| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology,* University of Washington School of Medicine, Seattle, Washington; COR Therapeutics, Inc., South San Francisco, California; the Department of Medical Biochemistry, University of Göteborg, Göteborg, Sweden; and the Fred Hutchinson Cancer Research Center, Seattle, Washington
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
PDGF is a family of disulfide-bonded homo- or heterodimers of four possible subunits (PDGF-A, PDGF-B, PDGF-C, and PDGF-D) which act on cells by binding to homo- or heterodimers of the two PDGF receptor proteins, PDGF 
-receptor and ß-receptor. PDGF-B is able to bind to both the PDGF - and ß-receptors, whereas PDGF-A can bind only to the PDGF -receptor.8
PDGF-C and PDGF-D have been identified recently,9-12
and much less is known about their roles and cellular sources. PDGF-CC and PDGF-DD form only homodimers, with PDGF-CC binding to PDGF -receptor homodimers or PDGF /ß-receptor heterodimers13
and PDGF-DD binding to PDGF ß-receptor homodimers or PDGF /ß-receptor heterodimers.12
After vascular injury of a normal artery, increased levels of PDGF-A and PDGF ß-receptor have been detected primarily in SMC neointima.14
In vascular grafts15
and atherosclerosis,16
which have a significant inflammatory component, macrophages are a major source of PDGF-A and PDGF-B, whereas SMC in the neointima express both PDGF-A and PDGF-B to a lesser extent. Increased expression of the PDGF ß-receptor is also observed. Although weak staining for PDGF-C has been observed in medial SMC of the normal arterial wall11
and PDGF-D mRNA has been detected in circulating leukocytes,10
changes in the expression of PDGF-C and PDGF-D have not been analyzed after injury or in atherosclerosis.
A role for PDGF in attracting SMC has been established in models of restenosis and vascular grafts,17-22 in which the increase in SMC occurs within the first 2 to 4 weeks after injury or implant. However, SMC accumulation in atherosclerosis occurs over decades in humans and many months in animals placed on high cholesterol diets that accelerate lesion formation.23 Protracted lesion formation requires a prolonged period of treatment and poses problems for experimental investigation, particularly with the administration of blocking antibodies. Studies in which endogenous neutralizing antibodies were induced in rabbits before initiation of the atherosclerotic diet24,25 and PDGF receptor antibodies were administered long term in the ApoE null mouse model of atherosclerosis26 have suggested the possibility that blockade of PDGF or the PDGF ß-receptor can reduce lesion size. In this study, we have examined lesions in detail in ApoE -/- mice at extended time points and used two different approaches to test the role of PDGF in SMC accumulation in advanced lesions of atherosclerosis: hematopoietic chimeras lacking PDGF-B in their circulating cells and mice treated daily with a PDGF receptor antagonist. Although we demonstrate evidence that PDGF can transiently delay SMC accumulation in ApoE -/- mice at 35 weeks, neither method of blockade is able to prevent formation of advanced fibrous caps analyzed at 45 and 50 weeks.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Antibodies used for immunostaining include: Mac-2 antibody for macrophages,27
a rat anti-mouse monoclonal antibody (ATCC, Manassas, VA, monoclonal supernatant diluted 1:4), PGF-007, a mouse monoclonal antibody to PDGF-B16, and anti--actin (DAKO, Carpinteria, CA) for SMC.
Animals
Male ApoE -/- mice were purchased from the Jackson Laboratory (Bar Harbor, ME) at the age of 5 weeks. This strain was produced by backcrossing the ApoEtmlUnc-null strain 10 times to C57BL/6J (G10). PDGF-B +/- mice that are 129 Ola/C57BL/6J3 were backcrossed 6 times with ApoE -/- (G6) mice in the Department of Medical Biochemistry, University of Göteborg (Göteborg, Sweden). All experimental protocols were approved by the Animal Care Institutional Review Board (University of Washington) or the IACUC Review committee (COR Therapeutics, Inc., South San Francisco, CA). Details describing first generation PDGF-B null hematopoietic chimeras have been published.28 In this study, male ApoE -/- recipients of 7 to 8 weeks were prepared by total body irradiation in a single 14-Gy fraction from dual-opposed Co-60 sources at an exposure rate of 20 cGy/min on the day before transplant. The next day, 5 x 106 to 10 x 106 viable marrow cells from a pool of first generation chimeras (repopulated with fetal liver cells from ApoE null/PDGF-B +/+ or -/- E16.5 fetal livers from littermate embryos) were injected into each recipient through the lateral tail vein.
Treatment with PDGF Receptor Antagonist
The PDGF receptor antagonist CT5292329 was pulverized using a mortar and pestle and suspended in 0.5% methyl cellulose. The suspension of CT52923 or 0.5% methyl cellulose (vehicle) was orally administered to ApoE null mice at a dose of 60 mg/kg once daily from 8 weeks of age to the time of sacrifice. Plasma samples were obtained at various time points to measure cholesterol levels, drug concentration, and ability to inhibit ex vivo PDGF receptor tyrosine kinase phosphorylation.
Blood Analyses
Venous blood (100–200 µl) from chimeras was obtained from the orbital venous plexus without killing the mice or from the heart at the time of sacrifice. Peripheral blood cell counts were measured at the Phoenix Central Laboratory (Everett, WA). Plasma cholesterol levels were measured at the Northwest Lipid Research Laboratories (Seattle, WA). Plasma concentrations of the PDGF receptor antagonist CT52923 were determined by high pressure liquid chromatography (HPLC, detection limit 0.5 µg/ml), and the ability of the plasma to inhibit PDGF receptor phosphorylation was determined in an ex vivo receptor autophosphorylation assay.29 For analysis of mouse platelets with a chain-specific PDGF ELISA,30 blood was collected in sodium citrate (final concentration 0.37%), and the platelet-rich plasma was collected after centrifugation at 4°C for 15 minutes at 200 x g. Platelets were pelleted by centrifugation at 4°C for 15 minutes at 800 x g and then lysed for ELISA analysis.
Quantitation of Atherosclerotic Lesions in the Brachiocephalic Trunk
After mice were killed, they were perfusion-fixed with methyl Carnoy’s fixative. The aorta was dissected and fixed in methyl Carnoy’s for 48 hours. The brachiocephalic trunk (innominate artery), from the bifurcation off the aortic arch to the branching point to the right subclavian artery and common carotid artery, was dissected and embedded in a sandwich cassette. Using a random start site from a random number table and within the first 75 µm, we serially sectioned the entire brachiocephalic trunk (5-µm sections), and every 75 µm a section was stained with hematoxylin and eosin (H & E). All of the H & E-stained images were captured with a microscope equipped with a Hamamatsu CCD camera (Bridgewater, NJ). Lesion area was quantitated with NIH Image 1.59 software. The volume of the brachiocephalic trunk lesion was calculated by the Cavalieri stereologic method [
(lesion area) x (distance; 75 µm)]. All analyses were done without knowledge of the tissue source.
Collagen Quantitation, Fibrous Cap Scoring, and Area Analysis
Sirius red was used to stain collagen fibrils31 and quantitated using polarization microscopy. Images were captured with a Spot Insight digital camera (Diagnostic Instruments, Sterling Heights, MI), and collagen area was quantitated using a color threshold and Image-Pro Plus 4.5 Software (Media Cybernetics, Silver Spring, MD). Fibrous cap formation was evaluated in H & E-stained slides. All of the H & E-stained sections in the brachiocephalic trunk were examined randomly by a single observer without knowledge of the tissue source. The extent of fibrous cap formation was scored as four different levels: thick (greater than 4 elastic layers), intermediate (two to four elastic layers), thin (a single elastic layer), and no fibrous cap (foam cell lesion only with no fibrous cap). Elastic fibers in the fibrous cap identified in H & E-stained sections were verified by staining serial sections with Verhoeff-Van Gieson (VVG) and Gomori’s aldehyde fuchsin (GAF) elastin-specific stains.32 Fibrous cap lesion area was also evaluated for the most advanced lesion in each mouse by using the VVG-stained slides. Only the elastin-stained area was selected using Photoshop (Adobe Systems Inc., San Jose, CA) and quantitated with NIH Image 1.59. The VVG-stained area was expressed as a percentage of total lesion area.
Immunohistochemistry
All immunohistochemical procedures were performed as previously described.33 Endogenous peroxidase activity was blocked by incubating the tissue sections in 0.3% H2O2 with 1% sodium azide. Primary antibodies were incubated overnight at 4°C with the sections in 3% serum matched to the species of the secondary antibody. Biotinylated second antibodies were incubated for 30 minutes at room temp followed by 30 minutes with horseradish peroxidase-conjugated streptavidin (1/5000; ImmunoResearch Laboratories, Inc., West Grove, PA), and the antibody binding was visualized with diaminobenzidine (Sigma, St. Louis, MO). The percentage of lesion area occupied by staining for macrophages was quantitated as described for fibrous cap area analysis.
TaqMan Quantitative PCR
Peritoneal macrophages from PDGF-B chimeric ApoE -/- mice were collected four days after injection of 3% thioglycolate (BD Biosciences, San Diego, CA) into the peritoneal cavity. RNA was isolated with Trizol, followed by LiCl precipitation and RNeasy column (Qiagen, Inc., Valencia, CA) after removal of lymphocytes from the purified peritoneal macrophages with anti-CD2 selection. cDNA was primed by random hexamers and made from the extracted RNA by the use of the Superscript Preamplification System (Gibco/BRL, Rockville, MD). Transcript levels were quantitated by real-time PCR as previously described.34 Standard 18 seconds primers and TaqMan probe and custom-made PDGF B-chain primers and TaqMan probe were obtained from Perkin Elmer Biosystems (Foster City, CA): PDGF B-chain forward primer, tccggagtcgagttggaaag; reverse primer, ggcgattacagcaggctctg; probe, FAM-tcgagggaggaggagccta. Thermocycling was performed on the GeneAmp 5700 Sequence Detection System (Perkin Elmer) using the following parameters: 50°C for 2 minutes, 95°C for 10 minutes, then alternating 40 times between 95°C for 20 seconds and 50°C for 60 seconds. Threshold (CT) values were calculated by the GeneAmp 5700 SDS Detector software. Each sample was analyzed in triplicate PCR reactions accompanied by a standard curve and two no-template control reactions.
Macrophage RNA Preparation and RNase Protection Assay
Total RNA was isolated from peritoneal macrophages using Trizol reagent (Gibco/BRL). Peritoneal macrophages were collected from PDGF-B +/+ and -/- chimeras at 24 weeks (n = 1), 30 weeks (n = 3), 35 weeks (n = 2), and 45 weeks (n = 2) on day 4 after intraperitoneal injection of aged, sterile 3% thioglycolate (Difco Laboratories, Becton Dickinson Microbiology, Sparks, MD). Multiprobe template sets for mouse chemokines, cytokines, and their receptors (mCK-1, mCK-2b, mDK-4, mCK-5, mCR-1, mCR-3, and mCR-5) were purchased from PharMingen International (San Diego, CA). RNA probes were synthesized with -[32P]UTP (Amersham Pharmacia Biotech, Piscataway, NJ) and used within 2 days. RNase protection assays were performed according to the manufacturer’s instructions. Ten to 20 µg of total RNA was used in each hybridization reaction, and RNase-protected probe fragments were resolved on 0.4 mm 5% polyacrylamide gels containing 8 mol/L urea. After they were dried, the gels were quantitated by PhosphorImage analysis. L32 and GAPDH were used for normalization.
Statistical Analysis
Data are presented as means ± SEM. Statistical analyses used Wilcoxon rank sum (Mann-Whitney) test statistic with Instat 2.01 (Graphpad Software, San Diego, CA). A value of P < 0.05 indicates statistical significance.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Lesions of atherosclerosis result from focal accumulation within the arterial intima of mononuclear inflammatory cells from the circulation and SMC from the underlying media. PDGF is a potent stimulant of SMC migration and proliferation in culture, suggesting that PDGF may play a role in the accumulation of SMC in atherogenesis. We have directly tested the role of PDGF in the accumulation of SMC in vivo using ApoE -/- mice that develop complex lesions of atherosclerosis. Although targeted deletion of the PDGF A- or B-chain3,5
or PDGF receptor genes4,6
is embryonic lethal, we have developed chimeric mice in which fetal liver cells from PDGF-B-deficient embryos are used to replace the circulating cells of lethally irradiated ApoE -/- mice, and marrow from these chimeras were used to repopulate the marrow of lethally irradiated study mice (Figure 1)
.
|
and data not shown).
|
Blockade of PDGF ligands or infusion of PDGF in vivo in acute balloon injury models of the normal carotid artery has demonstrated a role for PDGF in the stimulation of SMC migration and proliferation responsible for SMC-rich neointimal formation.17-19
Analysis of injury-induced lesion formation with blocking antibodies to the two PDGF receptors further supports an involvement of PDGF in the accumulation of SMC in the neointima.20,22
In human atherosclerotic lesions and animal models of atherosclerosis, macrophages are a major source of PDGF-B.16
Similarly, in lesions of ApoE -/- mice (data not shown) and PDGF-B +/+ chimeras (Figure 2)
, many of the macrophages are positive for PDGF-B in foam cell-rich lesions (Figure 2A)
, as well as more advanced lesions (Figure 2E)
. Consistent with real-time PCR analysis of isolated cells, no staining for PDGF-B is observed in PDGF-B -/- chimeras (Figure 2D)
.
|
.33
To evaluate lesion volume, we examined the entire length of the brachiocephalic trunk (innominate artery) from a random start site within the initial 75-µm and determined lesion area at 75-µm intervals. As shown in Figure 3A
, lesion volume varies significantly within an individual experimental group and is comparable for PDGF-B +/+ and -/- chimeras.
|
. This is illustrated by a comparison of the fibrous caps in PDGF-B +/+ chimeras shown in Figure 3, F and H
, as compared with PDGF-B -/- chimeras in Figure 3, G and I
.
The maturity of the underlying lesion also appears different between the two chimeras. PDGF-B -/- chimeras appear to have a reduced frequency of cholesterol clefts and necrotic cores (Figure 3C)
and an increase in the content of macrophages (Figure 3D)
, as shown with an antibody to MAC-2 (compare Figure 3, J and K
). The PDGF-B -/- lesion is composed almost exclusively of lipid-laden macrophages (Figure 3, G, I, and K)
, whereas the PDGF-B +/+ lesion contains significant amounts of accumulated extracellular matrix, varying numbers of macrophages, and abundant cholesterol crystals (Figure 3, F, H, and J)
. However, the differences between PDGF-B +/+ and -/- chimeras do not quite reach statistical significance. This reflects the variability in the formation of any fibrous cap in both groups of chimeric mice (Figure 3E)
.
By 45 Weeks, Smooth Muscle Accumulation in the Fibrous Caps of Lesions Is Indistinguishable in PDGF-B +/+ and -/- Chimeras
To ensure more consistent formation of fibrous caps in all chimeras, lesions were analyzed in two separate, matched sets of mice after 45 weeks. As observed at 35 weeks, lesion volume remains indistinguishable between PDGF-B +/+ and -/- chimeras (Figure 4A)
. Although fibrous cap formation is more consistently observed in both groups of mice at 45 weeks, the frequency of intermediate and thick fibrous cap formation appears the same in PDGF-B -/- as compared with PDGF-B +/+ chimeras (Figure 4B)
. This is well illustrated by representative sections histochemically stained with GAF to highlight connective tissue components deposited by SMC that migrate from the media into the neointima (Figure 4, C and D)
. Thus, elimination of PDGF-B from circulating cells is not sufficient to prevent accumulation of SMC at late stages of atherosclerotic lesion formation.
|
To probe possible differences in cytokine gene expression between the PDGF-B +/+ and -/- chimeras that may contribute to the altered lesion characteristics of PDGF-B -/- chimeras, we purified total RNA from thioglycolate-elicited peritoneal macrophages from matched PDGF-B +/+ and -/- chimeras at 24 weeks (n = 1), 30 weeks (n = 3), 35 weeks (n = 2), and 45 weeks (n = 2). RNase protection assays were used to analyze expression of cytokines and cytokine receptors (Table 2)
. In elicited peritoneal macrophages, interferon (IFN)-
, interleukin (IL)-1, and IL-15 are all increased in PDGF-B -/- chimeras (Table 2)
, characteristic of activated macrophages.35,36
In contrast, the potent chemokines—monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1, and MIP-1ß, MIP-2, and RANTES—are all decreased in macrophages (Table 2)
. Two chemokine receptors (CCRs), CCR2 and CCR5, receptors for MCP-1 and RANTES, respectively, which are important in monocyte recruitment,37,38
are both increased in PDGF-B -/- elicited macrophages (Table 2)
.
|
Since it has been determined recently that an additional member of the PDGF gene family, PDGF-D, also binds to the PDGF ß-receptor,10,12
redundancy in the PDGF ligands may compensate for the absence of PDGF-B in macrophages that infiltrate the vessel wall to initiate lesion formation (Figure 5A)
. Furthermore, elimination of PDGF-B from the circulating cells does not exclude other PDGF ligands made by endothelial cells and SMC of the vascular wall. Therefore, we administered a small molecule PDGF receptor antagonist (CT52923) that potently inhibits the kinase activity of both PDGF receptors29
to analyze its effect on the progression of atherosclerosis in ApoE -/- mice (Figure 5A)
. This antagonist blocks the kinase activity of the PDGF receptors and the highly related stem cell factor receptor (c-kit) with an IC50 of 100–200 nmol/L, while 45- to 200-fold higher concentrations of CT52923 are required to inhibit fms-like tyrosine kinase-3 and colony-stimulating factor-1 receptor, two other closely related PDGF receptor family kinases.29
The efficacy of this drug in inhibiting the activity of PDGF ß-receptor was analyzed by oral administration of the drug to ApoE -/- mice. At various time points after administration, plasma samples were collected and evaluated by ex vivo phosphorylation assay (Figure 5B)
. At the concentration used to study lesion progression, the inhibitory effect of the antagonist was lost 12 hours after administration.
|
. Over the course of treatment, changes in the clearance of the inhibitor are not observed (data not shown). Plasma cholesterol levels among unmanipulated, vehicle, and antagonist-treated groups are comparable at all time points examined (Table 3)
. Body weight of the unmanipulated mice is greater than that of vehicle and antagonist-treated mice, most likely reflecting the stress of daily oral gavage (Table 3)
. However, the body weights of the vehicle and PDGF antagonist groups are comparable. Lesion volume in the brachiocephalic trunk was measured using the same approach as described for the PDGF-B chimeras. Lesion volume increases with time in the unmanipulated (control), vehicle, and PDGF receptor antagonist-treated mice, but lesion volume among the groups is comparable (Figure 6A)
.
|
|
. Even at 25 weeks, only two mice fail to show any evidence of fibrous cap formation in the brachiocephalic trunk (Figure 6B)
. Fibrous caps also are not observed in two mice at 35 weeks, but fibrous caps containing lesions are observed in the brachiocephalic trunks of all mice at 50 weeks (Figure 6, C and D)
. Analysis of the frequency of fibrous cap formation shows no difference at 25 weeks in thin or intermediate and thick fibrous caps among the three treatment groups (Figure 7, A and B)
. However, at 35 weeks, the frequency of advanced (intermediate plus thick) fibrous cap-containing lesions is less in the antagonist-treated group than in the vehicle or unmanipulated group (P < 0.05), while the frequency of thin fibrous cap-containing lesions is similar in the three groups (Figure 7, A and B)
. The decreased deposition of connective tissue at 35 weeks is further illustrated by the Masson’s trichrome staining of the PDGF receptor antagonist-treated mice (Figure 7D)
compared with the vehicle-treated mice (Figure 7C)
. Examination of Sirius red stained sections from the mice at 35 weeks by polarized microscopy demonstrated collagen birefringency in all of the lesions of vehicle-treated mice, but only in 5 of 14 mice treated with the PDGF receptor antagonist. At 50 weeks, the frequency of advanced (intermediate plus thick) fibrous cap-containing lesions is indistinguishable among the three groups (Figure 7, A and B)
, and the change in the antagonist-treated group between 35 and 50 weeks is also significant (P < 0.001), implying that the lesions in the antagonist-treated mice "caught up" between 35 and 50 weeks. Extensive deposition of connective tissue is observed in both groups at 50 weeks (Figure 7, E and F)
.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Although elimination of PDGF-B from circulating cells and blockade of both PDGF receptors appear to delay the formation of advanced lesions of atherosclerosis at 35 weeks, neither treatment was able to prevent formation of advanced fibrous caps at 45–50 weeks. The two approaches asked different questions, each with their own limitations. PDGF-B chimeric mice generated in this study express no detectable PDGF-B in their circulating cells by sensitive analysis of mRNA and protein. However, PDGF-B could still be made by endothelial cells and SMC within the vessel wall, and other chains of PDGF (PDGF-AA, PDGF-CC, and PDGF-DD) can be made by circulating and other cells in the vessel wall (Figure 4A)
. In contrast, our studies with the PDGF receptor antagonist should block all forms of PDGF. However, a limitation of the receptor antagonist study is that the extended dosing of these animals restricted our administration of the antagonist to once daily, a dose that provided blockade of PDGF receptors for 8 to 10 hours. The PDGF receptor antagonist used in our study (CT52923) shows a high degree of specificity for PDGF.29
Although other PDGF receptor antagonists have been described, they either have not been tested against a broad panel of kinases,39-41
or they have been shown to inhibit other kinases, (eg, STI1571, which also blocks Abl kinase).42
CT52923 further demonstrates specificity for PDGF in its inhibition of PDGF-stimulated proliferation and migration, whereas 50- to 100-fold higher concentrations are required to alter FGF-stimulated effects.29
Thus, the two approaches that we used to block PDGF are highly specific but fail to prevent advanced fibrous cap formation.
Our results contrast with recent reports from two groups that blockade of PDGF can decrease the size of lesions of atherosclerosis.24-26 In the rabbit studies, in which endogenous antibodies were induced by immunization with either PDGF-AA25 or PDGF-BB,24 lesions were evaluated 12 to 18 weeks after initiation of a 1% cholesterol diet. Lesion area evaluated by oil red O staining of the entire aorta shows a decrease of approximately 30%, and cross-sectional quantitation of aortic lesion-media ratios at a single site suggests up to 95% reduction. However, from the level of hypercholesterolemia achieved in these studies (800–1000 mg/dl), lesions at 12 to 18 weeks would be primarily foam cell-containing lesions with minimal or no SMC involvement.43 A more recent examination of ApoE -/- mice fed a high fat diet, together with administration of anti-PDGF ß-receptor antibodies between 12 to 18 weeks, indicates a 67% reduction in oil red O-stained lesion area in the aortic sinus.26 The reduction in lesion area is associated with an 80% reduction in SMC counts in the limited number of animals (4 animals per group) and sections examined. The use of the lipid stain oil red O to quantitate lesion area in both studies favors lipid-rich lesions and would not detect lesions rich in connective tissue, characteristic of advanced fibrous cap-containing lesions. Therefore, it is difficult to conclude the true extent and nature of the reported reduction of lesion formation in these other studies. Neither of these studies examined extended time points.
Analysis of Advanced Lesions of Atherosclerosis Highlights the Difficulty in Assessing Changes in the Formation of Very Advanced Lesions of Atherosclerosis
The discrepancy between our study and those recently published emphasizes the many obstacles in evaluating advanced lesions of atherosclerosis. Unlike acute injury of a vessel, such as balloon injury of the rat carotid artery, in which mechanical injury of the media results in an immediate proliferative and migratory response of SMC at the site of injury, the accumulation of SMC in advanced lesions of atherosclerosis proceeds over many weeks in the ApoE -/- animals.33
Although particular sites of lesion formation, such as the brachiocephalic trunk, are reproducible,33
the exact location of the most advanced lesion within that site varies between animals. The most advanced and largest lesions in the brachiocephalic trunk frequently are found in the first segment that represents the area immediately adjacent to the aorta (Figure 6C)
. However, very advanced lesions are also observed in the middle of the brachiocephalic trunk in the absence of extensive lesion development in the first segment adjacent to the aorta (Figure 6, B, C, and D)
. Thus, studies in which lesions have been quantitated at a particular distance from a bifurcation or other anatomical reference may not be evaluating the site of maximal lesion formation.
Our analysis of advanced lesion formation in the brachiocephalic trunk highlights the variability in the formation of fibrous cap-containing lesions among the mice, especially in the PDGF-B chimeras. We avoided use of a high fat/high cholesterol diet that is often used to accelerate lesion formation because the very high cholesterol levels in these mice lead to even more variability in the extent of lesion formation (unpublished observations).33 We also avoided analysis of the root of the aorta, a frequently reported site of lesion evaluation, because of the unusual anatomy of this site and the absence of lesions at this site in humans.44 Further, our unpublished observations agree with suggestions that aortic root atherosclerosis may not reflect atherosclerosis in other regions of the vascular tree.45,46 Potential differences in lesion progression at the brachiocephalic trunk versus the aortic root may partially explain the differences between our observations and those of Sano.26
The clinical manifestations of atherosclerosis appear to result primarily from thromboses formed after physical rupture of the advanced atherosclerotic plaque.47-51 Studies focused on late stage lesion development have quantitated changes in plaque characteristics, including content of macrophages, SMC, T-cells, collagen, lipid core, cholesterol clefts, and matrix metalloproteinases (this report).52-56 Characterization of these features after genetic manipulation is critical to understanding the susceptibility to plaque rupture, which has been highly correlated with lesion characteristics rather than lesion size.51,57-59
Does the Absence of a Prolonged Effect of PDGF Blockade on Fibrous Cap Formation Suggest Redundancy in Signals? How Might PDGF Blockade Enhance Lesion Formation?
The inability of either of our two approaches of PDGF blockade to induce a prolonged inhibition of fibrous cap formation in ApoE -/- mice suggests that other growth factors may be sufficient to promote SMC accumulation and connective tissue deposition. Consistent with this possibility, we recently reported that in PDGF-B hematopoietic chimeras in C57BL/6 mice, the absence of PDGF-B in circulating cells does not alter granulation tissue formation after sponge implantation despite an observed increase in vascularization in the PDGF-B -/- chimeras.34 However, in contrast, analysis of mice derived from chimeric blastocysts composed of a mixture of wild-type cells and cells with targeted inactivation of the PDGF ß-receptor demonstrates a selective advantage for fibroblasts expressing PDGF ß-receptors in granulation tissue formation.60 Even the 50% reduction in PDGF ß-receptor gene dosage in PDGF ß-receptor +/- cells reduces fibroblast participation by 85%. However, analysis of mice derived from chimeric blastocysts for the PDGF ß-receptor is more sensitive and will reflect a selective advantage of wild-type cells over mutant cells rather than a requirement for the receptor. The kinetics and the release of specific factors that promote SMC migration and proliferation also may differ between the foreign body response in the sponge model and in the more slowly progressing, chronic inflammatory response in atherosclerosis. Similarly, although fibroblasts with the PDGF ß-receptor have a selective advantage in wound healing, they do not have one during development.7 Thus, our studies suggest that PDGF is not required for SMC accumulation in advanced fibrous caps and that other growth factors may compensate for its absence or blockade.
Blockade of PDGF may also alter expression of other gene(s), which could promote SMC accumulation via alternative mediators. PDGF is known to regulate a number of genes,61
and the absence of some of these regulatory molecules could subsequently alter lesion progression. We probed peritoneal macrophages from PDGF-B +/+ and -/- chimeras and observed a significant shift in the expression of several cytokines and cytokine receptors (Table 2)
. Monocytes are the first cells to accumulate in developing lesions of atherosclerosis, differentiate into macrophages within lesions, and are present throughout lesion progression.58
In vitro studies have suggested that expression of the PDGF ß-receptor increases with macrophage differentiation.62
Thus, the absence of PDGF-B in circulating cells appears sufficient to modulate macrophage gene expression.
The genes that increase in the absence of PDGF-B include several pro-inflammatory genes characteristic of activated macrophages,35,36
specifically IFN-, IL-1, and IL-15. Increased levels of these genes would be predicted to promote atherosclerosis in the ApoE null mouse.63-66
The associated increase in the chemokine receptors CCR2 and CCR5 may be due to reduced levels of their ligands, MCP-1 and RANTES. These ligands were originally identified as immediate early genes in mesenchymal cells stimulated by PDGF.61,67,68
Reduced expression of MCP-1 and RANTES in peritoneal macrophages in the absence of endogenous PDGF-B suggests that they are PDGF-regulated early genes in macrophages as well. The decrease in macrophage expression of these potent monocyte chemoattractants does not prevent monocyte infiltration into lesions in PDGF-B -/- chimeras, and may be explained by the fact that other stimulants in atherosclerosis, such as oxidized LDL,69
are sufficient to induce expression of MCP-1 and other chemokines in the vessel wall. Overexpression of CCR5 has been shown to increase the migratory rate of T cells toward RANTES and MIP-1.70
Thus, higher levels of CCR2 and CCR5 expression could enhance monocyte and T cell accumulation in PDGF-B -/- chimeras and further promote lesion progression.
The data on altered cytokine and cytokine gene expression in macrophages from PDGF-B -/- chimeras suggest a shift toward a proinflammatory phenotype that could further enhance lesion development. Although our current data do not allow us to determine whether the gene alterations are linked to changes in lesion progression, they suggest that elimination of a potent "gene switch," such as PDGF, can significantly affect multiple components of the chronic inflammatory response responsible for the progression of lesions of atherosclerosis.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by National Institutes of Health grants HL18645 (to E.W.R. and R.R.), HL55257 (to P.J.M.), and HL07828 (training grant to J.T.); the Swedish Medical Research Council, Cancer Foundation, Inga-Britt and Anne Lundberg Foundation, and a grant from the Novo Nordisk Foundation (to C.B.); and Deutsche Forschungsgemeinschaft grant Ka1078/1 (to W.E.K.).
Current address of Koichi Kozaki: Department of Geriatric Medicine, University of Tokyo Hospital, Tokyo, Japan.
Accepted for publication June 5, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-receptor. Nat Cell Biol 2000, 2:302-309[Medline]
and ß receptor. J Biol Chem 2001, 276:27406-27414 and ß platelet-derived growth factor receptor in the vascular response to injury in nonhuman primates. Arterioscler Thromb Vasc Biol 1999, 19:900-909 and -ß blockade on flow-induced neointimal formation in endothelialized baboon vascular grafts. Circ Res 2000, 86:779-786 prevents vascular smooth muscle cell accumulation in fibrous cap lesions in apolipoprotein E-deficient mice. Circulation 2001, 103:2955-2960 elicits arteriosclerosis in the absence of leukocytes. Nature 2000, 403:207-211[Medline]
enhances atherosclerosis in apolipoprotein E-/- mice. Am J Pathol 2000, 157:1819-1824 in patients with multiple sclerosis: overexpression of chemokine receptor CCR5. Brain 2000, 123:1874-1882This article has been cited by other articles:
 |
|
 |
|
  J. A. Thomas, R. A. Deaton, N. E. Hastings, Y. Shang, C. W. Moehle, U. Eriksson, S. Topouzis, B. R. Wamhoff, B. R. Blackman, and G. K. Owens PDGF-DD, a novel mediator of smooth muscle cell phenotypic modulation, is upregulated in endothelial cells exposed to atherosclerosis-prone flow patterns Am J Physiol Heart Circ Physiol, February 1, 2009; 296(2): H442 - H452. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. B. Seidelmann, C. Kuo, N. Pleskac, J. Molina, S. Sayers, R. Li, J. Zhou, P. Johnson, K. Braun, C. Chan, et al. Athsq1 Is an Atherosclerosis Modifier Locus With Dramatic Effects on Lesion Area and Prominent Accumulation of Versican Arterioscler Thromb Vasc Biol, December 1, 2008; 28(12): 2180 - 2186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Andrae, R. Gallini, and C. Betsholtz Role of platelet-derived growth factors in physiology and medicine Genes & Dev., May 15, 2008; 22(10): 1276 - 1312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Dentelli, A. Rosso, A. Balsamo, S. Colmenares Benedetto, A. Zeoli, M. Pegoraro, G. Camussi, L. Pegoraro, and M. F. Brizzi C-KIT, by interacting with the membrane-bound ligand, recruits endothelial progenitor cells to inflamed endothelium Blood, May 15, 2007; 109(10): 4264 - 4271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Schwartz, Z. S. Galis, M. E. Rosenfeld, and E. Falk Plaque Rupture in Humans and Mice Arterioscler Thromb Vasc Biol, April 1, 2007; 27(4): 705 - 713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Keul, M. Tolle, S. Lucke, K. von Wnuck Lipinski, G. Heusch, M. Schuchardt, M. van der Giet, and B. Levkau The Sphingosine-1-Phosphate Analogue FTY720 Reduces Atherosclerosis in Apolipoprotein E-Deficient Mice Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 607 - 613. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. Alvarez, H. M. Kantarjian, and J. E. Cortes Biology of Platelet-Derived Growth Factor and Its Involvement in Disease Mayo Clin. Proc., September 1, 2006; 81(9): 1241 - 1257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kraemer, P. J. Baker, K. C. Kent, Y. Ye, J. J. Han, R. Tejada, M. Silane, R. Upmacis, R. Deeb, Y. Chen, et al. Decreased Neurotrophin TrkB Receptor Expression Reduces Lesion Size in the Apolipoprotein E-Null Mutant Mouse Circulation, December 6, 2005; 112(23): 3644 - 3653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Tang, K. Kozaki, A. G. Farr, P. J. Martin, P. Lindahl, C. Betsholtz, and E. W. Raines The Absence of Platelet-Derived Growth Factor-B in Circulating Cells Promotes Immune and Inflammatory Responses in Atherosclerosis-Prone ApoE-/- Mice Am. J. Pathol., September 1, 2005; 167(3): 901 - 912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. K. Whalin and W. R. Taylor Rounding up the usual suspects in atherosclerosis. Focus on "Growth factors induce monocyte binding to vascular smooth muscle" Am J Physiol Cell Physiol, September 1, 2004; 287(3): C592 - C593. [Full Text] [PDF]
|
|
|
|
 |
|
 J. Rodel, D. Prochnau, K. Prager, J. Baumert, K.-H. Schmidt, and E. Straube Chlamydia pneumoniae Decreases Smooth Muscle Cell Proliferation through Induction of Prostaglandin E2 Synthesis Infect. Immun., August 1, 2004; 72(8): 4900 - 4904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. K. Owens, M. S. Kumar, and B. R. Wamhoff Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease Physiol Rev, July 1, 2004; 84(3): 767 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Lassila, T. J. Allen, Z. Cao, V. Thallas, K. A. Jandeleit-Dahm, R. Candido, and M. E. Cooper Imatinib Attenuates Diabetes-Associated Atherosclerosis Arterioscler Thromb Vasc Biol, May 1, 2004; 24(5): 935 - 942. [Abstract] [Full Text]
|
|
|
|
|
|
O. Leppanen, J. Rutanen, M. O. Hiltunen, T. T. Rissanen, M. P. Turunen, T. Sjoblom, J. Bruggen, G. Backstrom, M. Carlsson, E. Buchdunger, et al. Oral Imatinib Mesylate (STI571/Gleevec) Improves the Efficacy of Local Intravascular Vascular Endothelial Growth Factor-C Gene Transfer in Reducing Neointimal Growth in Hypercholesterolemic Rabbits Circulation, March 9, 2004; 109(9): 1140 - 1146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. S. Buetow, K. A. Tappan, J. R. Crosby, R. A. Seifert, and D. F. Bowen-Pope Chimera Analysis Supports a Predominant Role of PDGFR{beta} in Promoting Smooth-Muscle Cell Chemotaxis after Arterial Injury Am. J. Pathol., September 1, 2003; 163(3): 979 - 984. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
