| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |


From the Division of Gastroenterology* and the Academic Unit of Cancer Studies,
University Hospital, Queens Medical Centre, Nottingham, United Kingdom
| Abstract |
|---|
|
|
|---|
In contrast to ulcerative colitis, intestinal stricture formation because of excessive deposition of fibrous tissue often occurs in patients with Crohns disease.2 Although they share a number of clinical, pathological, and immunological similarities, the reason for the frequent development of intestinal strictures in Crohns disease, but not ulcerative colitis, remains unknown. The turnover of extracellular matrix during the processes of mucosal repair and remodeling is regulated by factors that influence its synthesis and degradation.
Myofibroblasts are the predominant mucosal cells that synthesize components of the extracellular matrix and their breakdown is mediated by proteolytic enzymes derived from different cell types of which matrix metalloproteinases (MMPs) represent a large and important family.3 MMPs are a family of zinc- and calcium-dependent proteases that are secreted as proforms and become activated via proteolytic cleavage.4 The proteolytic activity of MMPs is controlled by tissue inhibitors of metalloproteinases (TIMPs) via noncovalent binding of the active forms of MMPs at molar equivalence.4,5 TIMP-1 is inducible whereas TIMP-2 is mainly constitutive. An imbalance because of reduced MMP activity and/or increased expression of TIMPs may lead to the excessive deposition of extracellular matrix proteins with subsequent fibrosis and stricture formation in Crohns disease.
The transforming growth factor (TGF)-ß family of proteins has been shown to be important in the regulation of the synthesis and breakdown of extracellular matrix proteins.6 TGF-ß1 has been studied the most and has been shown to down-regulate MMP expression and to enhance the expression of TIMP-1.4,7 There is limited information on the role of isoforms of TGF-ß in the regulation of the turnover of extracellular matrix. In addition to expressing extracellular matrix proteins8 and MMPs,9 myofibroblasts also express distinct isoforms of TGF-ß. Thus, myofibroblasts isolated from normal intestinal mucosal samples express predominantly TGF-ß3,10 whereas those from ulcerative colitis express both TGF-ß1 and TGF-ß3. By contrast, in myofibroblast cultures from fibrotic Crohns disease tissue, there was significantly lower expression of TGF-ß3 but enhanced release of TGF-ß2.11
In the present study, we have investigated the expression of MMP-1, -2, -3, and -9 and TIMP-1 and TIMP-2 by myofibroblasts isolated from normal intestinal mucosal samples and those affected by inflammatory bowel disease. TIMP-1 inhibits active forms of all MMPs and is recognized as the predominant enzyme in inhibiting matrix degradation in the intestine and therefore the effects of recombinant isoforms of TGF-ß on myofibroblast expression of TIMP-1 have also been studied.
| Materials and Methods |
|---|
|
|
|---|
Subconfluent monolayers of myofibroblasts derived from normal colonic mucosal samples, seeded in 24-well plates (Nunc, Nunc, UK) at 5 x 104 per well, were also exposed for 24 hours to recombinant (r) TGF-ß1, TGF-ß2, and TGF-ß3 (R&D Systems, UK), at a final concentration of 5 ng/ml. MFCM of control and rTGF-ß-exposed cells was collected for determination of TIMP-1 concentration.
Expression of mRNA Transcripts
RNA was isolated using the Rneasy RNA extraction kit (Qiagen, Germany) and reverse transcribed using the Ready-To-Go T-Primed First Strand Reaction Kit (Pharmacia Biotech, Brussels, Belgium). Reverse transcription to cDNA was performed in buffered solution containing dATP, dCTP, dGTP, dTTP, FPLCpure murine reverse transcriptase, RNA guard (porcine), RNase/DNase-free bovine serum albumin, and NotI-d(T)18 primer [5'-d(AACTGGAAGAATTCGCGGCCGCAGGAAT18)-3'] according to the manufacturers instructions.
The expression of MMP-1, -2, -3, and -9; and TIMP-1 and -2 mRNA transcripts was subsequently studied by polymerase chain reaction (PCR) using the primer sequences: GAPDH, 5'-TGC CGT CTA GAA AAA CCT GC-3' and 5'-ACC CTG TTG CTG TAG CCA AA-3'; MMP-1, 5'-AAT GTG CTA CAC GGATAC CC-3' and 5'-CTT TGT GGC CAA TTC CAG GA-3'; MMP-2, 5'-CCG CCT TTA ACT GGA GCA AA-3' and 5'-TTT GGT TCT CCA GCT TCA GG-3'; MMP-3, 5'-GAG GAA AAT GCA TGC AGC CA-3' and 5'-CTC CAA CTG TGA AGA TCC AG-3'; MMP-9, 5'-GAA GAT GCT GCT GTT CAG CG-3' and 5'-ACT TGG TCC ACC TGG TTC AA-3'; TIMP-1, 5'-CGG GGC TTC ACC AAG ACC-3' and 5'-TCA GGC TAT CTG GGA CCG C-3'; TIMP-2, 5'-GAA GAA GAG CCT GAA CCA CA-3' and 5'-GTC CTC GAT GTC GAG AAA CT-3'.
In subsequent quantitative analysis, the expression of TIMP-1 transcripts were related to that of the constitutive product, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), by real-time PCR using GeneAmp 5700 Sequence Detection System (Perkin Elmer, Emeryville, CA). PCR reactions contained 2.5 µl of 10x SYBR Green PCR buffer, 3 µl of 25 mmol/L MgCl2, 0.2 mmol/L of dATP, 0.2 mmol/L of dCTP, 0.2 mmol/L of dGTP, 0.4 mmol/L of dUTP, 1 µl of sense and anti-sense primers (5 pmol), 0.25 U of uracil N-glycosylase, 0.125 U Amplitaq Gold DNA polymerase, 1 µl of cDNA, and 15.125 µl of sterile water.
The following primer pairs were used: 5'-CTT CGG GAA AAG TCT CGG AA-3' (sense) and 5'-ACA AGG GTG AGG GTA GAA AG-3' (anti-sense) to amplify TIMP-1 transcripts and 5'-GGT GAA GGT CGG AGT CAA CGG A-3' (sense) and 5'-GAG GGA TCT CGC TCC TGG AAG A-3' (anti-sense) to amplify GAPDH transcripts. The reactions were incubated at 50°C for 2 minutes and 95°C for 10 minutes. Amplification was performed by 40 cycles consisting of denaturation at 95°C for 15 seconds and annealing at 60°C for 1 minute. Amplification of the expected single PCR products was confirmed by gel electrophoresis. Expression of TIMP-1 transcripts, as a ratio of GAPDH transcripts, was determined using the sequence detection system software. In control reactions, reverse transcriptase enzyme or cDNA were omitted.
Gelatin Zymography
Gelatin zymography was used to assess the presence and bioactivity of MMP-2 and MMP-9. MFCM was collected as described above and diluted 1:1 with nonreducing sample buffer (Novex, San Diego, CA). Twenty-five µl of this mixture was applied per well and separated on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis gel containing 0.1% gelatin (Novex) immersed in running buffer (Tris base, 29 g; glycine, 144g; SDS, 10g, and dH2O to a volume of 1 L) (Novex) for 150 minutes at 125 V/gel. SDS was removed by incubation with renaturing buffer [Triton X-100, 2.5% (v/v) in dH2O] (Novex) for 30 minutes at room temperature. The gels were then washed for 30 minutes in developing buffer [50 mmol/L Tris, 0.2 mol/L NaCl, 5 mmol/L CaCl2, 0.02% Brij 35 (w/v), pH 7.6] (Novex) and then incubated overnight at 37°C in developing buffer. The gels were then stained with Coomassie brilliant blue R-250 and destained with 30% methanol (v/v) and 10% acetic acid (v/v) in dH2O for 10 minutes. The gels were finally immersed in Gel-Dry solution (Novex) and mounted between cellophane sheets and allowed to air dry.
Western Blot Analysis and Enzyme-Linked Immunosorbent Assay (ELISA)
After the concentration of MFCM was obtained from normal, ulcerative colitis, and Crohns disease myofibroblast cultures, equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis using 12.5% acrylamide-resolving gel (Bio-Rad Protean II Slab Gel Electrophoresis equipment). After transfer onto polyvinylidene difluoride membranes, immunostaining was performed using antibodies to MMP-1, MMP-3, TIMP-1, and TIMP-2 (obtained from Calbiochem-Novabiochem International) and the Vectastain Elite ABC kit (Vector Laboratories).
TIMP-1 concentrations in MFCM samples were assessed using specific ELISA (Amersham Pharmacia Biotech, UK). Protein concentration in each MFCM sample was determined using the Bradford-Lowry assay and samples with equivalent protein concentrations were used in the TIMP-1 ELISAs.
Statistical Analyses
For data obtained from real-time PCR, the Mann-Whitney U-test for unmatched samples was used. For data obtained from the ELISAs, the differences between the paired sample data were not normally distributed therefore the Wilcoxon signed sank test was used, P values <0.05 were taken as statistically significant.
| Results |
|---|
|
|
|---|
Normal, ulcerative colitis and Crohns disease myofibroblasts expressed mRNA transcripts for MMP-1, -2, and -3 and TIMP-1 and -2. No MMP-9 mRNA was expressed by any of the myofibroblast cultures (Figure 1)
.
|
In quantitative analysis by real-time PCR, expression of TIMP-1 transcripts was significantly higher in myofibroblasts isolated from fibrotic Crohns disease tissue compared to those obtained from normal mucosal samples (Table 1)
.
|
|
|
Studies by Western blot analyses showed that MMP-1 and MMP-3 were expressed by all myofibroblast cultures but were expressed only in their inactive forms (Figure 4)
. Gelatin zymography showed that MMP-2 was expressed in both active and inactive forms, however, MMP-9 was not expressed by any myofibroblast cultures (Figure 5)
.
|
|
Incubation of isolated normal human intestinal myofibroblasts with rTGF-ß1 and rTGF-ß2 led to a significant increase in the release of TIMP-1 when compared to control cultures (Table 2)
. However, concentrations of TIMP-1 in MFCM of rTGF-ß3-exposed myofibroblasts did not differ from those of cells cultured in control medium.
|
| Discussion |
|---|
|
|
|---|
We have shown that myofibroblasts isolated from fibrotic Crohns disease mucosal samples have an enhanced capacity to constitutively express higher levels of TIMP-1 than similar cells isolated from normal and ulcerative colitis mucosal samples. The resulting increase in inhibition of the activity of MMPs would be expected to inhibit degradation of the extracellular matrix, leading to its excessive deposition and subsequent stricture formation in Crohns disease. Our studies have also shown, for the first time, that recombinant isoforms of TGF-ß differ in their ability to regulate the expression of TIMP-1 by normal intestinal myofibroblasts. Thus, rTGF-ß1 and rTGF-ß2 induce the expression of TIMP-1 but rTGF-ß3 had no effect. These studies illustrate a potential mechanism by which TGF-ß isoforms may play an important role in the regulation of extracellular matrix proteins in tissue repair and remodeling.
In recent studies we have shown that, compared to normal intestinal cells, myofibroblast cultures established from fibrotic Crohns disease mucosal samples expressed significantly higher levels of bioactive TGF-ß1 and TGF-ß2. However, the expression of TGF-ß3 bioactivity by the Crohns disease intestinal myofibroblasts was significantly lower than by normal intestinal myofibroblasts.11 Our current studies suggest that the enhanced expression of TGF-ß1 and TGF-ß2 by Crohns disease myofibroblasts may lead to the increased expression of TIMP-1 by these cells. The expression of TIMP-1 by myofibroblasts from ulcerative colitis mucosal samples was similar to that expressed by normal intestinal myofibroblasts. Because the former also express TGF-ß1 at significantly higher levels than the latter, it is likely that factors other than TGF-ß1 are responsible for the enhanced expression of TIMP-1 by fibrotic Crohns disease myofibroblasts. These include TGF-ß2, which is released in significant amounts by Crohns disease intestinal myofibroblasts but not by myofibroblasts from normal or ulcerative colitis mucosal samples.11 By contrast, the expression of TGF-ß3 by Crohns disease myofibroblasts is significantly lower compared to myofibroblasts from normal or ulcerative colitis tissue. An important role for TGF-ß3 in tissue repair without scarring has been demonstrated in a model of rat cutaneous wound repair.18
TGF-ß1 and TFG-ß2 have been shown to promote repair of rat cutaneous wounds with excessive deposition of fibrous tissue.19 By contrast, TGF-ß3 induced wound repair without fibrosis and was also able to inhibit the profibrogenic effects of TGF-ß1 and TGF-ß2.18 Our previous studies11 suggest that the different isoforms of TGF-ß may also play an important role in the regulation of mucosal repair and remodeling.
A number of recent studies suggest that MMPs are the most important group of proteolytic enzymes responsible for the breakdown of extracellular matrix in inflammatory bowel disease.20-25 Studies of mRNA transcripts by competitive PCR suggest that MMP-1 and MMP-3 are the predominant MMPs in mucosal samples of patients with inflammatory bowel disease,23,24 but these studies have not consistently found significant differences between ulcerative colitis and Crohns disease in MMP expression in mucosal samples. Recent in vitro studies have demonstrated increased expression of MMPs and down-regulation of TIMP expression in an ex vivo model in which T cells in explants of second trimester human fetal intestine were activated with pokeweed mitogen or anti-CD3 plus interleukin 12.25 This model of acute injury, in which extracellular matrix degradation and ulceration predominate, may not reflect changes that occur in the chronically inflamed intestinal mucosa in ulcerative colitis and Crohns disease. We believe that our studies using myofibroblasts isolated from diseased tissue reflect the dysregulation of chronic intestinal mucosal repair and regeneration that leads to fibrosis and extracellular matrix deposition in Crohns disease, in contrast to ulcerative colitis.
MMPs and TIMPs are expressed by other cells within the intestinal lamina propria including macrophages and epithelial cells.25 Undoubtedly, MMP and TIMP secretion from these cells is likely to influence tissue remodeling, however, further studies are required to determine the relative contribution of the nonmyofibroblast cell types to this process in inflammatory bowel disease. Previous studies have also demonstrated an important contribution of smooth muscle cells in stricture formation in Crohns disease26 via proliferation and laying down extracellular matrix.
In conclusion, we have shown that myofibroblasts derived from normal and inflammatory bowel disease tissue express MMP-1 and MMP-3 (in their inactive forms) and MMP-2 in both active and latent forms. No MMP-9 expression was observed. Because TIMP-1 is capable of inhibiting all MMPs, we postulate that its enhanced expression by myofibroblasts in Crohns disease is a major determinant in the development of strictures in Crohns disease but not ulcerative colitis.
| Footnotes |
|---|
Supported by a Programme Grant from the Medical Research Council (UK) and a project grant from the National Association for Colitis and Crohns Disease.
Accepted for publication December 19, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A Di Sabatino, K M Pickard, D Rampton, L Kruidenier, L Rovedatti, N A B Leakey, G R Corazza, G Monteleone, and T T MacDonald Blockade of transforming growth factor {beta} upregulates T-box transcription factor T-bet, and increases T helper cell type 1 cytokine and matrix metalloproteinase-3 production in the human gut mucosa Gut, May 1, 2008; 57(5): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Bodger, S Ahmed, L Pazmany, D M Pritchard, A Micheal, A L Khan, R Dimaline, G J Dockray, and A Varro Altered gastric corpus expression of tissue inhibitors of metalloproteinases in human and murine Helicobacter infection J. Clin. Pathol., January 1, 2008; 61(1): 72 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sengupta and T. T. MacDonald The Role of Matrix Metalloproteinases in Stromal/Epithelial Interactions in the Gut Physiology, December 1, 2007; 22(6): 401 - 409. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heidemann, C. Ruther, M. Kebschull, W. Domschke, M. Bruwer, S. Koch, T. Kucharzik, and C. Maaser Expression of IL-12-related molecules in human intestinal microvascular endothelial cells is regulated by TLR3 Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1315 - G1324. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Denning, S. Granger, D. Mucida, R. Graddy, G. Leclercq, W. Zhang, K. Honey, J. P. Rasmussen, H. Cheroutre, A. Y. Rudensky, et al. Mouse TCR{alpha}beta+CD8{alpha}{alpha} Intraepithelial Lymphocytes Express Genes That Down-Regulate Their Antigen Reactivity and Suppress Immune Responses J. Immunol., April 1, 2007; 178(7): 4230 - 4239. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Peiris, I. Pacheco, C. Spencer, and R. J. MacLeod The extracellular calcium-sensing receptor reciprocally regulates the secretion of BMP-2 and the BMP antagonist Noggin in colonic myofibroblasts Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G753 - G766. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Brun, I. Castagliuolo, V. D. Leo, A. Buda, M. Pinzani, G. Palu, and D. Martines Increased intestinal permeability in obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G518 - G525. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Rieder, J Brenmoehl, S Leeb, J Scholmerich, and G Rogler Wound healing and fibrosis in intestinal disease Gut, January 1, 2007; 56(1): 130 - 139. [Full Text] [PDF] |
||||
![]() |
P. Garg, M. Rojas, A. Ravi, K. Bockbrader, S. Epstein, M. Vijay-Kumar, A. T. Gewirtz, D. Merlin, and S. V. Sitaraman Selective Ablation of Matrix Metalloproteinase-2 Exacerbates Experimental Colitis: Contrasting Role of Gelatinases in the Pathogenesis of Colitis J. Immunol., September 15, 2006; 177(6): 4103 - 4112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Medina and M. W. Radomski Role of Matrix Metalloproteinases in Intestinal Inflammation J. Pharmacol. Exp. Ther., September 1, 2006; 318(3): 933 - 938. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sodek, A. P. Batista Da Silva, and R. Zohar Osteopontin and mucosal protection. J. Dent. Res., May 1, 2006; 85(5): 404 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Theiss, J. G. Simmons, C. Jobin, and P. K. Lund Tumor Necrosis Factor (TNF) {alpha} Increases Collagen Accumulation and Proliferation in Intestinal Myofibroblasts via TNF Receptor 2 J. Biol. Chem., October 28, 2005; 280(43): 36099 - 36109. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Gratton, V. H. Rao, D. T. Meehan, C. Askew, and D. Cosgrove Matrix Metalloproteinase Dysregulation in the Stria Vascularis of Mice with Alport Syndrome: Implications for Capillary Basement Membrane Pathology Am. J. Pathol., May 1, 2005; 166(5): 1465 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Bourgier, V Haydont, F Milliat, A Francois, V Holler, P Lasser, J Bourhis, D Mathe, and M-C Vozenin-Brotons Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression Gut, March 1, 2005; 54(3): 336 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhou, J. B. Trudeau, K. J. Schoonover, J. I. Lundin, S. M. Barnes, M. J. Cundall, and S. E. Wenzel Interleukin-13 augments transforming growth factor-{beta}1-induced tissue inhibitor of metalloproteinase-1 expression in primary human airway fibroblasts Am J Physiol Cell Physiol, February 1, 2005; 288(2): C435 - C442. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Strup-Perrot, D. Mathe, C. Linard, D. Violot, F. Milliat, A. Francois, J. Bourhis, and M.-C. Vozenin-Brotons Global gene expression profiles reveal an increase in mRNA levels of collagens, MMPs, and TIMPs in late radiation enteritis Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G875 - G885. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-A. Choi, H.-K. Lim, J.-R. Kim, C.-H. Lee, Y.-J. Kim, S.-S. Kang, and S.-H. Baek Group IB Secretory Phospholipase A2 Promotes Matrix Metalloproteinase-2-mediated Cell Migration via the Phosphatidylinositol 3-Kinase and Akt Pathway J. Biol. Chem., August 27, 2004; 279(35): 36579 - 36585. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamagami, S. Yokoo, T. Mimura, and S. Amano Effects of TGF-{beta}2 on Immune Response-Related Gene Expression Profiles in the Human Corneal Endothelium Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 515 - 521. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Chitapanarux, S. L. Chen, H. Lee, A. C. Melton, and H. F. Yee Jr. C-type natriuretic peptide induces human colonic myofibroblast relaxation Am J Physiol Gastrointest Liver Physiol, January 1, 2004; 286(1): G31 - G36. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |