| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |





From the Cardiology Research Laboratory,* Childrens Hospital of Philadelphia, Philadelphia, Pennsylvania; the Departments of Medicine and Pharmacology,
University of Pennsylvania Medical Center, Philadelphia, Pennsylvania; and Wyeth-Ayerst Research,
Princeton, New Jersey
| Abstract |
|---|
|
|
|---|
5-HT receptor expression in heart valves or their interstitial cells has been the subject of several recent investigations.7,8 A total of 15 serotonin receptor subtypes have been discovered to date, and they may be subdivided further into seven subfamilies. All serotonin receptors, except for 5-HT3, belong to the superfamily of G-protein-coupled receptors. Previous studies have reported that 5-HT1B/1C and 5-HT2A/2BR subtypes are expressed in aortic valve cells from human, porcine, as well as canine aortic valves.7,8 Thus, in view of the well-established association of 5-HT with carcinoid cardiac valvulopathy, and the possibility of involvement of established receptor signaling pathways, we sought to carefully characterize 5-HT signaling in aortic valve interstitial cells (AVICs) with a long-term view toward both anticipating potential problems with serotonergic agents and the possibility of innovative therapies for heart valve disease. In the present studies, we investigated the hypothesis that our previous observation of 5-HT up-regulation of TGF-ß1 in SAVICs is because of 5-HT2R activity with associated G-protein signal transduction. Thus, we sought to functionally identify and characterize the 5-HT2R subtype(s) in SAVICs. 5-HT2R-mediated signaling pathways have been extensively studied in many cell types, such as mesangial cells, fibroblasts, and neurons.9-11 However, no studies of this nature have been performed with valvular interstitial cells. Therefore, our study also sought to characterize the signaling pathway for the SAVIC 5-HT2R.
| Materials and Methods |
|---|
|
|
|---|
Cell culture media consisting of M199 and Dulbeccos modified Eagles medium supplemented with penicillin, streptomycin, and fetal calf serum were all from Life Technologies, Inc. (Rockville, MD). Serotonin was obtained from Sigma (St. Louis, MO). Phospholipase C (PLC) inhibitor (U73122), protein kinase C (PKC) inhibitor (GF 109203X), Src-family tyrosine kinase inhibitor (PP1), and MEK inhibitors (PD98059 and U0126) were from BioMol (Plymouth Meeting, PA). Western analysis apparatus, precast gels, and polyvinylidene difluoride membranes were from BioRad (Hercules, CA). Phospho-specific-p44/42 mitogen-activated protein kinase E-10 monoclonal antibody was purchased from New England Biolabs (Beverly, MA) and nonphospho-specific-p44/42 mitogen-activated protein kinase polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Selective 5-HT2R antagonists/agonist (antagonists, MDL 100907, SB 242084, SB 206553, and the agonist, BW 723C86) were provided by Wyeth-Ayerst (Princeton, NJ). A replication defective adenovirus construct for overexpression of G
q under the control of the cytomegalovirus promoter (AdCMV-G
q) was provided by Dr. Morris Birnbaum (University of Pennsylvania School of Medicine, Philadelphia, PA), and was used as previously described by our group;6
a green fluorescent protein (GFP) adenovirus, AdCMV-GFP, was used as a control.6
Dr. Quanyi Li (Childrens Hospital of Philadelphia) provided cDNA obtained from AVICs cultivated from a human aortic valve specimen that was removed from a 2-year-old male heart transplant patient with congenital aortic valve stenosis and a ventricular septal defect.
Isolation and Cultivation of SAVICs
Sheep aortic valves were obtained from female sheep, age 6 months to 2 years at the time of sacrifice as approved by Institutional Committee for the Use and Care of Animals (IACUC) of Childrens Hospital of Philadelphia. Aortic valve leaflets were dissected and the endothelial cell layer was removed. The remaining tissues were cut by gentle rolling of the scalpel blade and were collected in a 15-ml Falcon tube containing 0.1% type I collagenase in M199 for incubation at 37°C for at least an hour with occasional vortex. Cells were then washed once and placed into culture plates in M199 supplemented with 10% fetal bovine serum, 2 mmol/L L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were passaged using 0.25% trypsin in 1 mmol/L ethylenediaminetetraacetic acid (Invitrogen, Carlsbad, CA) and used from passages 3 to 9.
PLC Assay
PLC activity was determined by a modification of the method from Berridge and colleagues.12 Briefly, cultured SAVICs in 6-well plates (3.5 x 105 to 4.5 x 105 cells per well) were labeled with myo-[3H] inositol (2.5 µCi/ml) for 24 hours in inositol-free Dulbeccos modified Eagles medium supplemented with 0.5% fetal bovine serum. After washing, cells were incubated in Dulbeccos modified Eagles medium (with 15 mmol/L LiCl) with or without various agonists or antagonists or combinations of both for 30 minutes to 1 hour unless otherwise indicated. Cell membranes (inositol-enriched region) were extracted using chloroform/methanol/HCl (1:2:0.05, by volume). Inositol 1-phosphate (InsP1), inositol 1,4-bisphosphate [Ins(1,4)P2], and inositol 1,4,5-triphosphate [Ins(1,4,5)P3] were eluted sequentially into scintillation vials with 0.2 mol/L ammonium formate/0.1 mol/L formic acid, 0.6 mol/L ammonium formate/0.1 mol/L formic acid, and 1.0 mol/L ammonium formate/0.1 mol/L formic acid, respectively, on an anion-exchange column (AG1X8 resin, formate form). Radioactivity was determined on a Beckman scintillation counter (LS-3801; Beckman, Irvine, CA). Triplicate wells were used in every applicable control or treatment. At least three independent experiments were performed for each treatment.
A luciferase assay for TGF-ß activity was performed using mink lung epithelial cells provided as a gift by Dr. D.B. Rifkin (New York University), that were stably transfected with a portion of the plasminogen activator inhibitor 1 promoter.13
Equal numbers of quiescent SAVICs (
4 x 105 cells) cultivated on collagen-coated six-well plates were treated with 10 µmol/L of 5-HT for 24 to 72 hours. After incubation, medium (test sample) was collected, centrifuged, and assayed for TGF-ß1 activity by PAI/L assay, as described by Abe and colleagues.14
Mink lung epithelial cells were cultivated in the presence of test samples for 14 hours at 37°C to assay luciferase activity for active, and separately, total TGF-ß activity (after heating at 80°C for 5 minutes).13
RNA Isolation
Confluent interstitial cells were trypsinized and homogenized. Total cellular RNA was extracted using a TRIzol extraction kit (Life Technologies, Inc.), according to the manufacturers instructions. The RNA concentration was quantitated by absorbance at 260 nm. The integrity was assessed by electrophoresis of 1 µg on an ethidium bromide-stained, formaldehyde-agarose minigel.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Sequence
Using
1 µg of total RNA, reverse transcription was performed with primer oligo-dT and reverse transcriptase (SuperScript First-Strand Synthesis System for RT-PCR kit, Life Technologies, Inc.). Because the full-length cDNA sequence of sheep serotonin receptor is not known, receptor sequences from several other species (human, mouse, and porcine) were compared and a consensus sequence was chosen for PCR primer design. Forward and reverse primers were designed for 5-HT1A (GACGGTCAAAAAGGTGGAGA, GCAGAAGGGCAGAACAAGAGCC), 5-HT2A (CAGTCCATCAGCAATGAGCAAA, CTGAGCCTGAATATACCGTGAA) and 5-HT2B (CCATCATGCATCTCTGTGCCATTTC, CCATCCAGCATYRCCAYCTTTTC). RT-PCR results were assessed by electrophoresis of the PCR product on ethidium bromide-stained, 1.5% agarose minigel. The expected band was excised. After cDNA extraction from the gel (Gel Extraction Kit; Qiagen, GmbH, Germany), the PCR product was sequenced using standard dideoxy methodologies. The information obtained from the sequencing was compared to other genes from the GenBank using the GCG (Genetics Computer Group) Wisconsin Package (Accelrys, San Diego, CA).
Immunoblot Analysis of Phosphorylated Extracellular Signal-Related Kinase (Erk) 1/2 Activity
Seventy to eighty percent confluent SAVICs were made quiescent by incubation in serum-free M199 overnight. Growth-arrested cells were incubated with or without 10 µmol/L of serotonin for 5 minutes unless otherwise indicated. When selective inhibitors were applied, they were added 30 minutes before the application of serotonin. SAVIC cellular protein was extracted in lysis buffer containing 0.1 mol/L Tris-HCL (pH 8.1), 1% Triton X-114, 10 mmol/L ethylenediaminetetraacetic acid, 0.2 mmol/L sodium orthovanadate, and a mixture of protease inhibitors (Complete Protease Inhibitor Cocktail Tablets; Boehringer Mannheim, GmbH, Mannheim, Germany) and protein concentration was determined by the Bradford method15 according to the instructions of the manufacturer (BioRad). Ten to 20 µg of total protein from each sample was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis precast gels and then transferred to a polyvinylidene difluoride membrane (BioRad). The membrane was probed with phospho-specific Erk 1/2 antibody (p-p44/42, New England Biolabs) or with a nonphospho-specific Erk 1/2 antibody (p44/42, Santa Cruz Technology).
Statistical Analysis
All values in the text and figures are presented as mean ± SE of three or more independent experiments. Results were analyzed with one-way analysis of variance followed by post test (Tukey-Kramer multiple comparisons test) or Students t-test. A value of P < 0.01 was considered statistically significant.
| Results |
|---|
|
|
|---|
PLC activity in cultured SAVICs is induced by serotonin in a dose-dependent (Figure 1A)
and time-dependent (Figure 1B)
manner. The effects of serotonin on PLC activity were continuously and significantly increased at 1 µmol/L and greater concentrations when serotonin was added to SAVICs for 30 minutes (Figure 1A)
. PLC activity, while maintaining basal levels (control) at 1 or 5 minutes, was significantly increased after 15 minutes of 10 µmol/L of serotonin exposure. This activity increase was sustained at the longer duration serotonin exposure times (30 and 60 minutes) (Figure 1B)
. To confirm the specificity of serotonin-stimulated PLC activity, the PLC inhibitor U73122 was used (Figure 1C)
. U73122 abrogated the serotonin-induced PLC activation. U73122 alone did not change the basal level expression of PLC activity. These data demonstrated the direct association between serotonin and increased PLC activity.
|
Based on studies with receptor subtype-selective antagonists and agonist, the response of serotonin-stimulated PLC activity appeared to be mediated exclusively by 5-HT2ARs. MDL 100907,13,16
a selective 5-HT2AR antagonist, was able to block completely the serotonin-stimulated PLC activity in a dose-dependent manner (Figure 2A)
. This decrease was significant (P < 0.01) when compared to PLC activity stimulated by serotonin even at the lowest dose (0.1 nmol/L) of MDL 100907 tested. However, SB 242084,17
a selective antagonist for 5-HT2CR (Figure 2B)
, did not inhibit the serotonin-stimulated PLC activity at any of the concentrations tested. Similarly, SB 206553,18
a selective antagonist for 5-HT2B/2CR (Figure 2C)
also had no effect on the serotonin-stimulated PLC activity except at the highest dose tested (1 µmol/L). BW 723C86,19
a specific 5-HT2BR agonist, did not stimulate PLC activity even at 10 µmol/L (Figure 2D)
. None of the antagonists had any effect on the basal level of PLC activity (control). The data clearly demonstrated that 5-HT2AR played an exclusive role in mediating the serotonin-induced PLC activity whereas 5-HT2B/2CR did not appear to be expressed in SAVICs.
|
|
|
Our study also demonstrated that serotonin increased Erk 1/2 phosphorylation activity in AVICs. Serotonin stimulated phosphorylated Erk 1/2 activity in a dose-dependent manner, as detected by specific antibodies against phosphorylated Erk 1/2 in the Western blot analysis (Figure 5A)
. Compared to the basal level expression of phosphorylated Erk 1/2 activity (control), 100 nmol/L or higher concentrations of serotonin after 5 minutes of exposure to SAVICs caused a notable increase in Erk 1/2 activity. The kinetics of serotonin (10 µmol/L)-induced Erk 1/2 phosphorylation were rapid and transient (Figure 5B)
. The activated Erk 1/2 reached a peak at 5 minutes and was quickly reduced to basal level activity by 10 minutes. Furthermore, mitogen- and extracellular- signal activated protein kinase kinase (MEK) mediates the Erk 1/2 activation by serotonin, because the MEK inhibitors U0126 and PD98059 completely inhibited the serotonin-stimulated phosphorylation of Erk 1/2 (Figure 6)
.
|
|
PKC Is Involved in Serotonin-Erk 1/2 Signaling Pathway
G
q is coupled to PLC, and subsequently to protein kinase C (PKC) activation.20-22
To study the role of PKC in mediating the serotonin-Erk 1/2 signaling pathway in SAVICs, GF109203X, a highly selective PKC inhibitor, was added to SAVICs for half an hour before 5 minutes of 10 µmol/L serotonin exposure. GF109203X attenuated serotonin-stimulated Erk 1/2 activity (Figure 7A)
, suggesting the involvement of PKC in the signaling pathway from 5-HT2AR to Erk 1/2 activation. To further investigate the role of PLC/PKC in this signaling, the effect of overexpression of G
q on Erk 1/2 phosphorylation activity was determined by using an adenoviral vector construct with constitutively active GTPase-deficient mutant G
q (AdCMV-G
q). SAVICs were exposed to various concentrations [plaque forming units (PFU)] of AdCMV-G
q or AdCMV-GFP (108 PFU) overnight. Compared to the effect of AdCMV-GFP on Erk 1/2 activity (similar to the control activity), AdCMV-G
q significantly increased Erk 1/2 phosphorylation at a dose of 105 PFU. This increase was greater at a higher concentration of AdCMV-G
q (106 PFU), and reached a plateau thereafter (Figure 7B)
. The data obtained with AdCMV-G
q provided further evidence for the involvement of PKC in mediating Erk 1/2 activation in SAVICs.
|
In addition to PKC, Src/Src-like tyrosine kinase has also been demonstrated to be involved in Erk 1/2 activation.23,24
Various concentrations of pyrazolopyrimidine (PP1, an inhibitor of Src/Src-like tyrosine kinases) were added to SAVICs for 30 minutes before an additional 10 µmol/L of serotonin exposure. This resulted in a dose-dependent decrease in 5-HT-stimulated Erk 1/2 phosphorylation activity (Figure 8)
. Taken together, our results demonstrated that both PKC and Src/Src-like tyrosine kinase are involved in mediating the stimulatory effects of serotonin on Erk 1/2 activity.
|
| Discussion |
|---|
|
|
|---|
q-PLC-PKC signal transduction pathway. Although the exact sequence of signaling events in this pathway leading ultimately to valve disease is unknown, another study by our group has demonstrated that serotonin-induced up-regulation of TGF-ß, and a related increase in extracellular matrix components (collagen and glycosaminoglycans), may contribute to the mechanism of serotonin-related heart valve disease.6
Our studies also showed that the 5-HT2AR antagonist, MDL 100907, inhibited TGF-ß1 up-regulation. Thus, the present results strongly support the view that 5-HT-induced heart valve disease may occur via a pathway including the 5-HT2AR with G-protein signal transduction leading to the up-regulation of TGF-ß1, as previously demonstrated,6
with hypothesized associated pathophysiological effects on both cuspal cellular activity and the extracellular matrix.
Seven serotonin receptor subfamilies have been identified to date. The 5-HT2R subfamily is composed of three members (5-HT2A/2B/2CR). Each of them is known to be associated with G
q-PLC signal transduction.24,25
In SAVICs, we have shown the consistent finding of serotonin stimulation of PLC activity in a dose-dependent and time-dependent manner (Figure 1, A and B)
. The 5-HT2R-PLC coupling was also demonstrated because a PLC inhibitor U73122 was observed to abolish serotonin-induced PLC activity (Figure 1C)
.
The expression of the 5-HT2A/2BR has been demonstrated by others in human aortic valve cells and porcine aortic valve cells by real-time RT-PCR.7 Fitzgerald and colleagues7 demonstrated in human and pig aortic valve cells that there is a predominance of both 5-HT2A/2BRs, with relatively little detectable 5-HT2CR. Furthermore, Roths group21 demonstrated a comparable pharmacological response for the 5-HT2A and 5-HT2BRs for either 5-HT or phenfluoramine. However, it is recognized that right-sided valve involvement predominates in patients with the carcinoid syndrome.25,26 This is primarily because of the fact that excess serotonin is metabolized to a great extent by pulmonary monoamine oxidase activity, thus sparing left-sided valves from exposure to the highest serotonin levels.25,26 However, left-sided valve disease has been reported with combined use of serotonergic drugs and monoamine oxidase inhibitors,25 and left-sided valve disease requiring valve surgery has been reported in patients with carcinoid syndrome.26 Thus in view of the previous studies concerned with 5-HT2Rs and previous clinical research on left-sided valve disease related to serotonin effects,25,26 we elected to study AVICs in these initial investigations. Further studies will undertake a complete analysis of pulmonary and tricuspid valve cellular 5-HT responsiveness.
Our studies have used RT-PCR and 5-HT2R subtype-selective antagonists/agonist studies to demonstrate that 5-HT2AR was the main functional serotonin receptor present in terms of mRNA/protein levels in SAVICs (Figure 4, A and B
, and Figure 2A
). Furthermore, 5-HT-induced active TGF-ß1 activity was inhibited by MDL 100907, a selective 5-HT2AR antagonist (Figure 3A)
. There is no evidence for the presence of functional 5-HT2B and/or 5-HT2CRs in these cells, because selective antagonists for 5-HT2C and 5-HT2B/2CR did not inhibit serotonin-induced PLC activity, and an agonist for 5-HT2BR also did not stimulate PLC activity (Figure 2; B, C, and D)
. Given the fact that only mRNA expression of 5-HT2A/2B was demonstrated (associated with undetectable level of 5-HT2C) in human or porcine valve cells from the previous studies,7
it is possible that activity of 5-HT2BR is minimal while 5-HT2BR mRNA may still be expressed. In fact, we did not detect 5-HT2BR by RT-PCR in SAVICs as well (Figure 4C)
. However, the presence of 5-HT2BR mRNA in SAVICs cannot be ruled out. Because there are no available sheep 5-HT2BR sequences in GenBank, the primers designed for checking this receptor subtype contained the consensus sequences from human, porcine, and mouse (positive control of 5-HT2BR detected from HAVIC in Figure 4C
). Thus, the polyvinylidene difluoride results of our RT-PCR studies may be because of relatively large variations in sequences among the species for 5-HT2BR subtypes.
Serotonin has been shown to increase the production of collagen in mesangial cells through the actions of protein kinase C (PKC) and TGF-ß1 via the G-protein-PLC signaling pathway.27,28
5-HT2R signal transduction has also been reported to regulate extracellular signal-regulated kinase 1/2 (Erk 1/2) activation in smooth muscle cells, fibroblasts, and mesangial cells.27,29,30
Erk 1/2, a mitogen-activated protein kinase (MAPK), is involved in signal transduction from the cell surface to the nucleus. Phosphorylated active Erk 1/2 has been demonstrated to increase the production of extracellular matrix components such as collagen in many cell types including cardiomyocytes and fibroblasts.31-35
Thus, our study investigated whether Erk 1/2 can be activated by serotonin in SAVIC cultures. The present studies demonstrated a strong association of serotonin and Erk 1/2 phosphorylation in AVICs (Figure 5)
using concentrations of 5-HT in the same range demonstrated to stimulate a TGF-ß1-dependent increase in proline incorporation.16
The serotonin-induced Erk 1/2 activation was dose-dependent (Figure 5A)
and transient (Figure 5B)
. These rapid and transient signaling results are comparable to those observed in other cell types.36,37
However, 5-HT-induced TGF-ß1 RNA synthesis in SAVICs occurs with 3 hours of 5-HT addition (Figure 3)
6
and thus, could reflect the cumulative effects of 5-HT > Erk 1/2 signaling. It was also observed that increased serotonin-induced Erk 1/2 phosphorylation was only minimally decreased by the 5-HT2AR-specific antagonist MDL 100907 (Figure 6B)
at the relatively high concentrations of 100 nmol/L or more. A limited effect was seen mostly on Erk1 phosphorylation.
Thus, it is likely that other 5-HT receptors are present that are responsible for serotonin-induced Erk 1/2 phosphorylation. Although Erk 1/2 is well known for involvement in mitogenic signaling,38,39 5-HT had no effects on proliferation in the present studies. Nevertheless, there have been investigations by others40,41 demonstrating the involvement of Erk 1/2 in signaling pathways that did not involve mitogenic activity.40,41 Thus, 5-HT could activate multiple pathways in SAVICs, and those involving either Erk 1/2 or TGF-ß could be unrelated.
PKC was shown to be involved in mediating the serotonin-induced Erk 1/2 activation based on two lines of evidence: GF109203X, a PKC inhibitor, reduced Erk 1/2 activity induced by serotonin (Figure 7A)
; and constitutively active, GTPase-deficient mutant G
q adenoviral vector42
stimulated Erk 1/2 activity in SAVICs (Figure 7B)
. In addition to PKC, Src or Src-like tyrosine kinase also appeared to play an important role in the serotonin-mediated Erk 1/2 activation because the Src inhibitor PP143
reduced 5-HT-stimulated Erk 1/2 activity in a dose-dependent manner (Figure 7)
. Whether this effect is related to the association of PKC/Src complex44
or to a PKC-independent signaling pathway involving Src45
in SAVICs remains to be resolved.
The present data have a number of important implications. Because the abnormalities in the serotonin/serotonergic system may play an important role in heart valve disease, 5-HT2 serotonergic receptor blockers, such as the selective 5-HT2AR antagonist, MDL 100907,13,16
may eventually have therapeutic potential in the treatment of heart valve diseases. Furthermore, numerous pharmacologically relevant drugs could be screened in AVIC culture systems to determine the existence of potential stimulatory effects on the 5-HT2AR-G
q-PLC pathway.
| Conclusion |
|---|
|
|
|---|
| Acknowledgements |
|---|
q; and Dr. D. B. Rifkin (New York University) for providing his mink lung epithelial cells for TGF-ß assays. | Footnotes |
|---|
Supported in part by grants from the National Institutes of Health (RO1 HL38118 to R. J. L., RO1 HL48225 to B. L., T32 HL07915 to R. J. L., J. X., and B. J.), the Wyeth-Ayerst Research (research grant to B. L.), and the William J. Rashkind Endowment of the Childrens Hospital of Philadelphia.
Accepted for publication August 15, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
X. Gu and K. S. Masters Role of the MAPK/ERK pathway in valvular interstitial cell calcification Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1748 - H1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Liu and A. I. Gotlieb Transforming Growth Factor-{beta} Regulates in Vitro Heart Valve Repair by Activated Valve Interstitial Cells Am. J. Pathol., November 1, 2008; 173(5): 1275 - 1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fabre, J. Marchal-Somme, S. Marchand-Adam, C. Quesnel, R. Borie, M. Dehoux, C. Ruffie, J. Callebert, J-M. Launay, D. Henin, et al. Modulation of bleomycin-induced lung fibrosis by serotonin receptor antagonists in mice Eur. Respir. J., August 1, 2008; 32(2): 426 - 436. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gornemann, H. Hubner, P. Gmeiner, R. Horowski, K. P. Latte, M. Flieger, and H. H. Pertz Characterization of the Molecular Fragment That Is Responsible for Agonism of Pergolide at Serotonin 5-Hydroxytryptamine2B and 5-Hydroxytryptamine2A Receptors J. Pharmacol. Exp. Ther., March 1, 2008; 324(3): 1136 - 1145. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Donnelly Cardiac Valvular Pathology: Comparative Pathology and Animal Models of Acquired Cardiac Valvular Diseases Toxicol Pathol, February 1, 2008; 36(2): 204 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Liu, V. R. Joag, and A. I. Gotlieb The Emerging Role of Valve Interstitial Cell Phenotypes in Regulating Heart Valve Pathobiology Am. J. Pathol., November 1, 2007; 171(5): 1407 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Droogmans, P. R. Franken, C. Garbar, C. Weytjens, B. Cosyns, T. Lahoutte, V. Caveliers, M. Pipeleers-Marichal, A. Bossuyt, D. Schoors, et al. In vivo model of drug-induced valvular heart disease in rats: pergolide-induced valvular heart disease demonstrated with echocardiography and correlation with pathology Eur. Heart J., September 1, 2007; 28(17): 2156 - 2162. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ogden, J. M. Thompson, Z. Hickner, T. Huang, D. D. Tang, and S. W. Watts A new signaling paradigm for serotonin: use of Crk-associated substrate in arterial contraction Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2857 - H2863. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Liang, L.-P. Lai, B.-W. Wang, S.-J. Juang, C.-M. Chang, J.-G. Leu, and K.-G. Shyu Mechanical stress enhances serotonin 2B receptor modulating brain natriuretic peptide through nuclear factor-{kappa}B in cardiomyocytes Cardiovasc Res, November 1, 2006; 72(2): 303 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Levy Serotonin Transporter Mechanisms and Cardiac Disease Circulation, January 3, 2006; 113(1): 2 - 4. [Full Text] [PDF] |
||||
![]() |
A. Mekontso-Dessap, F. Brouri, O. Pascal, P. Lechat, N. Hanoun, L. Lanfumey, I. Seif, N. Benhaiem-Sigaux, M. Kirsch, M. Hamon, et al. Deficiency of the 5-Hydroxytryptamine Transporter Gene Leads to Cardiac Fibrosis and Valvulopathy in Mice Circulation, January 3, 2006; 113(1): 81 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Miller SEROTONIN 5-HT2C RECEPTOR AGONISTS: POTENTIAL FOR THE TREATMENT OF OBESITY Mol. Interv., October 1, 2005; 5(5): 282 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Elangbam, R. M. Lightfoot, L. W. Yoon, D. R. Creech, R. S. Geske, C. W. Crumbley, L. D. Gates, and H. G. Wall 5-Hydroxytryptamine (5HT) Receptors in the Heart Valves of Cynomolgus Monkeys and Sprague-Dawley Rats J. Histochem. Cytochem., May 1, 2005; 53(5): 671 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. I. Gustafsson, K. Tommeras, I. Nordrum, J. P. Loennechen, A. Brunsvik, E. Solligard, R. Fossmark, I. Bakke, U. Syversen, and H. Waldum Long-Term Serotonin Administration Induces Heart Valve Disease in Rats Circulation, March 29, 2005; 111(12): 1517 - 1522. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Nebigil and L. Maroteaux Functional Consequence of Serotonin/5-HT2B Receptor Signaling in Heart: Role of Mitochondria in Transition Between Hypertrophy and Heart Failure? Circulation, August 19, 2003; 108(7): 902 - 908. [Full Text] [PDF] |
||||
![]() |
V. Setola, S. J. Hufeisen, K. J. Grande-Allen, I. Vesely, R. A. Glennon, B. Blough, R. B. Rothman, and B. L. Roth 3,4-Methylenedioxymethamphetamine (MDMA, "Ecstasy") Induces Fenfluramine-Like Proliferative Actions on Human Cardiac Valvular Interstitial Cells in Vitro Mol. Pharmacol., June 1, 2003; 63(6): 1223 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Jian, J. Xu, J. Connolly, R. C. Savani, N. Narula, B. Liang, and R. J. Levy Serotonin Mechanisms in Heart Valve Disease I: Serotonin-Induced Up-Regulation of Transforming Growth Factor-{beta}1 via G-Protein Signal Transduction in Aortic Valve Interstitial Cells Am. J. Pathol., December 1, 2002; 161(6): 2111 - 2121. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |