| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |


From the Department of Neuroscience,* the Institute of Gerontology, and the Department of Orthopaedic Surgery,
Osaka City University Medical School, Osaka, Japan
| Abstract |
|---|
|
|
|---|
, an ER stress protein, was expressed as a pathological reaction in virtually all COS7 cells expressing mutated but not wild-type COMP. Moreover, COS7 cells expressing mutated COMP exhibited significantly more apoptotic reaction than those expressing wild-type COMP. Pathological accumulation of COMP in rER and apoptosis in COS7 cells that were induced by the mutation (D472Y) in COMP imply that COMP mutations play a role in the pathogenesis of PSACH.
Cartilage oligomeric matrix protein (COMP) was initially termed the high-molecular-weight cartilage matrix glycoprotein that was isolated from articular cartilage7,8 and characterized later as a territorial homopentameric matrix protein with a subunit size of 100 to 110 kd.9 Interestingly, COMP proved to be the fifth member of the thrombospondin family, members of which have a coiled-coil region responsible for multimerization and interchain disulfide bonds,10 four epidermal growth factor-like type 2 repeats, seven highly conserved type 3 repeats that consist of 13 calcium-binding loops, and a COOH-terminal globular domain.11-13 Most mutations identified in the COMP gene are located within the exons encoding the calcium-binding type 3 repeats2,14,15 and are postulated to cause qualitative defects in the protein, induce COMP conformational change, and reduce calcium-binding activity.16-18
COMP is primarily synthesized in cells and then secreted as an extracellular territorial matrix around chondrocytes9 and can also be found in synovium, tendons, and dermal fibroblasts.19-22 In ultrastructural studies, chondrocytes from PSACH and EDM1 patients have been found to be characterized by enormous vesicles formed from rough endoplasmic reticulum (rER) that have a unique lamellar appearance with alternating electron-lucent and electron-dense layers.23-25 Extracellular matrix components, including aggrecan and type IX collagen, have been shown to be retained in these enlarged vesicles.25-29 The retention appeared to be cell type-specific since COMP is secreted normally from patient tendon and ligament in vitro and patient chondrocytes cultured in monolayers.27,28,30 However, it is still unclear how these mutations affect COMP trafficking and its pathway of secretion to cause disease phenotypes.
In this study, we examined the effect of a mutation (D472Y) in the calcium-binding domain previously identified for severe PSACH6 on the process of secretion in cultured COS7 cells with newly prepared antibodies specific for COMP. This mutation was found to affect an early stage of the membrane trafficking of COMP at the rER before the Golgi apparatus and plasma membrane. Recently, it has been shown that a variety of toxic insults, including calcium ionophores, inhibitors of glycosylation, chemical toxicants, and oxidative stress, can cause ER stress and ultimately lead to cell death.31-39 We found that significant ER stress and resultant apoptosis occurred in cells expressing mutated COMP compared with wild-type COMP and discuss the significance of this in PSACH.
| Materials and Methods |
|---|
|
|
|---|
We isolated periosterial cells from five normal subjects without any clinical disorders related to PSACH or EDM1 at surgical operation and used them for isolation of cDNA to encode COMP under informed consent. Cells were grown with 10 ng/ml TGF-ß, 10% fetal calf serum, and Dulbeccos modified Eagles medium (DMEM). Total RNA was extracted from cultured human synovial cells and used as the template for amplification of full-length COMP cDNA according to standard protocols with Pyrobest DNA Polymerase (Takara Bio Inc., Kyoto, Japan). The full-length COMP cDNA amplified with primers F-NdeI (5'-cagatccatgcggccgccatggtccccgacaccgcct gcgtt-3') and R-NdeI (5'-ggtcttcacgcggccgcctaggcttgccgcagctgatgggt-3') was introduced into the bacterial expression vector pET3a (Invitrogen, CA) for preparation of anti-COMP antibodies. Three COMP clones were established from each of the five individuals. All of the 15 clones of wild-type COMP cDNA were sequenced at every step and confirmed with an ABI Prism 310 DNA Sequencer (Applied Biosystems, CA) and found to possess the same 11 SNPs (Accession No: AB086984 in DDBJ (DNA Data Bank of Japan) database (http://www.ddbj.nig.ac.jp/)). The full-length COMP cDNA in pET3a vector was re-amplified with primers F-NotI (5'-cagatccatgcgg ccgccatggtccccgacaccgcctgcgtt-3') and R-NotI (5'-ggtcttcacgcggccgcctaggcttgccgcagctgatgg gt-3') and transferred into the mammalian expression vector pCMV (Invitrogen, CA) for transfection.
Mutagenesis of COMP cDNA
The point mutation (G1414A) found for a patient with severe PSACH6 was introduced into the wild-type COMP cDNA by PCR. The PCR primers used for the mutagenesis were the mutagenesis primers 1414-F (5'- ggaggactcagaccacgatggccagggtgatgcctgcgacgacgactacgacaat-3') and 1414-R (5'-attgtcgtagtcgtcgtcgcaggcatcaccctggccatcgtggtctgagtcctcc -3'), in addition to the two primers F-NotI and R-NotI. Mutated COMP cDNA was introduced into pCMV vector. It was confirmed by sequencing that the correct mutation had been introduced and that other PCR-generated errors were not incorporated. All of the COMP cDNA and its derivative clones were sequenced at every step and confirmed with an ABI Prism 310 DNA Sequencer.
Preparation of Anti-COMP Antibodies and Their Characterization
The antigens were the N-terminal and C-terminal fragments of COMP. Both fragments of COMP were recombinant proteins that were prepared from the truncated COMP cDNA. The two cDNAs were generated using full-sized COMP cDNA as the template by PCR with the two following primer sets. The N-terminal fragment (residue number: 89290) primers were NF (5'-cttgccaggcatatgctccactgcgcgcccggcttctgc-3') and NR (5'-gagtcatc gcatatgctagtccttacggcactgcggctccgg-3'), and the C-terminal fragment (residue number: 525757) primers were CF (5'-cttgccacccatatggaagtcacgctcaccgacttcagg-3') and CR (5'-tccggccatatgtcaccc tggtccctaggcttgccg-3'). Each COMP fragment cDNA was introduced into the bacterial expression vector pET3a and used for transformation of E. coli BL21 (DE3) (Novagen, NY). The transformed cells were homogenized with a teflon homogenizer and sonicated in 50 mmol/L Tris-HCl (pH 7.6), containing protease inhibitors and 2% 2-mercaptoethanol. After centrifugation at 15,000 x g for 20 minutes, the pellets were resuspended in the same buffer containing 1% Triton-X100. After centrifugation at 15,000 x g for 20 minutes again, the pellets were resuspended in the same buffer containing 8 mol/L urea. After centrifugation again, the resultant supernatants were applied to a Resource Q ion-exchange column (Amersham Pharmacia Biotech, NJ) pre-equilibrated with 50 mmol/L NaCl/8 mol/L urea/50 mmol/L Tris-HCl (pH 7.6). Elution was performed with a linear gradient of 50 mmol/L to 1000 mmol/L NaCl in 8 mol/L urea/50 mmol/L Tris-HCl (pH 7.6). Aliquots from fractions were analyzed by Coomassie brilliant blue R-250 dye staining following SDS-PAGE. The eluates containing COMP fragments were collected and dialyzed against 20 mmol/L ammonium bicarbonate buffer (pH 7.5), followed by lyophilization. Lyophilized material was resuspended in 50 mmol/L Tris-HCl (pH 7.6), and injected s.c. in rabbits and BALB/c mice every 2 weeks with Freunds incomplete adjuvant after the first immunization with Freunds complete adjuvant (Difco Laboratory, DM). From each species, two antibodies to the N-terminal and C-terminal fragments, respectively, were established. A rabbit anti-COMP polyclonal antibody to the N-terminal fragment whose immnoreactivity was stronger than the other antibodies in Western blotting was chosen for use in experiments thereafter.
To evaluate the specificity of the antibody, we performed an adsorption experiment and immunohistochemistry. For the former, the primary antibody was incubated with or without 10 µg/ml recombinant N-terminal COMP fragment. The protocol is described in detail for Western blot analysis below.
For immunohistochemistry, murine growth plates of the knee including chondrocytes were taken at 2 weeks after birth. Samples were fixed for 12 hours in fresh 4% paraformaldehyde in phosphate-buffered saline (PBS) at 4°C, embedded in paraffin, and serially sectioned (5-µm thick). Sections adsorbed to silanized over-dried glass slides were deparaffinized and hydrated. After incubation with a blocking buffer containing 20% calf serum in PBS for 30 minutes at room temperature, sections were incubated overnight at 4°C with the newly developed anti-COMP antibodies followed by biotinylated secondary antibodies for 30 minutes at room temperature. After washing, sections were incubated with avidin biotin-peroxidase complex (Vectastain ABC Kit, Vector Laboratories, CA) for 10 minutes at room temperature. Immnoreactivity was visualized by incubation with diaminobenzidine and 0.03% hydrogen peroxide solution for 5 minutes at room temperature.
Cell Culture and Transfection
COS7 cells were cultured with DMEM containing 10% fetal calf serum, penicillin, and streptomycin. Cells were grown to approximately 70% confluence in 60-mm dishes for 24 hours before transfection. The DNA construct of mammalian expression vector pCMV (3 µg) containing either wild-type COMP, mutated COMP, or vector only was mixed with 12 µl of LipofectAMINE (Gibco BRL, MD) in 2 ml of OPTI-MEM serum-free medium (Gibco BRL, MD) and added to cells, and incubated for 3 hours. The cells were further cultured in 2.5 ml of DMEM containing 10% fetal calf serum in 5% CO2.
Endoglycosidase H Digestion
The transfected cells were harvested, washed twice with PBS and dissolved in 0.5%SDS/1% 2-mercaptoethanol/50 mmol/L sodium acetate (pH 5.5), containing protease inhibitors. After protein content was determined, the same amount of each lysate was boiled for 10 minutes. Endoglycosidase H (Endo H) (Sigma, MO) (0.25 m unit/5 µl) in 50 mmol/L sodium acetate (pH 5.5), was added to each sample and incubated for 3 hours at 37°C. Endo H digestions were terminated by heating at 95°C.
Staurosporine Treatment of COS7 Cells
To prepare a positive control for ER stress and DNA fragmentation, COS7 cells were treated with staurosporine. When cells were grown to 80% confluence, staurosporine was added at a final concentration of 1 mmol/L to culture with DMEM containing 10% fetal calf serum, and the cells were incubated for 3 hours for ER stress and 12 hours for DNA fragmentation at 37°C in 5% CO2.
Western Blot Analysis
The transfected cells were harvested and then washed twice with PBS at 4°C, and the pellets were dissolved in 0.5% SDS/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), containing protease inhibitors. Samples of cell lysates and conditioned media were mixed with 4% SDS/20% glycerol/160 mmol/L Tris-HCl (pH 6.8), with or without 4% 2-mercaptoethanol, boiled for 5 minutes, centrifuged, and applied to 5% polyacrylamide gel. After electrophoresis, proteins on the gel were electroblotted to PVDF membrane (Millipore, Bedford, MA). The membranes were blocked in 3% nonfat milk/1%BSA/0.05% Tween 20/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), for 2 hours and were then incubated with the primary antibody to N-terminal COMP (1:10,000). After four washes with 0.05% Tween 20/150 mmol/L NaCl/50 mmol/L Tris-HCl (pH 7.6), the membranes were incubated with a horseradish peroxidase (HRP)-linked secondary antibody (1:10,000) (Bio-Rad Lab, CA), and immunoreactivity was detected by the ECL Plus Western Blotting Detection System (Amersham Pharmacia Biotech, NJ). An anti-G3PDH antibody (Trevigen Inc., MD) was used for immunoblotting to normalize protein contents of cell lysate samples. The densities of COMP in conditioned media and cell lysates were measured using a densitometer (Bio-Rad Lab). The secreted COMP/intracellular COMP ratio was calculated for three independent experiments. In ER stress experiments, membranes were incubated with a primary antibody to eIF2
(1:1000) or Phospho-eIF2
(1:1000) (Cell Signaling Technology Inc., MA) followed by HRP-conjugated secondary antibody.
Confocal View Analysis
COS7 cells grown on 1% gelatin-coated coverslips were transfected, as described above. After 2-day culture, cells were washed in PBS and fixed with cooled 90% methanol for 10 minutes at 4°C followed by acetone for 10 minutes at 4°C. The fixed cells were hydrated once with PBS, and washed with 0.05% Tween-containing PBS to ensure permeabilization for antibody staining. After washing again with PBS, the cells were incubated with blocking buffer containing 20% calf serum in PBS for 20 minutes at room temperature. The cells were then incubated with the primary antibodies followed by rhodamine (TRITC)- and fluorescein isothiocyanate (FITC)-conjugated secondary antibodies (Jackson Immunoresearch Labs Inc., PA). The stained specimens were mounted and examined under a confocal laser microscope (Zeiss LSM 510, Jena). The primary antibodies included the polyclonal antibody to N-terminal COMP, a monoclonal antibody to Grp78, a representative marker of endoplasmic reticulum (obtained from Stressgen Biotechnologies Corp, CA), a monoclonal antibody to Golgi 58K protein, a representative marker of the Golgi apparatus (obtained from Sigma), and a polyclonal antibody to Phospho-eIF2
, a marker of ER stress (obtained from Cell Signaling Technology Inc).
Terminal dUTP Nick-End Labeling Assay
COS7 cells grown on coverslips were transfected with either wild-type COMP, mutated COMP, or vector only. After 48 hours of incubation, the transfected cells were washed and fixed as described above. The cells were then washed twice with PBS and incubated with 50 µl terminal dUTP nick-end labeling (TUNEL) reaction mixture (Roche Diagnostic, IN) in a humid chamber for 60 minutes at 37°C. For subsequent double-staining, the cells were washed three times again and stained with the anti-COMP antibody as described above. The specimens were examined under a confocal microscope (Zeiss LSM 510, Jena). Six fields were randomly selected, in which total, TUNEL-positive, and COMP-positive cells were counted. The counts of the six fields were summed for each transfection. Each field contained approximately 200 cells. The TUNEL-positive cells/total cells and TUNEL- and COMP-positive cells/COMP-positive cells ratios were calculated. Transfection was performed three times.
Analysis of DNA Fragmentation
Transfected cells and staurosporine-treated cells (2 x 106) were incubated in 100 µl ice-cold lysis buffer (10 mmol/L Tris-HCl (pH 7.4), 10 mmol/L EDTA, 0.5% SDS) at 4°C for 10 minutes. The lysates were treated with 40 mg RNase A at 37°C for 1 hour, and then with 40 mg of proteinase K at 50°C for 1 hour. To precipitate genomic DNA, the mixture was incubated with 1 volume of isopropanol and 0.2 volumes of 3 mol/L sodium acetate at -20°C for 12 hours and centrifuged at 10,000 x g for 20 minutes. Pellets were air-dried and dissolved in 100 µl of Tris EDTA (TE) buffer. The DNA samples were subjected to 1.5% agarose gel electrophoresis using 40 mmol/L Tris acetate (pH 8.0) and 1 mmol/L EDTA as a running buffer. The gel was stained with 0.1 mg/ml of Syber Green (BioWhittaker Molecular Applications, ME) and observed under ultraviolet light.
Statistical Analysis
We used the unpaired t-test for statistical analysis. Statistical significance was confirmed when P values were <0.05.
| Results |
|---|
|
|
|---|
To evaluate the specificity of our newly developed anti-COMP antibody, we stained murine growth plates of knee, including chondrocytes, 2 weeks after birth with this antibody. The immunohistochemical distribution was very similar to that in a previous study performed with a different COMP-specific antibody40
(Figure 1AC
). Immnoreactivity associated with anti-COMP antibody was intracellularly observed in the proliferating zone of the growth plate while it was pronounced in the pericellular and territorial matrix of the hypertrophic zone. The specificity of the present anti-COMP antibody was then further examined by Western blotting analysis. As shown in Figure 1D
, the COMP protein synthesized in chondrocytes was specifically recognized by anti-COMP antibody, and the resulting immunoreaction was completely absorbed with recombinant COMP fragment used as immunogen (see Materials and Methods). Thus, the present anti-COMP antibody was confirmed to specifically stain COMP protein in cartilage tissue.
|
COS7 cells were used here as host cells because of their low background expression of COMP protein, as clearly demonstrated in Figure 2
(lanes 3, 6, 9, and 12). The human COMP cDNA used here was cloned from normal subjects and its wild-type sequence was confirmed by sequencing as described in Materials and Methods.2,5
The pathogenic mutation (D472Y) used here was initially identified as the causal mutation for a familial case with severe clinical manifestations.6
Thus, this important mutation was introduced into the wild-type COMP cDNA. COS7 cells were transfected with either wild-type COMP cDNA or the mutated COMP cDNA and examined biochemically by Western blot analysis with newly prepared anti-COMP antibodies. As seen in Figure 2
, both the wild-type and mutated COMP were detected in both cell lysates and culture media as a single band with a molecular weight (Mr) of 100 to 110 kd under reducing conditions. The apparent molecular weight of COMP in conditioned media was similar to that of cellular COMP, although it was slightly larger than expected on the basis of its amino acid composition because of glycosylation, as described below. The molecular weight of COMP in in vitro-cultured cells was found to be identical to that of COMP in in vivo human cartilage and tendon tissue (unpublished). Both wild-type and mutated COMP were found to migrate as one band with a high Mr of about 500 kd representing a pentamer complex in the gel under non-reducing conditions (Figure 2)
. Both the mutated and normal COMP were secreted into the culture media, but the velocities and amounts of their secretion were markedly different (Figure 2)
. As clearly shown in the time-course experiment at 12, 24, and 48 hours after transfection, the ratio of secreted COMP to cellular COMP was much less with the mutated COMP than with wild-type COMP (Figure 3,A and B)
, suggesting disturbance of trafficking of COMP for transport or secretion. All results obtained with an anti-COMP antibody recognizing the N-terminal fragment of COMP were reproducibly confirmed with another anti-COMP antibody recognizing the C-terminal fragment of COMP (data not shown).
|
|
To biochemically characterize cellular COMP, we examined the sensitivity of COMP to Endo H, an enzyme cleaving N-linked high-mannose oligosaccharides but not complex oligosaccharides. As shown in Figure 4
, both wild-type COMP and mutated COMP were synthesized as a glycoprotein with Mr of 100 to 110 kd and were sensitive to treatment with Endo H. Since it has been shown that glycoproteins with high-mannose oligosaccharides but not complex oligosaccharides, such as chondroitin sulfate proteoglycan, were sensitive to treatment with Endo H,41
our results indicate that intracellular COMP possesses high-mannose-type oligosaccharides.
|
To investigate the effect of mutation of COMP on its subcellular localization, we studied COMP with confocal microscopy. As shown in Figure 5
, wild-type COMP was diffusely located in the cytoplasm (Figure 5A)
, and partially colocalized with Grp78, an ER marker (Figure 5, B and C)
. COMP expressed in transfected cells exhibited subcellular localization very similar to that of endogenous COMP in native chondrocytes (Figure 1, AC
). In contrast, mutated COMP was tightly colocalized with Grp78 (Figure 5F)
. Strikingly, mutated COMP was induced in a lump of abnormally enlarged and somewhat swollen or gnarled ER (Figure 5, D and E)
. Notably, the immunofluorescence representing mutated COMP was stronger than that representing wild-type COMP (Figure 5, A and D)
.
|
ER Stress Occurred in Cells Expressing Mutated COMP
ER is known to be sensitive to alteration of homeostasis by a variety of different stimuli such as glucose deprivation, perturbation of calcium homeostasis, exposure to free radicals, perturbation of protein folding, and accumulation of malfolded proteins.42
These alterations could induce a pathological reaction termed ER stress that elicits two major cellular-protecting responses, the attenuation of protein synthesis and the up-regulation of genes encoding chaperones that facilitate the process of protein folding in the ER. These responses reduce the accumulation and aggregation of malfolded proteins in the compartments of cells.43
Double-stranded RNA-dependent kinase (PKR) and heme-regulated inhibitor kinase (HRI) phosphorylation of eukaryotic initiation factor 2
(elF2
) is a well-characterized mechanism of down-regulation of protein synthesis under conditions of stress.44
Phosphorylation of eIF2
occurs in response to various stressful stimuli, including nutrient deprivation, heat shock, viral infection, and treatment with compounds that deplete endoplasmic reticular calcium levels.44,45
Therefore, we examined cells expressing mutated COMP to determine whether they exhibited ER stress using anti-phospho-eIF2
antibody.
Phosphorylated eIF2
, an ER stress protein, was only minimally detected in cells expressing wild-type COMP (Figure 6B)
, but was clearly detected in cells expressing mutated COMP (Figure 6E)
. Phosphorylated eIF2
was completely colocalized with mutated COMP in the latter cells (Figure 6, D and F)
. Western blot analysis showed that phosphorylated eIF2
was more abundant in cells expressing mutated COMP than those expressing wild-type COMP (Figure 6G)
. These results indicate that the mutation of COMP dominantly induced ER stress.
|
The occurrence of ER stress in cells expressing mutated COMP led us to examine the possibility that cells expressing mutated COMP underwent apoptotic reaction. As a critical and final indicator of such a pathogenic reaction, we performed the TUNEL and DNA ladder assay. As clearly shown in Figure 7A and B
, we observed stronger TUNEL-positive reaction in cells expressing mutated COMP than in those expressing wild-type COMP. The ratio of apoptosis in cells transfected with vector alone was slightly lower than in those expressing wild-type COMP (not significant, data not shown). When we focused on transfected cells expressing either wild-type or mutated COMP, the difference in ratio of apoptosis between cells with wild-type and mutated COMP proved to be significant (P < 0.005) (Figure 7C)
. In DNA ladder assay, cells expressing mutated COMP exhibited DNA fragmentation, whereas cells expressing wild-type COMP did not (Figure 7D)
.
|
| Discussion |
|---|
|
|
|---|
Other matrix proteins such as aggrecan and type IX, type XI, and type XII collagens are known to bind COMP and to accumulate together with mutated COMP.18,26,29,46,48 Interaction of these proteins is assumed to require the intact calcium-binding domain of COMP. It is likely that this domain enables COMP to undergo appropriate protein folding and to bind with other matrix proteins to be secreted together.16-18 This appears to explain the dominant-interference mechanism of the COMP mutation in the region of the type 3 calcium-binding repeats that causes disease through disturbance of an interaction of mutated COMP with COMP-binding proteins, as described above. This could be further evidence that other matrix proteins also accumulate together with mutated COMP in abnormal cis-ternae of swollen rER with a unique lamellar structure inpatient cartilage.
The recent report that COMP-deficient mice exhibited no anatomical or histological abnormalities and no clinical signs of PSACH or EDM1 indicates that the phenotypes in PSACH/EDM1 cartilage disorders were not due to reduced amounts of COMP in cartilage.49 Since COMP is thought to play an important role in cartilage, it may be functionally compensated for in a redundant fashion by similar matrix proteins in such mice. These presumptive matrix proteins have yet to be identified, but they seem not to be members of the thrombospondin family.49
The ER is a principal site of synthesis and folding for membrane proteins as well as secreted proteins and also serves as a cellular storage site for calcium ion.50,51
Inhibition of N-glycosylation by tunicamycin or alteration of intracellular calcium homeostasis resulted in accumulation of unfolded proteins in ER and led to the induction of chaperone proteins and elevation of intracellular calcium, changes that have been collectively termed unfolded protein response or ER stress.52,53
Recently, it was demonstrated that a novel ER-specific apoptosis pathway is mediated by caspase-12, and it was shown that procaspase-12 is predominantly located in the ER and specifically activated by disturbances of ER homeostasis such as ER stress and mobilization of intracellular calcium ion stores.54
The observation of abnormal ER bearing massively accumulated mutated COMP (Figure 5)
suggested examination to determine whether cells expressing mutated COMP suffered ER stress and apoptosis. As shown in Figure 6
, it was noteworthy that phosphorylated eIF2
, an ER stress protein, was detected as much stronger signals in cells expressing mutated COMP than in those expressing wild-type COMP. In addition, such cells expressing mutated COMP exhibited marked apoptosis at higher frequency than cells expressing wild-type COMP (Figure 7)
. These new findings were compatible with the in vitro finding of reduced survival of cells obtained from PSACH patients55
and with the in vivo observation of narrowed and irregular columns in the proliferating or hypertrophic zone and reduced numbers of chondrocytes in the growth plates of PSACH patients.56,57
Since the present experiments were mainly performed with cultured COS7 cells, we could not simply extend our conclusion to in vivo effects of the mutation. However, it is very likely that other interacting or related proteins such as type IX collagen and aggrecan play partner roles in the secretion and function of COMP.18,25,26,29,46,48
In summary, mutation of COMP was shown to slow and to reduce the process of secretion and to induce accumulation of mutated COMP in rER. Cells expressing mutated COMP but not wild-type COMP exhibited apoptosis as well as ER stress. Further study is needed to clarify such in vivo function and interaction of COMP with other extracellular matrix proteins and cell surface molecules.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by a grant-in-aid for Scientific Research on Priority Areas (C)-Advanced Brain Science Project- from the Ministry of Education, Culture, Sports, Science, and Technology, Japan (to H.M.). This study was also supported by grants-in-aid from the Uehara Memorial Foundation, the Nakatomi Foundation, and the Osaka Gas Aging Foundation.
Accepted for publication April 1, 2003.
| References |
|---|
|
|
|---|
-helical bundle between residues 20 and 83. FEBS Lett 1994, 341:54-58[Medline]
kinases and the control of protein synthesis. EMBO J 1996, 10:1378-1387
This article has been cited by other articles:
![]() |
V. Gagarina, A. L. Carlberg, L. Pereira-Mouries, and D. J. Hall Cartilage Oligomeric Matrix Protein Protects Cells against Death by Elevating Members of the IAP Family of Survival Proteins J. Biol. Chem., January 4, 2008; 283(1): 648 - 659. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schmitz, A. Becker, A. Schmitz, C. Weirich, M. Paulsson, F. Zaucke, and R. Dinser Disruption of Extracellular Matrix Structure May Cause Pseudoachondroplasia Phenotypes in the Absence of Impaired Cartilage Oligomeric Matrix Protein Secretion J. Biol. Chem., October 27, 2006; 281(43): 32587 - 32595. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Holden, D. R. Keene, G. P. Lunstrum, H. P. Bachinger, and W. A. Horton Secretion of Cartilage Oligomeric Matrix Protein Is Affected by the Signal Peptide J. Biol. Chem., April 29, 2005; 280(17): 17172 - 17179. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wilson, S. Freddi, D. Chan, K. S. E. Cheah, and J. F. Bateman Misfolding of Collagen X Chains Harboring Schmid Metaphyseal Chondrodysplasia Mutations Results in Aberrant Disulfide Bond Formation, Intracellular Retention, and Activation of the Unfolded Protein Response J. Biol. Chem., April 22, 2005; 280(16): 15544 - 15552. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-j. Liu, L. Prazak, M. Fajardo, S. Yu, N. Tyagi, and P. E. Di Cesare Leukemia/Lymphoma-related Factor, a POZ Domain-containing Transcriptional Repressor, Interacts with Histone Deacetylase-1 and Inhibits Cartilage Oligomeric Matrix Protein Gene Expression and Chondrogenesis J. Biol. Chem., November 5, 2004; 279(45): 47081 - 47091. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bjarnason, B. Andersson, H. S. Kim, B. Olsson, D. Swolin-Eide, R. Wickelgren, B. Kristrom, B. Carlsson, K. Albertsson-Wikland, L. M. S. Carlsson, et al. Cartilage Oligomeric Matrix Protein Increases in Serum after the Start of Growth Hormone Treatment in Prepubertal Children J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5156 - 5160. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |