hours at 4°C in a humidified container. Slides were washed in PBS and mounted with Mowiol mounting media (CN Biosciences UK, Nottingham, UK). Fluorescent images were acquired using an MRC-600 confocal laser-scanning microscope (Bio-Rad Laboratories, Hemel Hempstead, UK) mounted on an Axiovert 100 inverted microscope equipped with a x63 Plan-Apochromat objective lens (Carl Zeiss, Welwyn Garden City, UK). Images were prepared for publication using Object-Image.20 Object Image is a public domain software package, based on NIH Image21 developed by Norbert Vischer (The University of Amsterdam, Amsterdam, The Netherlands) and is available via the Internet at http://simon.bio.uva.nl/object-image.html.
For mast cell evaluation, 3-cm lengths of jejunum were rolled villi-outermost using the Swiss-roll technique, and fixed in Carnoy’s fluid or 4% paraformaldehyde before subsequent processing and sectioning.22 Mast cells were detected by staining sections from Carnoy’s fixed tissue overnight in 0.5% toluidine blue (Merck, Poole, UK) in 0.5 mol/L HCl, pH 0.5, and counterstaining in 0.1% eosin solution (Surgipath, Peterborough, UK)22 or by staining paraformaldehyde-fixed sections for esterase in Fast Garnet GBC salt and naphthol AS-D chloroacetate.23 mMCP-1+ve MMCs were detected immunohistochemically with monoclonal antibody RF 6.1 as described previously.15 In jejunal sections, mast cells were enumerated per 20 villus-crypt units (vcu) both in the mucosa and in the submucosa directly below the 20 vcu19 and expressed per vcu. In sections of stomach, positively stained mast cells were counted in five adjacent fields in the glandular fundus and enumerated per mm2.15 Paraformaldehyde-fixed sections of jejunum werestained with Alcian Blue for mucin glycoproteins24 for enumeration of goblet cells (counted in 20 vcu/sample) and with carbol chromatrope for enumeration of eosinophils25 [counted at x500 in 20 adjacent fields (4.8 mm2 total area)]. Intraepithelial lymphocytes were detected by staining with anti-CD3 antibody26 and counted in 20 vcu/sample. All data were compared using the nonparametric Mann-Whitney test (Instat) with significance levels of P < 0.05.
Quantification of mMCP-1
Tissues for enzyme-linked immunosorbent assay analysis were snap-frozen in dry ice immediately after collection and stored at -70°C. Concentrations of mMCP-1 in tissues (µg/g wet weight) and in serum (ng/ml) were assayed using the rat monoclonal RF 6.1-based enzyme-linked immunosorbent assay with modifications.15,19
Detection of Transcripts by Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Samples of jejunum (0.5 cm) were transferred into 0.5 ml of RNA-later reagent (Ambion Inc., Austin, TX) immediately after collection and stored at 4°C for 3 weeks then at -20°C until processing. Stripped epithelium was transferred directly into TriReagent (Sigma, Poole, UK) and processed as described previously.17 Homogenization of tissues in TriReagent and removal of contaminating DNA using DNA-free DNase (Ambion Inc.) has been described.19 One µg of RNA was reverse-transcribed as previously described22 using 2.5 µmol/L of (dT)15 oligonucleotide primers for protease gene amplification or 2.5 µmol/L of random hexamer primers for amplification of integrin ß6 or TGF-ß1. One-twentieth volume was amplified by PCR using gene-specific primers described below, with equivalent quantities of nonreverse-transcribed RNA as negative controls. Reaction conditions were optimized to ensure the number of thermocycles used correlated with the amplification stage of the PCR, and magnesium concentration optimized as necessary (IgA only). Primers for the protease genes mMCP-1 and mMCP-2 and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) have already been described.19,22 Amplifications were performed for 1 minute at 94°C, 2 minutes at 63°C, and 3 minutes at 72°C for 26 thermocycles. Primers B6-6F and B6-5R for integrin ß6 have been described previously.18 Amplifications were performed for 40 seconds at 94°C, 40 seconds at 52°C, and 120 seconds at 72°C for 36 thermocycles along with GAPDH controls. Primers for mouse TGF-ß1 were purchased from Stratagene (Cambridge, UK) and amplifications performed for 40 seconds at 94°C, 40 seconds at 60°C, and 120 seconds at 72°C for 34 thermocycles along with GAPDH controls. Primers for IgA were used as a control for epithelial purity because B cells are abundant in the lamina propria but absent from the epithelium in the jejunum. Primers for mouse IgA (forward TCTCCTCCTCTTCTTGTCATACGC; reverse GGAGGTAAGTACCACAGGAGCGTTT) were designed from unique regions of the IgA sequence27 to give a PCR product of 316 bp. Amplifications were performed for 40 seconds at 94°C, 40 seconds at 58°C, and 120 seconds at 72°C for 34 thermocycles in 10 mmol/L of Tris-HCl and 1 mmol/L of MgCl2 along with GAPDH controls. PCR products were visualized on ethidium bromide stained 1.2 to 1.6% agarose gels and images recorded and analyzed by densitometry using a Kodak Digital Science Image Station 440CF and 1D Image Analysis software.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
To determine whether the integrin ß6 was expressed within the epithelial compartment and whether expression was altered during nematode infection, jejunal epithelium was separated from the lamina propria by vascular perfusion with ethylenediaminetetraacetic acid16,17
in normal uninfected 129S mice and on days 5, 7, and 9 after infection with 500 N brasiliensis L3 (n = 3/group/day). The samples of exfoliated epithelium were checked histologically to confirm that they comprised >95% epithelium with little or no contamination from the lamina propria (Figure 1a)
as described previously.16,17
Similarly the presence of IgA transcripts was obvious in RNA prepared from whole jejunum samples but very low or undetectable in all of the epithelial samples tested (Figure 1d)
, suggesting lamina propria cells are unlikely to contribute significantly to RT-PCR signals observed. Transcripts coding for ß6 were detected in all jejunal epithelial samples and PCR products were generally of greater intensity than that from RNA prepared from intact jejunum amplified under the same conditions (Figure 1d)
. Expression of ß6 by gut epithelium was also confirmed by immunocytochemistry on frozen sections of jejunum using rabbit anti-integrin ß6 IgG13
(Figure 1, b and c)
. Importantly, integrin ß6 shows a circumferential localization on enterocytes within the crypt epithelium (Figure 1b)
. Transcription of TGF-ß1 was detected in all epithelial samples and expression appeared to be constitutive (Figure 1d)
, which is consistent with previous findings in inflamed and normal lung tissue.6
|
Because MMCs in parasitized mice are predominantly intraepithelial,7,15
their presence in the isolated epithelium preparations was further evaluated by RT-PCR. Transcripts for the MMC-specific genes mMCP-1 and mMCP-228
were abundant in gut epithelium isolated fromS129 mice infected with N. brasiliensis compared with uninfected controls (day 0 versus day 9; P < 0.05) (Figure 1e)
. This was consistent with epithelial infiltration by mMCP-1-expressing MMCs that is detectable by immunohistochemistry15
and previous observations in isolated epithelium from BALB/c mice.17
Mice Lacking the Integrin ß6 Tolerate Infection with N. Brasiliensis and Expel the Worms with Normal Kinetics
To investigate whether the expression of ß6 by enterocytes is of functional importance in the immune rejection of nematodes, ß6-/- and ß6+/+ S129 mice (n = 4 to 5 mice/group/time point) were infected subcutaneously with 500 N. brasiliensis larvae and the course of infection was followed until day 9. Mice in the two groups carried comparable worm burdens at all stages of infection and immune rejection of the parasite was complete by day 9 (Table 1)
. This suggested that the rejection process was not affected by the absence of ß6.
|
The number of MMCs detected by toluidine blue staining increased significantly above uninfected control levels in infected ß6+/+ mice (P < 0.05), but MMCs were virtually absent in both control and infected ß6-/- mice except on day 9, when the count was 
10% of that seen in the ß6+/+ mice at the same time point (ß6+/+ versus ß6-/- on day 5, P < 0.05; and on days 7 and 9, P < 0.01) (Figure 2a)
. The majority of MMCs were intraepithelial in the infected ß6+/+mice [91% (SE ± 1.4) on day 9] (Figure 2c)
. MMCs in ß6-/- mice were rare (Figure 2d)
and only 39% (SE ± 4.4) were intraepithelial. The lack of MMCs in ß6-/- mice was confirmed by staining for esterase; the numbers of esterase+ve MMCs increased significantly above uninfected levels in the ß6+/+ mice late in infection [day 0, 0.1 to 0.4 MMCs/vcu (SE ± 0.4); day 9, 0.4 to 3.7 MMCs/vcu (SE ± 0.8) (P < 0.05)] whereas esterase+ve MMCs in the ß6-/- mice were absent in most samples [day 9, 0 to 0.05 MMCs vcu (SE ± 0.01); ß6-/- versus ß6+/+; P < 0.01]. This was in contrast with the staining with toluidine blue in which some mast cells were found in the ß6-/- jejunum on day 9 of infection (Figure 2, a and d)
. Toluidine blue+ve and esterase+ve mast cells in the submucosa were rare in both groups (0.05 to 0.25 toluidine blue+ MMCs per vcu in both groups on day 9). The lack of esterase staining is consistent with studies in mMCP-1-/- mice, suggesting that in the absence of this chymase (see below), toluidine blue+ve MMCs are esterase-ve.22
Interestingly, numbers of toluidine blue-stained mast cells in the gastric mucosa (glandular region) of the stomach were significantly greater (P < 0.05) in uninfected ß6-/- mice when compared with ß6+/+controls (Figure 2b)
. Although there was a trend toward increasing numbers of gastric MMCs in the ß6-/- mice during infection, this was not significantly different from uninfected levels or from infected ß6+/+ mice.
|
The kinetics of the systemic release of mMCP-1 into the circulation (Figure 3a)
and of mMCP-1 expression in the jejunum (Figure 3b)
in ß6+/+ controls after infection with N. brasiliensis were as described previously for the rat-passaged strain of the parasite.15
In contrast, mMCP-1 was virtually undetectable in ß6-/- mice at any stage of infection (ß6-/- versus ß6+/+controls on day 5, P < 0.05; and on days 7 and 9, P < 0.01) (Figure 3b)
. RT-PCR analysis of jejunal RNA from ß6+/+ mice showed significant up-regulation of transcription of the MMC proteases mMCP-1 and mMCP-2 in infected compared to uninfected mice (day 0 versus day 9; P < 0.05) (Figure 3c)
. mMCP-1 and mMCP-2 transcripts remained low or were undetectable in ß6-/- gut samples (ß6-/- versus ß6+/+controls on day 9, P < 0.05) (Figure 3c)
. Immunohistochemical staining showed that mMCP-1+ve MMCs were significantly increased in infected ß6+/+ mice (P < 0.05) but were virtually absent in the ß6-/- mice (Figure 3d)
, which was consistent with the absence of esterase staining in these mice. mMCP-1+ve cells in infected ß6+/+ jejunum were again predominantly intraepithelial. mMCP-1+ve cells in the stomach of infected ß6+/+ mice were very rare, and none were detected in infected ß6-/- mice (data not shown). Integrin ß6 transcripts were expressed in ß6+/+ jejunum and stomach, but were not altered during infection (data not shown). No ß6 transcripts were detected in ß6-/- tissues. TGF-ß1 transcripts were constitutively expressed and appeared to be unaltered in both infected and uninfected ß6+/+ and ß6-/- jejunum (data not shown) in accordance with previous data that TGF-ß1 synthesis is unaffected by ß6 deletion.6
|
It was important to establish whether, in the absence of ß6, other potential effector responses such as goblet cell hyperplasia, tissue eosinophilia, or recruitment of CD3+ IELs were altered after infection. Uninfected ß6-/- mice tended to show higher baseline numbers of goblet cells than ß6+/+ mice, but this was not significant (Table 2)
. Both ß6+/+ and ß6-/- mice developed goblet cell hyperplasia on infection with no significant differences between the two groups, although this was more pronounced in ß6+/+mice (day 0 versus days 5, 7, and 9; P <0.05) (Table 2)
. Numbers of eosinophils were significantly greater in the jejunum of uninfected ß6-/- mice when compared with ß6+/+ mice (P < 0.05) but numbers increased in both groups during infection and were not significantly different (Table 2)
. Eosinophils were detected in the stomach in both groups, but were not significantly different between ß6+/+ and ß6-/- mice [ß6+/+: day 0, 0.4 to 1.5 eosinophils/mm2 (SE ± 0.3); day 9, 0.2 to 4.2 eosinophils/mm2 (SE ± 0.7); ß6-/-: day 0, 0.6 to 3.1 eosinophils/mm2 (SE ± 0.5); day 9, 0.8 to 4.7 eosinophils/mm2 (SE ± 1.1)]. The numbers of CD3+ve IELs in the jejunum were variable but significantly higher in uninfected ß6-/- compared to ß6+/+ mice (P < 0.05) (Table 2)
. There was no overall increase in numbers of CD3+ve IELs during infection in either group (Table 2)
.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Vß6 mediates lung inflammatory responses through TGF-ß1 activation,6,12,13
the role of this integrin in inflammatory responses in the intestine has not been previously investigated. Our data strongly suggests, for the first time, that integrin Vß6 and TGF-ß1 are constitutively co-expressed in the epithelial compartment of the murine jejunum, and that the integrin Vß6 is primarily confined to the crypts, the main site of mast cell recruitment and mMCP-1 expression. The responses to intestinal nematode infection in ß6-/- mice were marked by a virtual absence of mMCP-1+ve and esterase+ve MMCs and a highly significant reduction in MMC hyperplasia. Our previous in vitro observations showing mMCP-1 is a TGF-ß1-inducible gene8,9
indicates that presentation of mature TGF-ß1 at the cell surface of the epithelium to differentiating MMCs would be expected to induce mMCP-1 expression in vivo. The lack of mMCP-1 expression in ß6-/- mice lends weight to our hypothesis that the integrin vß6 is required for epithelial processing of latent TGF-ß1 latency-associated peptide in the intestine. Although numerous pathways for TGF-ß1 activation have been identified in the lung apart from integrin vß6, many of these are not confined to the epithelium29
or are macrophage-dependent1,30,31
and so are unlikely to be important in the intestinal epithelium where macrophages are rare. Our observations are in agreement with the growing body of evidence that activation of latent TGF-ß1 is tissue-restricted and mediated by localized factors.32
The concurrent substantial reduction in intestinal MMCs, but not gastric MMC hyperplasia in ß6-/- mice is somewhat surprising. However, gastric MMCs in BALB/c mice, and apparently in S129 mice (PA Knight, unpublished observations) are phenotypically distinct from intestinal MMCs and do not normally express mMCP-1,14,15
and therefore may be regulated or recruited by a different mechanism. Mast cell precursors increase in number in the jejunal epithelium during the early phase of nematode infection,33,34
and the most likely explanation for the failure of the MMC response in parasitized ß6-/- mice is either that mature TGF-ß1 is an essential differentiation or chemotactic factor for the precursors that are recruited to the intestinal epithelium, or that it regulates the local epithelial expression of other MMC-specific differentiation factors that have yet to be identified.
As might be predicted, the kinetics of worm expulsion was similar in both groups because expulsion of N brasiliensis is influenced by goblet-cell mucins but independent of mast cell responses in the mouse,35
and there were no significant differences in goblet cell responses between infected ß6-/- and ß6+/+ mice. Uninfected ß6-/- mice had significantly higher levels of CD3+ve IELs and tissue eosinophilia than ß6+/+ mice, which is consistent with observations of higher baseline inflammatory responses in the skin and lungs.13,18
However, eosinophil and IEL responses were similar in both groups during infection. It is surprising that IEL numbers were unaffected in ß6-/- mice because they express Eß736
and, as is the case for mast cells,9
expression of this integrin by T cells is regulated by TGF-ß1 in vitro.37
Nevertheless, in a recent study in which parasitized mice were treated systemically with anti-E or -ß7 antibodies, there was selective depletion of MMCs but not IELs38
indicating TGF-ß1-induced expression of Eß7 could be critical for recruitment and survival of MMCs but not of IELs within the epithelium.
In conclusion, MMC hyperplasia and granule expression of mMCP-1 during nematode infection require the expression of Vß6 by jejunal epithelium. Future studies will be directed toward determining whether the attenuation of MMC hyperplasia is a consequence of a defect in the recruitment of mast cell precursors to the epithelium or whether, having entered the epithelial compartment early in infection,33
the precursors are unable to differentiate in the absence of mature TGF-ß1.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Wellcome Trust (grant no. 060312) and the Biotechnology and Biological Science Research Council (grant no. 15/S10130).
Accepted for publication June 2, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  P. A. Knight, J. K. Brown, S. H. Wright, E. M. Thornton, J. A. Pate, and H. R.P. Miller Aberrant Mucosal Mast Cell Protease Expression in the Enteric Epithelium of Nematode-Infected Mice Lacking the Integrin {alpha}v{beta}6, a Transforming Growth Factor-{beta}1 Activator Am. J. Pathol., October 1, 2007; 171(4): 1237 - 1248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sheppard Transforming Growth Factor {beta}: A Central Modulator of Pulmonary and Airway Inflammation and Fibrosis. Proceedings of the ATS, July 1, 2006; 3(5): 413 - 417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. Brown, S. M. McAleese, E. M. Thornton, J. A. Pate, A. Schock, A. I. Macrae, P. R. Scott, H. R.P. Miller, and D. D.S. Collie Integrin-{alpha}v{beta}6, a Putative Receptor for Foot-and-Mouth Disease Virus, Is Constitutively Expressed in Ruminant Airways J. Histochem. Cytochem., July 1, 2006; 54(7): 807 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Datta, M. L. deSchoolmeester, C. Hedeler, N. W. Paton, A. M. Brass, and K. J. Else Identification of Novel Genes in Intestinal Tissue That Are Regulated after Infection with an Intestinal Nematode Parasite Infect. Immun., July 1, 2005; 73(7): 4025 - 4033. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-L. Wang, M. E. Shin, P. A. Knight, D. Artis, D. G. Silberg, E. Suh, and G. D. Wu Regulation of RELM/FIZZ isoform expression by Cdx2 in response to innate and adaptive immune stimulation in the intestine Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G1074 - G1083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Knight, A. D. Pemberton, K. A. Robertson, D. J. Roy, S. H. Wright, and H. R. P. Miller Expression Profiling Reveals Novel Innate and Inflammatory Responses in the Jejunal Epithelial Compartment during Infection with Trichinella spiralis Infect. Immun., October 1, 2004; 72(10): 6076 - 6086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Artis, M. L. Wang, S. A. Keilbaugh, W. He, M. Brenes, G. P. Swain, P. A. Knight, D. D. Donaldson, M. A. Lazar, H. R. P. Miller, et al. RELM{beta}/FIZZ2 is a goblet cell-specific immune-effector molecule in the gastrointestinal tract PNAS, September 14, 2004; 101(37): 13596 - 13600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Brown, P. A. Knight, A. D. Pemberton, S. H. Wright, J. A. Pate, E. M. Thornton, and H. R. P. Miller Expression of Integrin-{alpha}E by Mucosal Mast Cells in the Intestinal Epithelium and Its Absence in Nematode-Infected Mice Lacking the Transforming Growth Factor-{beta}1-Activating Integrin {alpha}v{beta}6 Am. J. Pathol., July 1, 2004; 165(1): 95 - 106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Hakkinen, L. Koivisto, H. Gardner, U. Saarialho-Kere, J. M. Carroll, M. Lakso, H. Rauvala, M. Laato, J. Heino, and H. Larjava Increased Expression of {beta}6-Integrin in Skin Leads to Spontaneous Development of Chronic Wounds Am. J. Pathol., January 1, 2004; 164(1): 229 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Rosbottom, C. L. Scudamore, H. von der Mark, E. M. Thornton, S. H. Wright, and H. R. P. Miller TGF-{beta}1 Regulates Adhesion of Mucosal Mast Cell Homologues to Laminin-1 Through Expression of Integrin {alpha}7 J. Immunol., November 15, 2002; 169(10): 5689 - 5695. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
