| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
4ß7 Expression and Immunoglobulin Configuration Suggest an Origin from Local Antigen-Experienced B Cells


From the Departments of Pathology*and Gastroenterology,
Academic Medical Center, Amsterdam, The Netherlands; and the Department of Pathology,
Centre Hospitalier Universitaire Sart-Tilman, Liege, Belgium
| Abstract |
|---|
|
|
|---|
4ß7 integrin, an established mucosa-homing receptor also expressed by normal intestinal B and T lymphocytes and by low-grade mucosa-associated lymphoid tissue lymphomas. However, the chemokine receptor CXCR3, expressed on low-grade mucosa-associated lymphoid tissue lymphomas, was not detected on the GI-FLs or on nodal FLs. The combined data suggests that primary FL of the small intestine is a distinct entity that originates from local antigen-responsive B cells.
In the lymph nodes, FL is one of the most common B-NHLs and, by consequence, has been extensively studied. In its classical form, this neoplasm consists of follicular structures that harbor centrocytic and centroblastic tumor cells. These cells proliferate within networks of nonneoplastic follicular dendritic cells, similar to the GC B cells of so-called secondary lymphoid follicles.12 Like their normal counterparts, the tumor B cells generally express CD10, CD38, and BCL-6 in addition to pan B-cell markers.12-14 Nodal FLs most often express surface IgM (sIgM) and sIgD, less frequently sIgG and rarely sIgA. At the molecular level, FLs are characterized by the t(14;18)(q32;q21) involving the Ig heavy chain (IGH) and BCL-2 gene loci.15,16 Because of this translocation, the oncogene BCL-2 is constitutively expressed, preventing cells from apoptosis.17,18 Molecular analyses of the variable (V) regions of IGH- and IGL- chain genes have further confirmed the germinal center (GC) origin of FLs: the IgVH and IgVL genes of FLs harbor significant numbers of nucleotide substitutions because of somatic hypermutation.19-21
It is remarkable that in all of the reported cases of primary duodenal FLs,5,6,8,9
including a large FL that invaded the pancreas,7
no evidence for distant or systemic disease was found. This low tendency to disseminate outside the GI tract, which clearly contrasts the behavior of nodal FL,12
may be because of expression of specific adhesion molecules and/or dependence on local stimuli such as antigen or chemokines.22
Mucosal lymphocytes strongly express the
4ß7 integrin whereas its ligand, MAdCAM-1, is selectively expressed on mucosal endothelium.23,24
Accordingly, mucosa-associated B-NHLs, such as low-grade MALT lymphomas and mantle zone lymphomas presenting as malignant lymphomatous polyposis, have been shown to express the mucosal homing receptor
4ß7.25,26
In addition, it has been reported that intestinal epithelial cells produce a number of chemokines, ie, CLL25 (TECK),27,28
CCL5 (RANTES),29
CCL9 (MIG), CCL10 (IP10), and CCL11 (I-TAC).30,31
The respective receptors for these chemokines, CCR9, CCR5, and CXCR3 are expressed by
4ß7+ T lymphocytes present in the lamina propria and in the epithelium.27,28,30-32
Interestingly, it has recently been shown that CLL25 (TECK) also attracts IgA-secreting cells to the intestine.33
Furthermore, CXCR3 is expressed by a small subset of peripheral B cells and by distinct types of B-cell malignancies such as low-grade MALT lymphoma, splenic marginal zone lymphoma, and B-cell chronic lymphocytic leukemia (B-CLL).34-36
However, CXCR3 expression has not been detected in nodal FLs.36
Thus, expression of adhesion molecules and chemokine receptors determine homing and dissemination of normal and malignant B cells.
To explore to what extent FLs of the small intestine resemble their nodal counterparts and on the other hand to explain their localized nature, we performed a detailed analysis of the configuration of the expressed IgVH chain genes and the expression of lymphocyte-homing receptors in four cases of GI-FL. The results of these studies strongly suggest that these lymphomas are the offspring of local antigen-responsive B cells.
| Materials and Methods |
|---|
|
|
|---|
Fresh tissue material of the four GI-FLs, originating from a small bowel resection in one case and from endoscopically taken biopsies in three other cases, was in part snap-frozen in liquid nitrogen and in part fixed in formalin and paraffin-embedded. Patient 1, a 60-year-old male, was admitted with nausea and vomiting because of an ileus. On laparotomy, a stricturing tumor of 3.7 cm in diameter was found that extended transmurally up to 1 mm from the serosa. Patients 2, 3, and 4 were females of 68, 45, and 35 years of age that underwent endoscopic examinations for nonspecific GI complaints. In patient 2, a lesion was seen in the pars descendens of the duodenum covering an area of 3 cm in diameter with a conspicuously nodular surface. A low-grade MALT B-cell lymphoma was suspected. In patient 3, a polypous tumor with a diameter of 1.5 cm was found in the area of the ampulla of Vater (see Figure 2A
). In patient 4 a lesion in the duodenum and focally in the ileum was found. In none of the four patients was histological evidence obtained for systemic disease. Patient 4 however, was treated chemotherapeutically based on demonstration of a t(14;18) by polymerase chain reaction (PCR) on bone marrow. All achieved a disease-free status. The clinical data of the patients are summarized in Table 1
.
|
|
Immunohistochemistry
The immunohistochemical stainings were performed on acetone-fixed cryostat sections and/or on formalin-fixed paraffin-embedded sections using the highly sensitive Powervision+ detection system (ImmunoVision Technologies, Daly City, CA). Endogenous peroxidase activity of cryostat sections was blocked with 0.1% NaN3 and 0.3% H2O2 in phosphate-buffered saline and of paraffin sections, after deparaffinization and rehydration with 0.3% H2O2 in methanol. Visualization of antibody binding was performed for the cryostat sections with 3-amino-9-ethylcarbazole (Sigma, St. Louis, MO), 0.03% H2O2 in sodium acetate, pH 4.9, and for the paraffin sections with 3,3'-diaminobenzidine (Sigma), 0.03% H2O2 in Tris-HCl, pH 7.6. The sections were counterstained with hematoxylin (Merck, Darmstadt, Germany). Monoclonal antibodies (mAbs) specific for CD10 (CALLA), IgM,
- and
-light chains (Becton and Dickinson, Erembodegem-Aalst, Belgium), IgG, IgA, CD20 (B-Ly1), CD21-L (DRC-1, R4/23), BCL-2 (124), and BCL-6 (PG-B6P) (DAKO, Glostrup, Denmark), CD38 (HIT2) (CLB, Amsterdam, the Netherlands), CXCR3 (1C6) (Pharmingen, San Diego, CA), and
4ß7 (Act-1)37
were used. mAbs for IgM, IgG, IgA,
,
, CD21-L,
4ß7, CD10, and CD38 were only used on cryostat sections, mAbs for CD20, BCL-2, BCL-6, and CXCR3 were used on cryostat and on paraffin sections. For the CXCR3, BCL-2, and BCL-6 mAbs, the paraffin sections were pretreated with citrate buffer (10 mmol/L, pH 6.5) at 100°C for 10 minutes.
Amplification and Analysis of t(14;18)
High-molecular weight DNA was obtained from frozen tissue specimens by lysis in sodium dodecyl sulfate and 100 µg/ml of proteinase K. The samples were digested at 56°C for 16 hours, followed by phenol-chloroform extraction and ethanol precipitation. After washing, the DNA samples were dissolved in distilled water. These genomic DNA samples were tested for the presence of the t(14;18)(q32,q21) using a PCR targeted at the BCL-2/JH breakpoint. The BCL-2 mbr2 primer was used in combination with a reverse JH consensus primer JH18.38 The PCR products were analyzed on a 1.5% agarose gel and subsequently purified. The purified PCR products were sequenced on both strands using the Big Dye terminator cycle-sequencing kit and an ABI sequencer (Perkin Elmer Corp., Norwalk, CT).
Microdissection and cDNA Synthesis
Microdissection of groups of cells was performed with a PALM laser-microbeam system [Positioning and Ablation with Laser Microbeams (PALM), GmbH, Bernried, Germany]. Frozen tissue sections of 10 µm were mounted on plastic membranes and stained for 1 minute with hematoxylin. For RNA analyses, samples of
50 cells were dissected out of tumor follicles and catapulted into a 20-µl cDNA reaction mixture (see below) and kept on ice. Without previous RNA isolation, cDNA was synthesized using 2 nmol of Pd(N)6 primer (Pharmacia Biotech, Roosendaal, The Netherlands) and 160 U of M-MLV reverse transcriptase (Live Technologies, Breda, The Netherlands). The reaction mixture further contained 8 mmol/L dithiothreitol, 1 mmol/L of each dNTP, 1x first strand buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2) and 24 U of RNase inhibitor (Boehringer Mannheim, Almere, The Netherlands). The reaction was performed for 15 minutes at 37°C after which the enzyme was inactivated during 10 minutes at 95°C. After cDNA synthesis, 20 µl of water was added.
Amplification of the VH Gene by PCR
The IGVH locus and the applied primers in the PCR reactions are schematically depicted in Figure 1
. VH family-specific PCRs were performed using different VH family-specific leader primers39
in combination with reverse primers specific for either C
(patients 1 and 3) or Cµ (patient 2). (Cµ1: 5' CGTATCCGACGGGGAATTCTC 3'; C
1: 5' TTCGCTCCAGGTCACACTG 3'). In the first round of amplification 1 µl of cDNA was used in a 25-µl PCR reaction volume. The PCR mixture contained 1x Taq buffer (20 mmol/L Tris HCl, 50 mmol/L KCl, pH 8.4), 0.2 mmol/L of each dNTP, 1.5 mmol/L MgCl2, 1 U of Taq polymerase (Life Technologies, Breda, The Netherlands) and 0.5 µmol/L of each primer. First, 10 PCR cycles were performed in the thermal cycler (PTC-100; MJ Research Inc., Watertown, MA) successively 30 seconds at 95°C, 20 seconds at 57°C, and 20 seconds at 72°C. The next 40 cycles of amplification consisted of 30 seconds at 95°C, 20 seconds at 55°C, and 20 seconds at 72°C. The reaction was completed for 6 minutes at 72°C. Under the same conditions, the complementary determining region 3 (CDR3) was amplified in a nested PCR reaction using 2.5 µl of the first PCR product in a 25-µl reaction volume using a forward primer specific for framework region 3 (FR3) in combination with an appropriate nested reverse C
or Cµ primers.39
The PCR products were analyzed on a 3% Methaphor agarose gel (FMC Bioproducts, Rockland, ME).
|
or Cµ primers. Also 2.5 µl of PCR product of the first VH family-specific PCR was used here in a 25-µl reaction volume under the same PCR conditions (VH3-FR1, 5'-TCCCTGAGACTCTCCTGTG-3') PCR products were analyzed on a 1% standard agarose gel. The PCR products were sequenced on both strands. The IgVH sequences found were compared with published germline IgVH sequences using the Vbase database40
and DNAplot41
on the internet (http://www.mrc-cpe.cam.ac.uk) to identify somatic mutations. The amino acid sequences of the CDR3 regions were analyzed using the National Center for Biotechnolgy Information Protein-BLAST program, option "search for short nearly exact matches" (http://www.ncbi.nlm.nih.gov/BLAST). Statistical Analysis
To calculate whether there is significant selection against replacement (R) mutations in the framework regions (FR), we used the binomial distribution model as proposed by Chang and Casali42 and the multinomial distribution model as proposed by Lossos and colleagues43 Because the framework regions are essential for the overall structure of the IgV region, in normal Ag-selected B cells counterselection for R mutations in these regions occurs. This results in lower replacement/silent ratios in the FR regions (R/S <1.5) than would be expected if mutations would occur by chance only (R/S = 2.9).
| Results |
|---|
|
|
|---|
We studied four cases of primary FL of the small intestine (see Materials and Methods). In patient 3, a typically polypous tumor with a diameter of 1.5 cm was found in the area of the ampulla of Vater (Figure 2A)
. Histologically, the tumors of all four patients consisted of dense infiltrates of predominantly small cleaved lymphocytes admixed with variable numbers of centroblasts and a few immunoblasts. The infiltrates displayed a clear nodular growth pattern reminiscent of normal lymph follicles (Figure 2, B and C)
. Starry sky macrophages, which are prominent in reactive germinal centers, were absent. Unlike in classical MALT-type lymphomas, the lymphoid cells did not infiltrate and destruct the gland epithelium, ie, no lymphoepithelial lesions were present. Immunohistochemistry demonstrated that the tumor cells consisted of mature CD20+ B cells, expressing the typical GC B-cell markers CD38, CD10, and BCL-6, which are also expressed by the vast majority of nodal FLs12-14
(Figure 2, D and F
; Table 2
). Interestingly, the tumor cells of patients 1, 3, and 4 were IgM-, IgG-, and IgA+ (Figure 2, G to I
; Table 2
). CD21-L (DRC-1) stainings demonstrated that the tumor cells expand mainly in networks of follicular dendritic cells (Figure 5
, Table 2
). However, BCL-2+ BCL-6+ IgA+ tumor cells were also found scattered in the lamina propria (Figure 2; E, F, and I)
. Like nodal FLs, all four GI-FLs were found to carry a t(14;18). The translocations in all cases involved the major breakpoint region (mbr), located in the 3' untranslated region of the BCL-2 gene, adjacent to one of the JH gene segments of the IGH locus (Table 2
and data not shown).15,16
|
|
We amplified the IgVH regions out of almost pure samples of tumor cells microdissected from frozen tissue sections of the GI-FL of patients 1, 2, and 3. In these experiments, separate PCRs were performed applying six VH family leader region-specific primers in combination with appropriate reverse constant heavy chain region-specific primers, being either C
1, in lymphomas 1 and 3 or Cµ1 in lymphoma 2 (Figure 1)
. On the PCR products thus obtained, not visible on agarose gel, a nested CDR3-specific PCR was performed using an FR3 region-specific primer, which anneals just 5' to the D gene, combined with a nested C
or Cµ region-specific reverse primer (Figure 1)
. Of each GI-FL, these nested CDR3 PCRs yielded sharp bands on agarose gel only in the condition that a VH3-specific leader primer had been used in the first PCR (Figure 3A)
. As this finding was reproducible in multiple tissue samples of each lymphoma we were confident that we had confirmed clonality and identified the IgVH genes, with their respective CDR3 regions, that were expressed by the lymphomas. To obtain sufficient amounts of PCR products for sequencing, nested PCRs on the primary VH3 PCR products were performed using a 5' primer annealing in the FR1 region in combination with the nested C
or Cµ reverse primers (Figures 1 and 3B)
. To ascertain that these nested IgVH products indeed originated from the tumor clones, we also performed a seminested CDR3 PCR on them. In all three cases, the obtained CDR3 products had sizes identical to the original CDR3 amplimers (not shown). The amplified IgVH genes were sequenced and analyzed. Of lymphomas 1, 2, and 3 we obtained VH sequences out of six, two, and six malignant follicles, respectively. GI-FL 1 used the V311 gene in combination with the JH4b gene, GI-FL 2 used the V3-48 and JH4b genes, and GI-FL 3 used the V3-7 and JH6 genes (Table 3)
. Corbett and colleagues44
proposed stringent criteria for the assignment of D genes: at least 10 constitutive nucleotides of identity are required to confidently assign a D gene segment. According to these criteria, we could not determine a D gene used in any of the three cases.
|
|
The GI-FLs of patients 1, 2, and 3 all expressed extensively mutated IgVH genes with, respectively, 40, 32, and 21 nucleotide differences in their VH genes compared to germline VH3 genes of closest homology (Figure 4
, Table 3
). We assessed the distribution of replacement (R) mutations versus silent (S) mutations over the CDR and FR regions. In all three cases the R/S ratios found in the FR regions were lower than those of the CDR regions (Table 4)
. According to the statistical analysis of Lossos and colleagues,43
in all cases the number of R mutations in the FR regions were significantly lower (P < 0.05) than would be expected if the mutations had occurred at random and in the absence of selective forces (Table 4)
. These data indicate that despite the high number of somatic mutations the overall structure of the IgVH and thus of the B cell receptor (BCR) was preserved in these lymphomas.
|
|
GI-FLs but Not Nodal FLs Express the Mucosa Homing Integrin
4ß7
Tissue sections of the intestinal and nodal FLs, MALT lymphomas, B-CLL, as well as normal tonsil, lymph node, and distal ileum (Peyers patches) were stained with monoclonal antibodies specific for
4ß7 and CXCR3, respectively (Figure 5
, Table 5
). Among the lymphomas, exclusively the GI-FLs and the low-grade MALT lymphomas expressed the mucosa-specific homing integrin
4ß7. By contrast, and in agreement with our previous results,26
the vast majority of nodal FLs and the GCs of lymph nodes were
4ß7-negative. In the normal ileum, the GCs displayed low expression of
4ß7, whereas the mantle zone B lymphocytes and lamina propria T lymphocytes were strongly positive (Figure 5
, Table 5
). However, unlike MALT lymphomas, both the intestinal and nodal FLs expressed CD38 but lacked CXCR3 expression. Thus, the GI-FLs resemble normal GC B cells of tonsil and Peyers patches (Figure 5
, Table 5
). In agreement with Jones and colleagues,36
we found that two of the three tested cases of B-CLL were strongly CXCR3-positive (Table 5)
.
|
| Discussion |
|---|
|
|
|---|
Cytologically and histologically the neoplasms were indistinguishable from their nodal counterparts. This morphological resemblance was supported by the immunohistochemical and molecular analyses. In addition to the pan B-cell surface protein CD20, the tumor cells expressed CD38, CD10, and BCL-6, markers typical of GC stage-derived B-cell malignancies and are generally not expressed by low-grade MALT or mantle cell lymphoma (Table 2)
.12-14
We established that the constitutive overexpression of BCL-2 is because of a t(14;18) also typical of nodal FLs.15,16,47
This indicates that with respect to the earliest genetic alterations, the pathogenesis of nodal and GI-FL is similar.
The Ig gene analyses demonstrated that all three analyzed GI-FLs carried heavily mutated IgVH regions proving that the tumor cells indeed had undergone GC stage-specific alterations (Figure 4
, Tables 3 and 4
). The mutation frequencies were significantly higher than those found in normal (post) GC B cells,21
compatible with a prolonged stay of the tumor cells in the GC environment. Moreover, we observed discrete nucleotide differences between molecular clones derived of each lymphoma (data not shown). Although this so-called intraclonal V gene diversity must be a reflection of the somatic hypermutation process, it is not certain to what extent this process continues during the tumor stage.20,48
Detailed analysis of the observed mutation patterns indicated that, at least at some time of development, counterselection for potentially harmful replacement mutations must have occurred in the FRs. These patterns, physiologically found in normal antigen-selected B cells, suggest that expression of an intact B-cell receptor (BCR) is also essential for the tumor cells to survive (Table 4)
.
It is intriguing that in three of our four GI-FLs analyzed, no evidence was obtained for distant or widespread disease and that these patients became disease-free after local therapy only. In patient 4 chemotherapeutical treatment was given, based on the demonstration of a t(14;18) by PCR on bone marrow. The localized nature of these neoplasms was most clearly illustrated in a patient described by Misdraji and colleagues7
in whom, despite the fact that the duodenal FL had a significant volume and had invaded the pancreas, there were no signs of metastasis. In our study, the localized nature may be because of the fact that in at least two of the four cases (ie, patients 2 and 3) the lesions happened to be diagnosed at a very early stage of disease. Still, this is in clear contrast to nodal FLs that are in majority systemic at the time of diagnosis, ie, Ann Arbor stage III or IV.12
Conversely, despite the systemic nature of the latter entity, the GI tract is not a frequent localization of primary nodal FLs. Thus supposedly, expansion of these neoplasms at mucosal sites depends on highly specific phenotypic qualities. In this respect, our observation that the GI-FLs differ from their nodal counterparts in that they express
4ß7, a well-defined mucosal homing receptor that is specifically expressed by normal mucosal lymphocytes and by low-grade MALT lymphomas,26
is highly significant (Figure 5
, Table 5
). Also the lack of CXCR3 expression is compatible with their origin, because this chemokine receptor was not found to be expressed by normal GC B cells of the GI tract either. MALT lymphomas, supposed to be derived of post-GC B cells, by contrast do express CXCR3 (Figure 5
, Table 5
).
Another explanation for their low metastasizing potential is invoked by the Ig analyses. The fact that three of the four analyzed GI-FLs express IgA is of note because this isotype is seldom expressed by nodal FLs. In fact, this finding again indicates that these lymphomas may originate from local, antigen-responsive precursor cells, as IgA is the principal Ig class of the mucosal immune system (Table 2)
. This contention, obviously supported by the presence and distribution of somatic mutations in IgVH, may imply that the BCRs expressed by these FLs still have binding capacity for antigens originating from the gut lumen. The localized nature of these GI-FLs may thus also be because of dependence on growth-supporting signals elicited by these BCR ligands potentially presented by follicular dendritic cells in the tumor follicles. The group of primary GI-FLs may therefore be an attractive entity to study the concept of antigen-driven lymphomagenesis in humans.
| Acknowledgements |
|---|
| Footnotes |
|---|
C. J. M. v. N. is a fellow of the Netherlands Royal Academy of Arts and Sciences and L. D. L. is a research associate of the Belgian National Fund for Scientific Research.
Accepted for publication September 19, 2002.
| References |
|---|
|
|
|---|
chain homologous to human VLA-4
. Cell 1989, 56:37-46[Medline]
4ß7 integrin mediates lymphocyte binding to the mucosal vascular addressin MAdCAM-1. Cell 1993, 74:185-195[Medline]
4ß7 in malignant lymphomatous polyposis of the intestine. Gastroenterology 1994, 107:1519-1523[Medline]
4ß7 in gastrointestinal non-Hodgkins lymphomas. Am J Pathol 1996, 150:919-927[Abstract]
This article has been cited by other articles:
![]() |
E. S. Jaffe, N. L. Harris, H. Stein, and P. G. Isaacson Classification of lymphoid neoplasms: the microscope as a tool for disease discovery Blood, December 1, 2008; 112(12): 4384 - 4399. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. van Maldegem, R. van Dijk, T. A. M. Wormhoudt, P. M. Kluin, R. Willemze, L. Cerroni, C. J. M. van Noesel, and R. J. Bende The majority of cutaneous marginal zone B-cell lymphomas expresses class-switched immunoglobulins and develops in a T-helper type 2 inflammatory environment Blood, October 15, 2008; 112(8): 3355 - 3361. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Sato, K Ichimura, T Tanaka, K Takata, T Morito, H Sato, E Kondo, H Yanai, N Ohara, T Oka, et al. Duodenal follicular lymphomas share common characteristics with mucosa-associated lymphoid tissue lymphomas J. Clin. Pathol., March 1, 2008; 61(3): 377 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Pals, D. J. J. de Gorter, and M. Spaargaren Lymphoma dissemination: the other face of lymphocyte homing Blood, November 1, 2007; 110(9): 3102 - 3111. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gulmann, V. Espina, E. Petricoin III, D. L. Longo, M. Santi, T. Knutsen, M. Raffeld, E. S. Jaffe, L. A. Liotta, and A. L. Feldman Proteomic Analysis of Apoptotic Pathways Reveals Prognostic Factors in Follicular Lymphoma Clin. Cancer Res., August 15, 2005; 11(16): 5847 - 5855. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |