| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology, Fox Chase Cancer Center, Philadelphia, Pennsylvania
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Furin, a prototypic PC, is ubiquitously expressed and has been implicated in many physiological and pathological processes.3 Overexpression of this PC in human cancer has been well documented. It has been shown that furin levels are increased in lung,4 breast,5 and head and neck tumors.6 In addition, furin has been proposed as a marker of differentiation between non-small cell lung carcinomas (NSCLC) and small cell lung carcinomas (SCLC) since an elevated expression of this PC has been observed in the former.4
Metalloproteinases are a family of endopeptidases implicated in the degradation of most components of basement membranes and, hence, directly related to tumor cell invasion.7
Among the six groups in which these enzymes have been subdivided, membrane-bound metalloproteinases, MT-MMP’s, are characterized by their localization to the plasma membrane and intracellular activation.7
Six members have been described so far and some of them have been associated with cancer. Interestingly, all of them bear the recognition sequence for furin in the boundaries of their pro-domains.8
MT1-MMP, one of the best-studied invasion-related substrates associated with furin, plays a key role in the activation of progelatinase A.9,10
This MT-MMP, may represent the main bridge between furin and, ultimately, the biological effect, ie, degradation of the extracellular matrix.11
Furin inhibition with 
-1 PDX, a specific inhibitor of this PC,12
demonstrated that the levels of processed MT1-MMP as well as the invasion ability of cells was greatly diminished in head and neck squamous cell carcinoma (HNSCC) cell lines.13
On the other hand, some reports argue that MT1-MMP can be activated in a furin-independent manner suggesting that, at least in some systems, furin may not be crucial to tumor progression.14
Furin can process another metalloproteinase, stromelysin-3,15
which is able to degrade -1 proteinase inhibitor, a serin protease inhibitor,16
contributing to enhance extracellular matrix turnover.
In addition, furin can affect cell growth through processing of growth factors and growth factor receptors. Reduction in the levels of functional insulin growth factor receptor-1 (IGF-IR) by PDX-mediated inhibition of furin led to a drastic reduction in tumorigenesis and cell growth rate in HT-29, an aggressive colon cancer cell line.17
Other experiments, however, pointed to a potentially opposite effect. A furin-transfected MCF-7 breast carcinoma cell acquired greater dependence on estradiol and exhibited growth impairment18 at low estradiol concentration. Since the effects of furin overexpression on invasion and tumorigenesis were not previously examined, we transfected the furin cDNA into two moderately aggressive head and neck cancer cell lines. Invasion ability and proliferation of transfectants were analyzed in vitro and in vivo. Our results demonstrate that overexpression of furin significantly enhanced the advanced malignant phenotype of HNSCC cells.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
The human cell lines from HNSCC, SCC12, and SCC15 used in these experiments were obtained from the American Type Culture Collection (Rockville, MD). They were cultured in suspension minimal essential medium (S-MEM) (Sigma, St. Louis, MO) with 10% fetal bovine serum (FBS), 2 mmol/L L-glutamine, and 100 units/ml penicillin and 100 µg/ml streptomycin. For selection and culture of transfected cell lines, 400 µg/ml G418 were added.
Transfection of Cell lines
Cells were transfected with the mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA) or pcDNA3.1-furin. The latter plasmid was constructed as follows. Full-length coding sequence from human furin was amplified by PCR from the plasmid pSVL-fur (American Type Culture Collection).
The primers used were: 1) 5' primer: 5' GCCAAGCTTACCCCCATGGAGCTGAGGCCCTGGTTG 3' and 2) 3' primer: 5 GCGAATTCAGTGGGCTCATCAGAGGGCGCTCTGG 3'.
The primers were designed to include the 217ATG (5' primer) and the stop codon 2599TGA, which amplified a 2400-bp fragment. In addition, a Hind III site in the 5' and an EcoRI site in the 3' primer restriction sites were added to facilitate directional cloning. PCR conditions used consisted of an initial step at 94°C for 2 minutes, 30 cycles of annealing/synthesis at 72°C for 3 minutes 30 seconds, a denaturation step at 94°C for 1 minute, followed by a final extension of 68°C for 7 minutes. Sequencing checked the identity of the PCR product after elution of a 2.4-kb band in agarose gels. This HindIII/EcoRV fragment was cloned directionally in the corresponding sites in the multi-cloning site of the vector. Transfections were performed according to the manufacturer’s instructions (Lipofectamine, GIBCO, Carlsbad, CA). Colonies were selected from the transfection mixture with G418 800 µg/ml. For maintenance and culturing of transfectant clones, 400 µg/ml G418 were added to the medium. Separate clones of stable transfectants were used for further studies.
Cell Growth Assay
[3H]-thymidine incorporation was evaluated after plating in 2.0 x 104 cells/well in 96-well culture plates. Twenty-four hours after plating, cells were incubated in a growth arrest medium (0.5% FBS-MEM, L-Glu, Pen-Strep) for 24 hours. Then, cells were incubated an additional 24 hours either in the presence of serum or IGF-1 (Sigma, St. Louis, MO). When indicated, the furin inhibitor, decanoyl-Arg-Val-Lys-Arg-chloromethyl-ketone (CMK), 100 µmol/L was included in the incubation mixture. For the last 4 hours of incubation, 0.5 µCi/well [3H]-methylthymidine (Moravek, Biochemicals, Brea, CA) was added. After this period of time, cells were washed three times with phosphate-buffered saline (PBS) and treated with 10% trichloroacetic acid at 4°C for 30 minutes and washed three times with water. Cells were then rinsed with 70% ethanol and air-dried. Labeled DNA was dissolved with 200 µl 10 mmol/L NaOH, 1% SDS and counted with Scintiverse (Fisher, Pittsburgh, PA). Results are expressed as percent with respect to the vector-alone-transfected cells (when incubations were performed in the presence of serum) or to the vector-alone-transfected cells in serum-free medium (in the studies with IGF-1).
Western Analysis
Cells were grown to 80% confluency and washed three times with cold PBS. 0.1 to 1 ml of RIPA lysis buffer (1X PBS, 0.1% SDS, 0.5% Na deoxycholate, 1% Nonidet P-40) with the protease inhibitors 1 mmol/L aprotinin, 100 mmol/L PMSF, and 100 mmol/L Na3VO3 was added to the culture and incubated at room temperature for 2 minutes. Cells were scraped, passed through a 21-G needle and incubated at 4°C for 30 minutes. After a centrifugation at 10,000 x g for 5 minutes, the supernatant was separated. Aliquots of the cell lysates were fractionated by electrophoresis in SDS-PAGE, 8% for the analysis of furin and IGF-1R, and 10% for the analysis of MT1-MMP. The proteins were electroblotted to a nitrocellulose membrane and probed with the antifurin monoclonal antibody MON-152 (Alexis, San Diego, CA) and polyclonal anti-MT1-MMP antibody AB815 (Chemicon, Temecula, CA) and polyclonal anti-IGF-1Rß (C-19) (Santa Cruz, Santa Cruz, CA). Loading controls were performed using an -actin polyclonal antibody (I-19) (Santa Cruz). Densitometric analysis was performed with Imagequant 3.1 densitometer (Molecular Dynamics Amersham, Piscataway, NJ) using the software Iqv3.15.
Zymography
A total of 5 x 106 cells were grown overnight in serum-free S-MEM with 2 mmol/L L-glutamine. The conditioned media were concentrated to 200 µl by ultrafiltration (Centriprep 30, Amicon Millipore, Bedford, MA) and 40 µg were loaded in a 10% precast zymogram gel (Invitrogen). Proteins were renatured, developed, and stained according to the manufacturer’s suggestions. Zymography standards were purchased from Chemicon (Temecula, CA).
In Vitro Invasion Assay
The invasive ability of cells was assessed with Biocoat Matrigel invasion chambers (Becton Dickinson, Bedford, MA) and used following the manufacturer’s suggestions. Briefly, cells were trypsinized and 25,000 cells were suspended in serum-free S-MEM with 0.1% bovine serum albumin (BSA). In the inhibition studies, 100 µmol/L CMK (Alexis Corp, San Diego, CA.) was added to this medium. Medium containing 5% serum was used as chemoattractant. Incubation was performed for 22 hours. Cells that degraded the reconstituted extracellular matrix (ECM) and passed through the invasion chamber were fixed, stained, and counted. Experiments were performed in triplicate. Fifteen to 20 fields were counted per invasion chamber (a total of 3000 to 6000 cells per transfectant). Control inserts (Becton Dickinson, Bedford, MA) were used to assess the ability to migrate through the chambers.
In Vivo Invasion Assay
Tracheal transplants were prepared as described,19,20 Cells from each transfected cell line (5 x 105) were inoculated into de-epithelialized rat trachea (Zivic-Miller, Zelienople, PA). Eight to 16 tracheas were used. After cell inoculation, the tracheas were sealed and transplanted into the dorsal s.c. tissues of severe combined immunodeficient (Scid) mice. Tracheal transplants were removed surgically at 6 or 8 weeks, sectioned into 3-mm thick rings, and fixed in 10% formalin. After hematoxylin/eosin staining, the degree of invasion of the tracheal wall was determined by measuring the length of maximum penetration of the tumor cells into the tracheal wall. All microscopic images of cross-sections of tracheal transplants were digitized at x 40. The lengths were determined by measuring the distance between the luminal center and the most distant point of tumor invasion. If the lumen was obliterated, the distance measured was between the geometric center of the tumor mass inside the tracheal lumen and the most distant point of tumor invasion either inside or outside the tracheal wall. Each tracheal transplant was represented by two to six measurements corresponding to the number of cross-sections containing tumor cells. A mean was calculated for each tracheal transplant and for each group of transfected cells. The results were expressed in µm of penetration depth.
In Vivo Tumorigenicity
Either furin- or vector-alone-transfected cells (5 x 106) were injected into the s.c. tissues of Scid mice (five mice per cell line). Mice were shaved weekly to assess time of tumor development, appearance, and volume. Tumors were measured twice a week after the appearance of the first tumor for the pair of transfected cells by using a Vernier caliper. Volumes (V) of the tumors were obtained by using the following equation: V = [(L1 + L2)/2] x L1 x L2 x 0.526, where L1 and L2 are the length and width of the s.c. tumor.21
Immunohistochemistry
Furin immunohistochemistry of tumors was performed using paraffin-embedded material. All paraffin sections were subjected to antigen retrieval for 10 minutes in distilled water. MON-152 was used as primary antibody at a 1:100 dilution. An avidin-biotin-peroxidase kit (Vectastain Elite, Vector, Burlingame, CA) was used, followed by the chromagen 3,3-diaminobenzidine to develop the immunostain. Negative controls, not incubated with furin antibodies, were incubated with normal mouse IgG. All sections were counterstained with hematoxylin and mounted.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
In a previous study we demonstrated that expression of endogenous furin correlated with the aggressiveness of head and neck and lung SCC cell lines.6 Similarly, metastatic tumors exhibited higher levels of furin mRNAs and protein than their non-metastatic counterparts. These results suggested that elevated furin expression could be associated with aggressive behavior.
To demonstrate this association, stable transfection with the complete coding sequence of furin cDNA was performed. Based on the correlation between furin expression6
and the known in vivo growth behavior in immunosuppressed mice,22
two HNSCC cell lines (SCC12 and SCC15) were selected for transfection with the complete furin cDNA. SCC12 cells display a less malignant behavior than the moderately aggressive cell line, SCC15. Seven to 10 transfectants were analyzed in each case and selection of the clone to be used for future studies was based on the levels of furin expression and ability to process MT1-MMP, a key furin substrate directly related to degradation of ECM and to invasive behavior (Figure 1)
.
|
, A (SCC12) and B (SCC15). MTI-MMP processing was analyzed in cell lysates from vector-alone- and furin-transfected cell lines. As shown in Figure 1C
, the ratio of processed to unprocessed MT1-MMP in furin transfectants is higher than in their vector-alone counterparts. The vector-alone-transfected cells showed a ratio of 0.3 (SCC12) and 0.7 (SCC15). Transfection of furin and enhanced processing of MT1-MMP is reflected in the higher ratio of 5 and 1.5 for the SCC12 and 2.9 and 1 for the SCC15 furin transfectants. This processing of a key furin substrate demonstrates that, in these cell lines, furin transfection led to an enhanced activation of the metalloproteinase. Since enhanced MT1-MMP activation results in activation of progelatinase A (MMP-2),7 the enzyme that directly degrades collagen IV, the gelatinolytic potential of transfectants was evaluated. Gelatinase activity was consistently and significatively enhanced in the furin transfectants. Overexpression of furin resulted in a moderate increase in the levels of the mature MMP-2 form. The levels of MMP-2 are very low in these cell lines, in agreement with their low level of aggressiveness. However, a slight increase in the expression of MMP-2 was observed in the furin-transfected cells.
The colagenolytic activity corresponding to MMP-9 was also analyzed. Its activity was very low but detectable. Interestingly, only the unprocessed form of MMP-9 was observed in vector-alone transfectants (Figure 2A)
suggesting that furin may participate in MMP-9 activation.
|
. A fourfold increase in the number of SCC15 furin-transfected cells that were able to invade was observed. Similar results were obtained with SCC12, a less aggressive cell line. Although the absolute number of cells that invaded through the filter were lower than those seen in SCC15, the invasive ability enhancement was similar (four- to fivefold). No significant differences in migration were observed when assayed in control inserts, ie, without ECM coating. CMK-Inhibition of Furin Activity Reverts the Malignant Phenotype of HNSCC
The synthetic inhibitor CMK is a lipophilic furin inhibitor capable of penetrating the plasma membrane reaching the interior of the cell23 where it interacts with furin and blocks its catalytic site.24 Cells were plated and incubated in the presence of 0, 50, 100, and 250 µmol/L CMK for 2 days. No cell detachment, presence of vacuolation, or changes in the morphology was observed with concentrations as high as 100 µmol/L. Although no vacuolation or other abnormalities were observed after incubation with 250 µmol/L, roughly half of the cells detached. This concentration-dependent effect was observed in all cell lines, furin- or vector-alone-transfected. Trypan blue staining revealed that only 3 to 6% of the cells died when incubated at 100 µmol/L CMK. Based on this data, a concentration of 100 µmol/L was used in the following studies.
Inhibition of furin activity resulted in a reduction in the processing of MT1-MMP either in vector-alone or furin-transfectant cells (Figure 3A)
. In vitro invasion studies pointed in the same direction. Both control cell lines displayed a low invasive ability. After incubation with the inhibitor, very few or no cells were able to invade the coated filter. When furin-transfected cells were grown in the presence of the inhibitor, a remarkably regression in invasive ability was observed when compared to the untreated counterparts (Figure 3B)
.
|
Both the pro-receptor and the mature form of IGF-IR (approximately 105 kD) was observed in SCC12 cells transfected with vector-alone (Figure 4A
, lane 1) indicating some degree of endogenous furin activity. Overexpression of furin, resulted in a complete processing of the receptor (Figure 4A
, lane 3). According to its higher levels of expression of furin,6
endogenous furin activity was more evident in the more aggressive SCC15. Despite the fact that these cells expressed elevated levels of IGF-IR (Figure 4A)
, almost all of the receptor was cleaved in the control (vector-alone-transfected) cells. However, a slight increase in the processing was observed in the furin-transfectant cells. Measurements of [3H]-thymidine incorporation indicated that after furin transfection, a small increase (20 to 30%) in the proliferation rate was achieved, in agreement with the small increase of IGF-IR processing observed. Processing of IGF-IR was partially blocked after inhibition of furin activity with 100 µmol/L CMK (Figure 4A
, lines 2, 4, 6, and 8). This decrease in the processed IGF-IR resulted in a reduction in the proliferation activity of cells as noted by the lower counts in the incorporation of [3H]-thymidine (Figure 4C)
.
|
. Enhanced in Vivo Growth Patterns of Transfected HNSCC
In vivo invasion was evaluated using the tracheal xenotransplant invasion assay. Cells were inoculated into rat tracheas and implanted s.c. in the backs of SCID mice. After either 6 or 8 weeks the tracheas were removed, sectioned, and stained. SCC15 cells transfected with the empty vector grew in the interior of the tracheal lumen where a tumoral mass was observed. However, these cells were not able to reach the extratracheal tissues (Figure 5A)
. Conversely, furin transfectants were capable to breach the tracheal wall through the pars membranacea of the tracheal wall and reach the exterior of the xenotransplant (Figure 5B)
.
|
.
The less aggressive SCC12 cells were evaluated at 8 weeks after xenotransplantation. SCC12 cells, although invasive, did not penetrate as deeply at 8 weeks into the tracheal wall as SCC15 cells. Nevertheless, the increase in invasive ability after furin transfection was similar (approximately twofold) in both cell lines (Figure 5C)
.
Since proliferative rates of furin-transfected cells were higher than control cells (vector-alone) in vitro, we tested the ability of SCC15 cells to grow in vivo as s.c. xenotransplants. The furin transfectant cells grew faster and produced larger tumors than the vector-alone-transfected cells. The former developed tumors 15 days earlier than the vector-alone-transfected cells (Figure 6A)
. All of the animals injected with furin transfectant cells developed tumors. In contrast, at the time of termination of the experiment (45 days), only two of five control animals (injected with vector-alone-transfected cells) had tumors. Immunohistochemistry of tumors revealed strong expression of furin in the transfectants (Figure 6C)
. Weak staining was observed with SCC15 control cells (Figure 6B)
.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Among the participating enzymes, PCs may have a fundamental role. PCs are members of a family of serine proteases that have been implicated in several types of cancer. For example, PACE-4 is overexpressed in many cell lines derived from rodent skin cancer27 and high levels of furin have been observed in human lung,4 breast5 and head and neck cancer.6 Furin is synthesized as a proenzyme and self-activates in the ER. Once processed, it serves to activate a large variety of substrates, many of them with well-recognized roles in cancer development and progression. Overexpression of furin may activate many of these substrates in a non-regulated manner and contribute to an enhanced malignant phenotype.
We selected two human HNSCC cell lines of different degrees of aggressiveness and stably transfected them with full-length furin cDNA. After transfection with furin, both cell lines showed an increased ability to process MT1-MMP, one of the key enzymes in the cascade that leads to the degradation of ECM. This correlated with enhanced in vitro invasiveness. SCC15, the cell line that displays a moderate degree of aggressiveness, showed a more malignant phenotype after furin transfection. Interestingly, SCC12, the less aggressive cell line in the SCC series, exhibited a remarkable increase in invasive ability. Although SCC12 furin transfectants were not as invasive as furin-transfected SCC15 cells, this result suggests that furin expression is sufficient to enhance the invasive ability of this low-grade cell line. The increase in the invasive ability of furin transfectants can be explained by an enhanced activation of MT1-MMP. It has been demonstrated that this membrane-type MMP is overexpressed in many SCC and that the levels found correlated positively with the overall malignancy of tumors.28 Our results suggest that, at least in some cases, the primary abnormality may be the overexpression of the MT1-MMP activator (furin). MT1-MMP plays a central role in invasion and tumor progression because it is able to activate MMP-2 or collagenase IV, a major ECM degradative enzyme.7 Both cell lines had low levels of MMP-2 and MMP-9. Zymographic analysis showed that collagenase IV expression and activation is enhanced in furin transfectants. This cannot entirely account for the changes observed and it is very likely that other MMP-2-independent effects are also taking place. In this context, it has been noted that for complete activation of MMP-2, several components of the ECM such as collagen are needed.29 The presence of ECM components could explain the relative discrepancies observed in zymography and the in vitro invasion assay.
Pro-MMP-9 activity was also detected at low levels. Unexpectedly, only the active form was detected in furin transfectants, whereas only the pro-form was present in the vector-alone-transfected cells. This activity may contribute to the increased invasiveness. Although correlation between MMP-9 activation and furin activity is not clear, the minimal consensus sequence for furin cleavage (RXXR) can be recognized near but not at the carboxy-terminal part of the pro-peptide,11 thus furin activity can putatively generate active MMP-9.
CMK is a potent furin inhibitor (inhibition constant, ki, in the order of nanomolar) capable of acting intracellularly. Treatment with this inhibitor resulted in reduced cleavage of MT1-MMP and in vitro invasiveness in HT-1080 cells.30 Inhibition studies with CMK were performed in our cell systems to provide further evidence that furin was responsible for the changes in the observed phenotype. Inhibition of furin activity resulted in an almost complete blockage of MT1-MMP processing. This result confirms that furin plays a major role in activation of MT1-MMP. This decrease in processing correlated with the marked reduction in the invasiveness in vitro.
In Vivo Invasion Assays Confirmed the Results Obtained in Vitro
Cells were able to grow inside tracheal transplants and reach the connective tissues that bridge both ends of the cartilage (pars membranacea). SCC15 cells transfected with vector-alone remained inside the trachea even 8 weeks after the xenotransplant was performed. Despite cells being in physical contact with the pars membranacea, they did not have the capacity to degrade and invade it. In contrast, furin-transfected cells acquired the ability to disrupt this barrier and migrate to the extratracheal compartment. In vivo invasive ability was also evaluated in SCC12 cells. Although these cells displayed very low invasive potential, a clear difference between vector-alone versus furin-transfected cells were observed. Furin can process and activate other cancer-associated substrates not directly involved in invasion or degradation of ECM such as growth factors and growth factor receptors.31-34
Inhibition of furin by PDX, a specific inhibitor of this PC, resulted in a reduction in proliferation rate in HT-29, a colon carcinoma cell line.17
To elucidate if overexpression of furin in HNSCC was related to enhanced proliferation, [3H]-thymidine incorporation experiments were performed. Furin transfectants showed moderate increase [3H]-thymidine incorporation (
30%) when compared to vector-alone-transfected cells. The enhanced processing of the receptor, resulting in higher concentration of the active receptor in the cell surface may enhance the response to IGF-1 in more aggressive cells leading to increase the proliferative rates. As already noted in other systems,35
more dramatic effects were achieved after blocking the activity or the expression of IGF-IR. Treatment with CMK resulted in reduction of the relative amounts of the processed receptor and inhibition of the proliferative ability. Inhibition of incorporation of radioactivity was observed not only in furin-transfected but also in vector-alone-transfected SCC15 cells, suggesting that some degree of inhibition of endogenous furin had occurred. In SCC12 cells, proliferation was almost abolished.
IGF-1, one of the IGF-1R ligands, induced a dose-dependent proliferative response. Furin-transfected cells showed higher levels of proliferation than their vector-alone counterparts. This effect was more striking in SCC12 cells, in agreement with the increased ability of furin transfectants to process IGF-1R (Figure 4A)
. Treatment with the furin inhibitor, CMK, significantly reduced the IGF-1-mediated proliferative response. Taken together, these results demonstrate that the proliferation rate is moderately affected by the overexpression of furin but inhibition of this PC can reduce or even abolish proliferation in these cell lines.
When SCC15 cells were injected s.c. in mice, furin transfectants grew faster than the vector-alone counterparts and tumors were detected earlier. These tumors were three to four times larger than tumors derived from control-transfected cells. Early onset of tumor derived from furin-overexpressing cells may be explained, in part, by their increased sensitivity toward IGF-1.
Conversely, furin overexpression may provide a better adaptation to a relative unfavorable environment through processing of yet unknown substrates. This advantage may help malignant cells to grow or survive in adverse conditions that they may have to circumvent to colonize at distant organs. SCC12 cells grew poorly when injected s.c. in mice. Nevertheless, small tumors were obtained 3 months after injection of furin-transfected cells. On the other hand, control cells were unable to grow.
In summary, furin overexpression resulted in a remarkable increase in the invasive potential of cells. Proliferation rates were moderately higher. After inhibition of furin activity, both proliferation and invasive ability decreased due to impairment in the processing of a variety of furin substrates. These features make furin a potential target for future therapeutic efforts. One might speculate that a combined use of MMP inhibitors together with furin inhibition could improve the perspectives of targeting these tumor progression-related enzymes.36,37
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by National Institutes of Health-National Cancer Institute grants CA 75028 and CA 06927 and by an appropriation of the Commonwealth of Pennsylvania.
Accepted for publication October 14, 2002.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
1-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent. Proc Natl Acad Sci USA 1998, 95:7293-7298This article has been cited by other articles:
 |
|
 |
|
  M. Lapierre, G. Siegfried, N. Scamuffa, Y. Bontemps, F. Calvo, N. G. Seidah, and A.-M. Khatib Opposing Function of the Proprotein Convertases Furin and PACE4 on Breast Cancer Cells' Malignant Phenotypes: Role of Tissue Inhibitors of Metalloproteinase-1 Cancer Res., October 1, 2007; 67(19): 9030 - 9034. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Lopez de Cicco, D. E. Bassi, S. Zucker, N. G. Seidah, and A. J.P. Klein-Szanto Human Carcinoma Cell Growth and Invasiveness Is Impaired by the Propeptide of the Ubiquitous Proprotein Convertase Furin Cancer Res., May 15, 2005; 65(10): 4162 - 4171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Singh, Y. Itahana, S. Knight-Krajewski, M. Kanagawa, K. P. Campbell, M. J. Bissell, and J. Muschler Proteolytic Enzymes and Altered Glycosylation Modulate Dystroglycan Function in Carcinoma Cells Cancer Res., September 1, 2004; 64(17): 6152 - 6159. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. de Cicco, J. C. Watson, D. E. Bassi, S. Litwin, and A. J. Klein-Szanto Simultaneous Expression of Furin and Vascular Endothelial Growth Factor in Human Oral Tongue Squamous Cell Carcinoma Progression Clin. Cancer Res., July 1, 2004; 10(13): 4480 - 4488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nejjari, V. Berthet, V. Rigot, S. Laforest, M.-F. Jacquier, N. G. Seidah, L. Remy, E. Bruyneel, J.-Y. Scoazec, J. Marvaldi, et al. Inhibition of Proprotein Convertases Enhances Cell Migration and Metastases Development of Human Colon Carcinoma Cells in a Rat Model Am. J. Pathol., June 1, 2004; 164(6): 1925 - 1933. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
:10% FBS, 
:10% FBS + 100 µmol/L CMK. Furin transfection increased [3H]thymidine incorporation and this was inhibited with CMK. D: Growth-arrested cells were incubated with the additions indicated. The last four hours, 0.5 µCi [3H] methyl thymidine/well was added. 
, 20 ng/ml IGF-1; 
,100 ng/ml IGF-1; 
