| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |






From the Department of Gastroenterology, Hepatology, and Endocrinology,*Hanover Medical School, Hanover; the Heinrich-Pette-Institute for Experimental Virology and Immunology
and the Clinic and Policlinic of Internal Medicine,
University Hospital Hamburg, Eppendorf; and the Institute of Crystallography and Mineralogy,
Ludwig-Maximilians University, Munich, Germany
| Abstract |
|---|
|
|
|---|
Stem cells with the ability to differentiate into adult hepatocytes can also be derived from embryonic tissue. Embryonic stem cells differentiate into hepatic precursor cells in vitro, when appropriate mediators are supplied.14 Determined liver progenitor cells can be isolated and cultured from the early embryonic liver and from fetal liver.15 Fetal liver cells from rats and mice have been shown to differentiate into cells with biliary and hepatic phenotype after transplantation into recipient animals.16,17
Lack of normal nontransformed liver progenitor cell lines has resulted in limited understanding of the linear relationships of different stages of liver cell differentiation. Consequently, differentiation and transdifferentiation of stem cells into fully functional hepatocytes have been observed only after transplantation experiments in vivo. Genetic information at different stages of differentiation, however, is critical for our understanding of lineage commitment and development into parenchymal cells.
In the present study we combine cell transplantation with gene expression analysis in laser-microdissected tissue samples to characterize the in vivo differentiation of transplanted fetal liver progenitor cells. We generated quantitative expression data for the developmentally regulated genes albumin and alpha fetoprotein (AFP) and followed changes in gene expression levels throughout the liver regeneration process. Our results demonstrate that only 2 weeks after transplantation into uPA/RAG2 mice, differentiation toward a mature hepatic phenotype can already be detected despite ongoing proliferation of the transplanted cells in the regenerative liver.
| Materials and Methods |
|---|
|
|
|---|
Enhanced green fluorescent protein (EGFP)-transgenic mice (C57BL/6-TgN(ACTbEGFP)1Osb) were purchased from The Jackson Laboratory, Bar Harbor, ME). The uPA/RAG-2 mice were generated by crossbreeding of uPA-transgenic mice originally described by Sandgren and colleagues18 with the RAG-2 mouse as described elsewhere.19,20 All animals were maintained and handled in accordance with institutional guidelines. For preparing fetal liver progenitor cells from EGFP embryos (embryonic day 13.5) the livers were removed under the binocular microscope. Cells were isolated by collagenase/dispase (Roche, Mannheim, Germany) digestion for 20 minutes at 37°C. The cells were washed twice in cold Dulbeccos modified Eagles medium with 10% fetal calf serum, resuspended in phosphate-buffered saline (PBS) at 3 x 107 cells/ml and stored on ice. Intrasplenic transplantation of 1.5 x 106 cells in 13- to 21-day-old uPA/RAG-2 mice was performed under ketamine/rompun anesthesia. After 2, 4, and 6 weeks mice were sacrificed and the livers were removed, embedded in OCT, and snap-frozen in liquid nitrogen. One hour before sacrifice, 2 mg of BrdU solution was injected intraperitoneally for analysis of the proliferation activity.
Flow Cytometry
A 1:10 aliquot of the isolated fetal liver progenitor cells was incubated with a biotin-conjugated anti-mouse TER119 antibody (1:100 dilution) for 5 minutes on ice. Cells were washed and stained with a 1:100 dilution of a streptavidin-phycoerythrin conjugate (SAv-PE; both from BD Pharmingen, Heidelberg, Germany) for an additional 5 minutes on ice. After final washing the cells were analyzed in the presence of 1 µg/ml of propidium iodide with a FACSCalibur fluorescence flow cytometer (BD Biosciences, Heidelberg, Germany).
Staining Procedures
For hemalaun-eosin staining 5-µm cryosections were fixed with 4% p-formaldehyde (Merck, Darmstadt, Germany) in PBS for 5 minutes, washed, stained with hemalaun for 3 minutes, washed again, and stained with 0.5% eosin for an additional 3 minutes. After an additional washing step with water the slides were dehydrated in 70%, 96%, and 100% ethanol, and in xylol before they were embedded in DPX (Polysciences, Eppelheim, Germany).
Immunofluorescence staining of the dipeptidyl-peptidase (DPPIV) antigen was performed with acetone-fixed 5-µm cryosections using the anti-mouse CD26 (DPPIV) antibody (BD Pharmingen) in a 1:200 dilution. We used Cy3-labeled goat anti-rat IgG (Jackson ImmunoResearch/Dianova, Hamburg, Germany) in a 1:400 dilution as the second antibody and a 1:200 diluted AlexaFluor 488-labeled anti-EGFP antibody (A-21311; Molecular Probes, Leiden, The Netherlands) for detecting the EGFP-positive regeneration nodules, because their fluorescence is lost during acetone fixation.
For analysis of the proliferation activity the BrdU-labeling Kit I (Roche, Mannheim, Germany) was used according to the protocol given by the manufacturer with one exception: as the second antibody Cy3-conjugated goat anti-mouse IgG polyclonal antibody (Jackson ImmunoResearch) was used at a 1:200 dilution. For counterstaining of the nuclei we added 1 nmol/L of 4,6-diamidino-2-phenylindole (Sigma, Taufkirchen, Germany) and for visualization of the regeneration nodules (1:200 dilution) AlexaFluor 488-labeled anti-EGFP antibody during the incubation of the second antibody.
Laser-Manipulated Microdissection and Laser Pressure Catapulting
For laser-manipulated microdissection and laser-pressure catapulting we used the PALM Microbeam System (P.A.L.M., Bernried, Germany). The system was adapted to an inverted fluorescence microscope (Carl Zeiss, Oberkochen, Germany) and was equipped with a digital video camera and appropriate image analysis systems. Cryostat sections (10 µm) of livers from transplanted uPA-mice were mounted onto a 0.9-µm polyester membrane on thin microscope slides and kept at -20°C. Before performing laser-manipulated microdissection the specimens were dried at 37°C. EGFP-positive regeneration nodules were identified by fluorescence microscopy and areas with
50 cells were cut by laser-assisted microdissection. One µl of RLT lysis buffer (RNeasy kit; Qiagen, Hilden, Germany) was pipetted in a cap of a 0.5-ml Eppendorf tube, the cap was moved close to and above the specimen and the microdissected cell area was captured by laser-pressure catapulting. Afterward the cap was placed on its tube that was filled with an additional 9 µl of RLT buffer. The captured cell areas were collected by centrifugation at 8000 x g for 3 minutes.
RNA Preparation and cDNA Synthesis
The RNeasy Mini Kit (Qiagen) was used for isolation of total RNA of all samples. DNase digestion of 7 µl of total RNA was performed using 1 U DNase (Gibco Life Tech, Karlsruhe, Germany) with the supplied buffer in presence of 40 U of RNasin (Promega, Mannheim, Germany). For cDNA synthesis 10 µl of total RNA were mixed with 1 µl (100 ng) of T7-oligo dT primer 5' GCATTAGCGGCCGCGAAATTAATACGACTCACTATAGGGAGA(T)21ACG 3' and 9 µl of RT premix (4 µl 5x first strand buffer, 2 µl of 100 mmol/L dithiothreitol, 1 µl of 10 mmol/L dNTP, and 100 U Superscript II Polymerase (Gibco Life Tech). Samples were incubated for 45 minutes at 42°C followed by heat inactivation at 65°C for 15 minutes.
Quantitative Real-Time Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Specific mRNA were quantified using the TaqMan technique,21-23 the qPCR Core Kit (Eurogentec, Seraing, Belgium), and the iCycler system (Bio-Rad, Munich, Germany). Primers and hybridization probes were designed with the Primer3 software (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and were as follows: albumin: forward: 5'-CTCAGGTGTCAACCCCAA-3', reverse: 5'-TCCACACAAGGCAGTCTC-3', probe: 5'-FAM-CGTGGAGGCTGCAACAAACCTAGG-TAMRA-3', AFP: forward: 5'-GTTTTCTGAGGGATGAAACCTATG-3', reverse: 5'-GAAGCTCTTGTTTCATGGTCTGTA-3', probe: 5'-FAM-CTTCCACAAGGATCTGTGCCAAGC-TAMRA-3', GAPDH: forward: 5'AAGGAGTAAGAAACCCTGGACCAC-3', reverse: 5'-GAAATTGTGAGGGAGATGCTCAGT-3', probe: 5'-FAM-CACTGAGCAAGAGAGAGGCCCTATCC-TAMRA-3', EGFP: forward: 5'-CGACGGCAACTACAAGAC-3', reverse: 5'-TAGTTGTACTCCAGCTTGTGC-3', probe: 5'-FAM-ACTTCAAGGAGGACGGCAACATCCT-TAMRA-3'. Ten pmol/L of the primer and hybridization probes each were used in a reaction volume of 50 µl. The amplification protocol was: 30 seconds at 95°C, 35 seconds at 55°C for 40 cycles after an initial denaturation step of 10 minutes at 95°C. All experiments were done in triplicates and threshold cycle (Ct) values are given in means ± SD.
| Results |
|---|
|
|
|---|
EGFP-transgenic breeder pairs were phenotyped for green fluorescence of their naked skin and eyes using a standard blacklight lamp. Because EGFP homozygous mice were reported to be lethal,24
heterozygous mice were used with the consequence that some prepared fetal livers did not contain EGFP-positive cells. Nucleated cells express EGFP, but not mature red blood cells, which are the most common cells in fetal liver. Therefore, freshly prepared cells from fetal livers were characterized by flow cytometry (Figure 1, a and b)
. Of all isolated vital cells 92.5% showed TER119-positive staining (Figure 1c)
and were EGFP-negative. From the remaining 7.5% TER-negative cells the majority (85.1%, representing 6.4% of all cells) was EGFP-positive (Figure 1d)
, illustrating only a small proportion of EGFP-negative fetal livers in the initial tissue preparation procedure. The propidium iodide exclusion test revealed an overall vitality of 97.5%.
|
1 x 105 EGFP-positive/TER-negative cells (6.4% of total cells). From the analysis of at least six different specimens per liver we calculated a total of 100 to 150 EGFP-positive regeneration nodules representing 1 to 2% of the regenerated liver mass.
|
Two weeks after fetal liver progenitor cell transplantation, small EGFP-positive regeneration nodules were detectable by immunofluorescence in the uPA/RAG2 mouse liver. Hemalaun-eosin staining showed distinct regeneration nodules surrounded by diseased liver tissue (Figure 2, a and c)
as well as larger EGFP-negative parenchyma of endogenous regenerated liver cells. Four weeks (Figure 2, b and d)
and 6 weeks after the cell transplantation, the EGFP-positive nodules became larger and were more and more integrated in the EGFP-negative regenerated parenchyma, although some demarcation was visible most likely because of freezing and staining procedures.
|
|
4.8% of the fetal liver cells showed proliferation activity (Table 1
1.9% BrdU-positive nuclei), but 4 weeks and 6 weeks after transplantation the surrounding tissue shows no increased proliferation activity (Figure 4, e and f)
|
Gene expression profiling is a suitable tool for staging differentiating processes in the liver because transcripts of the fetal liver cell protein AFP are hardly detectable in adult tissue, whereas the RNA level of the major secretion protein albumin rises constantly during liver development. Regeneration nodules derived from the transplanted cells were identified by fluorescence microscopy and isolated by laser-mediated microdissection. In preliminary examinations a pool of five microdissected areas, each of
50 cells, has been proven to result in sufficient RNA quantities for 12 analyses, which are needed for expression profiling of four genes in triplicates. This amount of RNA gave Ct values in the same order of magnitude as obtained with 2 ng of standard cDNA. Therefore, the complete RNA of five pooled areas was transcribed into cDNA (20 µl) and diluted 1:3 for 12 x 5-µl sample volumes.
For the analysis of the eight different mouse liver samples, two iCycler runs had to be performed, including nontemplate controls and standard cDNA of adult and fetal (day 13.5) mouse liver (Table 2)
. Quantitative RT-PCR of 2 ng of fetal liver cDNA gave Ct values of 26.7 and 25.8 for albumin, of 29.3 and 27.2 for AFP and of 32.3 and 30.3 for the housekeeping gene GAPDH (Table 2)
, resulting in a difference of albumin and AFP expression of
1.4 to 2.6 cycles. For comparison, in 2 ng of adult liver cDNA Ct values of 24.1 and 23.5 were measured for albumin and Ct values of 32.6 and 31.5 for GAPDH, whereas the AFP expression was not detectable until cycle 38 in these samples. So, the albumin/AFP difference rises to >13.9 in adult mouse liver. No EGFP expression was found in our standard cDNA of fetal and adult liver from wild-type mice. These data were additionally shown in Figure 5a
, by normalizing the albumin and AFP expression as differences to the GAPDH Ct values.
|
|
These differences became even larger in regeneration nodules analyzed after 4 and 6 weeks. The AFP expression level was decreased under the detection limit (Ct > 38), whereby the albumin expression remained in the same range compared to GAPDH and EGFP expression. Analysis of the albumin/AFP differences (>10.2, >9.2, >10.5, >11.3, and >10.1; see mice nos. 1255 to 1308 in Table 2
) and of the normalized expression levels (Figure 5b)
demonstrates an even more differentiated gene expression profile, suggesting a terminal differentiation into mature hepatocytes of the transplanted fetal liver cells.
| Discussion |
|---|
|
|
|---|
The alb-uPA mice used as recipient animals for cell transplants express the uro-plasminogen protein exclusively in hepatocytes. The transgene destroys the hepatocytes after birth and induces a subacute liver failure. In the heterozygous state some host cells can delete the transgene and form large regeneration nodules.19,20 The transplanted EGFP-transgenic liver progenitor cells participated in tissue regeneration and formed cohesive cell clusters within the host liver of the uPA mice. The high frequency of small- and medium-sized EGFP-positive regeneration nodules in our experiments suggests efficient initial integration of fetal liver progenitor cells in the host liver and subsequent clonal expansion. The regeneration originating from the transplanted cells always competes with endogenous regeneration and is terminated with restoration of the normal liver mass. In contrast, repopulation models based on hematopoietic stem cell transdifferentiation have resulted only in a few, but large cell clones after a long period of positive/negative selection pressure.12
Identification of transplanted cells in the liver without tissue staining allowed us to follow and analyze the differentiation process during the early phase of liver regeneration. Recently, a contamination-free laser-assisted microdissection procedure was developed that is useful to isolate intact mRNA of frozen tissue samples.30-32 In dried cryosections we were able to identify the EGFP-positive cell clusters by fluorescence microscopy, precisely isolate the target cells by laser microdissection and generate RNA from the tissue samples. Normalized for the GAPDH and EGFP mRNA content we quantified mRNAs for the hepatocyte-specific proteins AFP and albumin. For the first time this experimental approach provides quantitative data of the in vivo differentiation process at the transcriptional level. In a previous study from our group albumin has been shown to be expressed at developmental stage embryonic day 11.5 in mice at a level comparable to AFP. At later stages the albumin mRNA level constantly increases and reaches a maximum in the adult liver (A. Jochheim et al, manuscript in preparation). AFP mRNA expression also rises during fetal development, although at overall lower levels compared to albumin, and drops to very low levels immediately after birth. The quantitative mRNA levels of both genes thus represent excellent markers of liver maturation and may characterize the transition of fetal liver progenitor cells into mature hepatocytes. The data show that 2 weeks after transplantation the differentiation process in the transplanted cells is already initiated. The (AFP-ALB) Ct value substantially increased compared to values obtained from the primary fetal tissue, but did not reach the level obtained for adult liver tissue. After 4 and 6 weeks AFP mRNA was not detectable anymore, whereas the albumin/GAPDH ratio reached levels comparable to adult liver. These data strongly suggest terminal differentiation of the transplanted fetal liver progenitor cells into mature hepatocytes after 4 to 6 weeks. The staining pattern of the DPPIV antigen, which is associated with the mature parenchymal cells in the liver,26 in EGFP-positive regeneration nodules also supports the obtained gene expression data. In 2- and 4-week-old cell clusters the DPPIV antigen staining appeared scattered and faint, whereas in 6-week-old nodules continuous networks with strong DPPIV staining had already formed.
It is notable that differentiation of fetal liver progenitor cells into mature hepatocytes occurred despite ongoing cell proliferation. BrdU pulse labeling showed a substantially increased proliferation index compared to normal liver tissue in 2-week-old regeneration nodules. After 4 weeks the index decreased but was still higher than in control tissue and dropped to levels comparable to normal liver tissue after 6 weeks. The BrdU-labeled nuclei were located predominantly in the periphery of regeneration nodules clearly indicating a growth of the cell clusters rather than increased turnover of cells caused by acute damage and apoptosis. Our data suggest that the differentiation pathway is distinct from the process leading to reactivation of AFP expression in carcinoma cells.33 In fact, Dabeva and colleagues34 have shown that cell division of hepatocytes is not associated with dedifferentiation and reactivation of AFP expression indicating dissociation of proliferation from AFP expression in hepatocytes.
Sandhu and colleagues35
reported that embryonic day 14 fetal liver progenitor cells derived from DPPIV+ rats showed a higher proliferation capacity compared to adult hepatocytes and proliferated for up to 6 month after transplantation into a DPPIV- host liver and subsequent partial hepatectomy. In our model we could not observe a further increase in the size of regeneration nodules derived from liver progenitor cells beyond the 6 week period. Similar results have also been observed by transplanting adult hepatocytes, because the hepatocyte proliferative stimulus lasts in uPA/RAG-2 mice
8 to 10 weeks after birth, until the transplanted hepatocyte mass becomes comparable to the liver mass of nontransgenic normal mice.
Quantitative RT-PCR has been performed with RNA from <50 microdissected cells or <2 ng of total RNA. In a previous study we were able to show, that combination of laser-mediated microdissection with a linear RNA amplification protocol36 makes even low abundance genes such as transcription factors accessible for molecular analysis (T. Cantz et al, manuscript in preparation). Our quantitative molecular approach may thus be applicable in the analysis of in situ differentiation involving scattered adult hepatic and extrahepatic stem cells. Recently, differentiation of adult stem cells into mature hepatocytes has been demonstrated in murine animal models as well as in humans. Transdifferentiation of bone marrow cells into liver progenitor cells and hepatocytes has been described.10-12 Generation of hepatocytes from bone marrow cells also occurs after allergenic liver transplantation in humans and is associated with the frequency and severity of rejection episodes.37 The molecular events, however, inducing differentiation and transdifferentiation in adult and embryonic/fetal stem cells are primarily unknown. Stage- and differentiation-specific gene expression patterns with quantitative PCR and genome-wide technologies may be helpful in unraveling the underlying molecular mechanisms and will be crucial for developing in vitro differentiation protocols for stem cell populations.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by grants of the Deutsche Forschungsgemeinschaft (OT 131/4-1 and PE 608/2-3).
Accepted for publication September 9, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Haridass, Q. Yuan, P. D. Becker, T. Cantz, M. Iken, M. Rothe, N. Narain, M. Bock, M. Norder, N. Legrand, et al. Repopulation Efficiencies of Adult Hepatocytes, Fetal Liver Progenitor Cells, and Embryonic Stem Cell-Derived Hepatic Cells in Albumin-Promoter-Enhancer Urokinase-Type Plasminogen Activator Mice Am. J. Pathol., October 1, 2009; 175(4): 1483 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Sharma, T. Cantz, R. Richter, K. Eckert, R. Henschler, L. Wilkens, A. Jochheim-Richter, L. Arseniev, and M. Ott Human Cord Blood Stem Cells Generate Human Cytokeratin 18-Negative Hepatocyte-Like Cells in Injured Mouse Liver Am. J. Pathol., August 1, 2005; 167(2): 555 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Eventov-Friedman, H. Katchman, E. Shezen, A. Aronovich, D. Tchorsh, B. Dekel, E. Freud, and Y. Reisner Embryonic pig liver, pancreas, and lung as a source for transplantation: Optimal organogenesis without teratoma depends on distinct time windows PNAS, February 22, 2005; 102(8): 2928 - 2933. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |