This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barlow, S. C. Articles by Bullard, D. C. Search for Related Content PubMed PubMed Citation Articles by Barlow, S. C. Articles by Bullard, D. C.

(American Journal of Pathology. 2003;163:197-202.)
© 2003 American Society for Investigative Pathology

Psoriasiform Dermatitis Susceptibility in Itgb2^tm1Bay PL/J Mice Requires Low-Level CD18 Expression and at Least Two Additional Loci for Progression to Severe Disease

Shayne C. Barlow^*, Robert G. Collins, Nigel J. Ball, Casey T. Weaver, Trenton R. Schoeb^* and Daniel C. Bullard^*

From the Departments of Genomics and Pathobiology^* and Pathology, The University of Alabama at Birmingham, Birmingham, Alabama; the Department of Pediatrics, Section of Leukocyte Biology, Baylor College of Medicine, Houston, Texas; and the Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver Hospital and Health Sciences Centre, Vancouver, Canada

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Itgb2^tm1Bay PL/J mice express low levels of the ß₂ integrins and, unlike Itgb2^tm1Bay C57BL/6J mice, spontaneously develop psoriasiform dermatitis with several similarities to human psoriasis. To define the genetic requirements for skin disease susceptibility we analyzed more than 500 F2 progeny from an Itgb2^tm1Bay (PL/J x C57BL/6J) intercross. We found that 23.5% developed chronic inflammatory skin disease, although significant differences in severity were observed. Another CD18 mutation, Itgb2^tm2Bay, has now been generated that completely eliminates CD18 expression. Surprisingly, of 10 Itgb2^tm2Bay homozygote PL/J N4 mice generated, none showed clinical or histopathological evidence of disease. However, Itgb2^tm1Bay/Itgb2^tm2Bay PL/J mice developed dermatitis indistinguishable from Itgb2^tm1Bay PL/J mice. In addition, approximately half of Itgb2^tm1Bay/Itgb2^tm2Bay (C57BL/6J x PL/J)F1 mice were found to develop mild psoriasiform dermatitis identical to the early stages of disease seen in Itgb2^tm1Bay PL/J mice. Collectively, these results suggest a complex inheritance pattern of psoriasiform dermatitis in this model that involves lowered, but not absent, CD18 expression and at least two additional PL/J loci for the development of severe disease. The susceptibility allele can act in either a heterozygous or homozygous state, dependent on the level of CD18 expression.

Currently, there are no spontaneous animal models that completely reproduce all of the different manifestations of psoriasis. However, several mouse models with a psoriasiform phenotype have been reported and can be used to study both the cellular mechanisms and genetic pathways that lead to the development of human inflammatory skin diseases. We have previously reported a model of psoriasiform dermatitis that develops in homozygous Itgb2^tm1Bay PL/J mice.¹⁷ Itgb2 encodes CD18, the ß subunit of the ß₂ integrins, a family of four heterodimeric proteins expressed only on leukocytes.¹⁸ The ß₂ integrins mediate many immune and inflammatory processes through interactions with a diverse set of ligands including ICAM-1. The Itgb2^tm1Bay mutation is hypomorphic in that it results in low level, but not null expression of CD18. Itgb2^tm1Bay PL/J mice, unlike Itgb2^tm1Bay C57BL/6J or 129/Sv mice, spontaneously develop dermatitis characterized clinically by erythema, alopecia, and scale and crust formation and histologically by lymphocyte infiltration of the superficial dermis and deep epidermis, epidermal proliferation with hyperkeratosis and parakeratosis, and accumulation of neutrophils in affected epidermis with formation of subcorneal pustules. Such dermatitis has not been reported in cattle or humans with spontaneous CD18 deficiency resulting in the disease leukocyte adhesion deficiency-1.

The phenotype of these mice is surprising considering the severe anti-inflammatory effects generally associated with inhibition or loss of CD18 expression. The chronic dermatitis observed in Itgb2^tm1Bay PL/J mice shows high penetrance, with 91% of fourth generation backcross (N4) and 100% of N6-N8 mice developing disease. Previous genetic analyses of Itgb2^tm1Bay PL/J (susceptible) and Itgb2^tm1Bay C57BL/6J (resistant) mice suggested that there may be a single recessive PL/J allele in addition to Itgb2^tm1Bay that is responsible for the disease susceptibility.¹⁷ This hypothesis was based on observations that Itgb2^tm1Bay (C57BL/6J x PL/J)F1 mice were phenotypically normal whereas 50% of N2 progeny generated from backcrossing these F1 mice to Itgb2^tm1Bay PL/J mice developed psoriasiform dermatitis.

Here we report the results of additional studies designed to further elucidate the genetics of psoriasiform dermatitis in Itgb2^tm1Bay PL/J mice. Analysis of a large cohort of F2 intercross progeny generated from Itgb2^tm1Bay PL/J and Itgb2^tm1Bay C57BL/6J mice showed that 23.5% of mice developed chronic skin inflammation with highly variable severity. This finding suggests that skin disease susceptibility in CD18-deficient mice requires a single recessive PL/J allele. We also studied the effects of lowered CD18 expression on skin disease development using another mutation, Itgb2^tm2Bay, which completely eliminates CD18 expression.¹⁹ Surprisingly, we observed that Itgb2^tm2Bay PL/J mice did not develop any clinical or histological evidence of psoriasiform dermatitis, whereas Itgb2^tm1Bay/Itgb2^tm2Bay compound heterozygous PL/J mice developed dermatitis indistinguishable from Itgb2^tm1Bay PL/J mice. In addition, nearly half of Itgb2^tm1Bay/Itgb2^tm2Bay (PL/J x C57BL/6)F1 mice developed mild psoriasiform dermatitis, in contrast to our previously reported finding that Itgb2^tm1Bay (PL/J x C57BL/6J)F1 mice are completely resistant to inflammatory skin disease.¹⁷ These findings indicate a crucial role for CD18 expression as well as other PL/J loci in the pathogenesis of psoriasiform dermatitis in this model.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Generation of Itgb2^tm1Bay (PL/J x C57BL/6J)F2 Mice

Itgb2^tm1Bay 129/Sv mice were backcrossed onto the PL/J and C57BL/6J mouse strains (The Jackson Laboratory, Bar Harbor, ME) for seven generations. F1 mice were generated by intercrossing homozygous Itgb2^tm1Bay N7 PL/J mice (susceptible) with homozygous Itgb2^tm1Bay N7 C57BL/6J mice (resistant). These F1 mice were bred together to produce an F2 population. Homozygous Itgb2^tm1Bay mice were observed for 6 months. Animals were evaluated every 2 to 3 weeks for 6 months and assigned a score based on the clinical severity of psoriasiform dermatitis. Disease was scored by the following scale: 1, red or dry skin in obvious areas with no hair loss; 2, red, dry skin with alopecia on the head, ears may or may not show signs of necrosis; and 3, hair loss extends to areas other that head, scale and crust formation. Animals were categorized based on the highest score they received throughout the 6-month study period.

Additional Crosses

The Itgb2^tm2Bay mutation (The Jackson Laboratory) was backcrossed four generations onto the PL/J strain background and homozygous Itgb2^tm2Bay mice were generated. Itgb2^tm1Bay/Itgb2^tm2Bay PL/J compound heterozygote mice were produced by intercrossing Itgb2^tm1Bay N6 PL/J mice with Itgb2^tm2Bay N5 PL/J mice. Itgb2^tm1Bay/Itgb2^tm2Bay (PL/J x C57BL/6J)F1 mice were generated by intercrossing Itgb2^tm1Bay N8 PL/J with Itgb2^tm2Bay N7 C57BL/6J. Itgb2^tm1Bay/Itgb2^tm2Bay C57BL/6J mice were made by intercrossing Itgb2^tm1Bay N10 C57BL/6J with Itgb2^tm2Bay N8 C57BL/6J. All animals were observed for age of onset and severity disease for a period of 6 to 9 months.

Preparation of Histology Sections

Samples of muzzle, ear, dorsum, and tail were fixed by immersion in alcoholic formalin (10 ml 40% formalin:70 ml absolute ethanol:20 ml distilled water); routinely trimmed, processed, and embedded in paraffin; sectioned at 5 µm; and stained with hematoxylin and eosin. Sections were evaluated with the identity of the experimental groups unknown to the examiner.

DNA Sequencing

Primers were generated from the Itgb2 genomic sequence obtained from the Celera and public databases. Primers were designed using Primer3 software (Massachusetts Institute of Technology, Cambridge, MA) in the intron sequence surrounding each of the 15 Itgb2 exons listed by Celera, an additional exon listed in NCBI (but not in Celera), the duplicated exon 3 with the neomycin resistance cassette-disrupted intron-exon boundary, and a part of exon 16 that was listed as exon sequence by NCBI and intron sequence by Celera. Primer sequences were as follows: exon 1 forward primer: ggcgctgacttagaacagga, exon 1 reverse primer: gcccacttctgaggtgtttc, exon 2 forward primer: ctggagtcacctgctccttc, exon 2 reverse primer: gcccactgtcaaggaatgtc, exon 3 forward primer: agtcagccctgtctgtctcc, exon 3 reverse primer: ggaagggcagcttagactctg, exon 3/neo forward primer: ggattgggaagacaatagcag, exon 3/neo reverse primer: ggaagggcagcttagactctg, cryptic exon 1 forward primer: caagtcagaggtggcgaaac, cryptic exon 1 reverse primer: agtggcgataagtcgtgtct, cryptic exon 2 forward primer: ggcacctatctcagcgatct, cryptic exon 2 reverse primer: cgttgcgcaaactattaactg, exon 4 forward primer: ttctagcctatgccctctgc, exon 4 reverse primer: acacattccaaccaggttcc, exon 5 forward primer: gctcagagtgtcccttgctt, exon 5 reverse primer: tcccaaggttgaaaggagtg, exon 6 forward primer: tctgcttctgtctgctgtcc, exon 6 reverse primer: gccctgagtttgaggaagtt, exon 7 forward primer: gggaaaccaaggcaggtaac, exon 7 reverse primer: aggcaggcagagcactcac, exon 8 forward primer: gtcctggaaggcttgtctga, exon 8 reverse primer: attgcacaaggttccgctta, exon 9 forward primer: cctgcgctagcttgatcttc, exon 9 reverse primer: cagctttgctggagactcac, exon 10 forward primer: cagccactcctgtctctcct, exon 10 reverse primer: gcaccctgctataggaacca, exon 11 forward primer: acccacagttgggaactgaa, exon 11 reverse primer: ccttttccatgaactgatgc, exon 12 forward primer: cccaagggcacacctaagta, exon 12 reverse primer: cctggtacaaatggacaaggaa, exon 13 forward primer: cctgcagggaagtgagtcat, exon 13 reverse primer: ctcccaggtagtccagcagt, exon 14 forward primer: cctgactcctcctcctcctc, exon 14 reverse primer: aggtaccacccagcctcac, exon 15 forward primer: ctgacatttttggttgtgtgc, exon 15 reverse primer: accacaagggttcccaaag, exon 16.1 forward primer: acctccctgcactgacaaga, exon 16.1 reverse primer: aagattgtgcaggtcggaag, exon 16.2 forward primer: cagggtttccagggacttgt, exon 16.2 reverse primer: cagcatggatggaagcttta. The exons were amplified from genomic DNA isolated from Itgb2^tm1bay PL/J and Itgb2^tm1bay C57BL/6 mice in 25-µl reactions in a Perkin-Elmer (Norwalk, CT) 9600 Thermal Cycler. The polymerase chain reaction products were electrophoresed in a 2% agarose gel and purified from excised gel slices using the QIAquick Gel Extraction Kit (Qiagen, Chatsworth, CA). DNA sequencing was performed using the ABI PRISM BigDye Terminator and Dye Primer Cycle Sequencing Ready Reaction Kits (Applied Biosystems, Foster City, CA) followed by electrophoresis on the ABI 377 automated sequencer.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Previous crosses designed to estimate the number of loci contributing to the psoriasiform phenotype in this model showed that 50% of backcross progeny developed disease with varying degrees of severity.¹⁷ This analysis suggested that a small number of loci, perhaps a single recessive PL/J allele, are required in addition to CD18 deficiency for susceptibility. However, this cross did not allow evaluation of the suppressive or other modifying effects of C57BL/6J homozygosity at these loci.

To further characterize the genetic requirements of psoriasiform dermatitis in this model, we intercrossed Itgb2^tm1Bay C57BL/6J and Itgb2^tm1Bay PL/J mice to produce F2 progeny. We observed 23.5% (116 of 494) incidence of disease in the homozygous Itgb2^tm1Bay offspring. For a single gene autosomal recessive trait in this cross, 25% incidence of disease would be expected, because all mice are homozygous for the Itgb2^tm1Bay mutation. Analyses by Z-test with Yates correction factor showed that there is no significant difference between our results and the expected incidences for a single recessive allele (P = 0.542). These data support our earlier backcross results and further suggests that susceptibility to this skin disease is controlled by two loci, Itgb2^tm1Bay and a recessive PL/J allele.

Approximately half of the affected F2 mice developed only mild disease with erythema and/or dry skin with correspondingly mild histological changes. In the remaining F2 mice, the disease progressed to a severe form with various degrees of alopecia (Figures 1 and 2) . Areas of alopecia are characterized by extension of the epithelial and inflammatory changes into the infundibulum of the follicle, progressive destruction and loss of affected follicles, and scarring. However, the features of the early stages of the severe form are clinically and histologically identical to those of the mild, nonprogressive form. Previously we reported that highly backcrossed Itgb2^tm1Bay PL/J mice always progress to the severe psoriasiform phenotype.¹⁷ Thus, these data suggest that the severity of skin disease is determined by PL/J loci other than the susceptibility locus.

View larger version (36K): [in this window] [in a new window]   Figure 1. Maximum score obtained by Itgb2tm1Bay(C57BL/6J x PL/J)F2 mice that developed skin disease throughout the 6-month study period. All mice were scored on a 0 to 3 scale of increasing severity of psoriasiform dermatitis (see Materials and Methods).

Previous studies showed that the level of Itgb2 expression on peripheral blood leukocytes in both Itgb2^tm1Bay 129/Sv and Itgb2^tm1Bay PL/J was less than 10% of control animals.²⁰ Because psoriasiform dermatitis does not develop in heterozygous PL/J Itgb2^tm1Bay mice, one requirement for disease susceptibility appears to be substantially reduced Itgb2 expression. To determine the effect of complete loss of Itgb2 expression on disease development, we backcrossed the Itgb2^tm2Bay mutation onto the PL/J strain background. Surprisingly, of 10 homozygous Itgb2^tm2Bay PL/J N4 mice generated, none showed clinical or histopathological evidence of disease (Figure 2, A and B) , nor did heterozygous Itgb2^tm2Bay PL/J mice develop psoriasiform dermatitis. We then bred these Itgb2^tm2Bay PL/J mice with Itgb2^tm1Bay PL/J mice to produce Itgb2^tm1Bay/Itgb2^tm2Bay PL/J compound heterozygotes. In this study we found that all compound heterozygote Itgb2^tm1Bay/Itgb2^tm2Bay PL/J mice developed disease that was clinically and histologically indistinguishable from that in Itgb2^tm1Bay PL/J mice (Figure 2, C and D) . In these mice, dermatitis was moderate to severe. Although the lesions tended to be multifocal or patchy, and not all changes were present in all sections from each mouse, the typical pattern included epidermal acanthosis and both orthokeratotic and parakeratotic hyperkeratosis. In the most severely affected areas, the epidermis contained infiltrates of neutrophils, with sparse focal intraepidermal neutrophil accumulations, or microabscesses. Neutrophils, with lesser numbers of lymphocytes, also were present in the superficial dermis, and the superficial dermal vessels were dilated. In a few sections, these changes tended to be particularly prominent in and around hair follicles.

View larger version (143K): [in this window] [in a new window]   Figure 2. A: Normal skin of a wild-type PL/J mouse. B: Normal skin of a Itgb2tm2Bay PL/J mouse. Itgb2tm2Bay homozygotes do not express CD18. C: Dermatitis in Itgb2tm1Bay PL/J mouse expressing low levels of CD18. The epidermis is acanthotic and there is orthokeratotic hyperkeratosis with focal accumulation of neutrophils. In the dermis there is infiltration of neutrophils and lesser numbers of lymphocytes, and the superficial dermal vessels are dilated. D: Dermatitis in a PL/J Itgb2tm1Bay/Itgb2tm2Bay heterozygote mouse, showing changes similar to those in Itgb2tm1Bay PL/J mice. E: Mild dermatitis in a Itgb2tm1Bay PL/J mouse. The epidermis is acanthotic and hyperkeratotic, but there are few neutrophils in the epidermis or dermis. The predominant inflammatory cells are lymphocytes, which are located primarily in the superficial dermis, the basal layer of the epidermis, and around hair follicles. F: Mild dermatitis in an Itgb2tm1Bay/Itgb2tm2Bay (C57BL/6J x PL/J)F1 mouse. Changes are similar to those in E, with lymphocytes prominent in the basal layers of the epidermis of the hair follicles.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Psoriasis is a common inflammatory skin disease. Its etiology is unknown, but probably involves both genetic and environmental factors. Even in a single patient there can be highly variable manifestations of the disease, suggesting that multiple mechanisms are involved in the pathogenesis of psoriasis. Unfortunately, there are few available animal models amenable to genetic analysis. The Itgb2^tm1Bay mouse serves as an excellent model for genetic studies of psoriasiform dermatitis, because both susceptible (PL/J) and resistant (C57BL/6J and 129/Sv) mouse strains have been described. Similar to human psoriasis, the Itgb2^tm1Bay PL/J phenotype is polygenic but has the advantage that one involved gene, Itgb2, is already known. The disease is 100% penetrant in highly backcrossed mice and offspring are viable and fertile, thus large numbers of animals can be generated. The dermatitis is also spontaneous and requires no surgical manipulation. Finally, we have recently observed that the skin disease in Itgb2^tm1Bay PL/J mice, like human psoriasis, is immunologically driven. Using T-cell depletion strategies, we found that the skin inflammation in this model was mediated by CD4⁺ and CD8⁺ T lymphocytes (SC Barlow et al, submitted).

In these studies, we wanted to further characterize the inheritance of psoriasiform dermatitis and evaluate the requirements for CD18 expression in this model. Our previous report suggested that only a few loci (possibly one) in addition to Itgb2^tm1Bay were responsible for the inflammatory skin disease observed in Itgb2^tm1Bay PL/J mice.¹⁷ This was based on the observation that 50% of the N2 offspring generated by breeding Itgb2^tm1Bay (C57BL/6J x PL/J)F1 mice to Itgb2^tm1Bay PL/J mice developed clinical signs of skin disease. Our finding that 23.5% of homozygous Itgb2^tm1Bay F2 mice developed psoriasiform dermatitis, combined with this previous result, strongly suggests that susceptibility to psoriasiform dermatitis in Itgb2^tm1Bay mice requires only the influence of a single recessive PL/J allele. Analysis of the genomic DNA sequence from dermatitis-susceptible and -resistant strains demonstrates that susceptibility to the disease is not mediated by polymorphisms in the Itgb2^tm1Bay mutation itself.

In these mice we observed highly variable severity of disease (Figure 1) . In highly backcrossed Itgb2^tm1Bay PL/J mice, the disease develops as erythema and/or dry skin on the ears and tail and then progresses over the body and involves significant alopecia in the advanced stages. Interestingly, in the F2 mice we observed some mice that developed the early manifestations of psoriasiform dermatitis, erythema and/or dry skin on ear and tail, but did not progress to the more severe phenotype involving alopecia. The highly variable severity observed in these F2 mice suggest that other PL/J loci control the extent to which disease develops, although at this time it is difficult to estimate the exact number of modifying loci.

Another CD18 mutation, Itgb2^tm2Bay, has now been reported that completely eliminates expression of CD18, and thus all ß₂ integrins.¹⁹ This mutation on a mixed 129/Sv and C57BL/6J background did show a phenotype of spontaneous skin ulcerations, but unlike CD18-deficient (Itgb2^tm1Bay) PL/J mice, this trait was associated with bacterial infection and the mice did not develop psoriasiform lesions. We backcrossed this mutation onto the PL/J strain background to evaluate whether the complete absence of CD18 would alter the pathogenesis of psoriasiform dermatitis. This mutation on other strain backgrounds, such as C57BL/6J and 129/Sv, results in a phenotype characterized by the increased susceptibility to infection.¹⁹ In our analysis, we observed no clinical or histological signs of psoriasiform dermatitis in homozygous Itgb2^tm2Bay mice backcrossed four generations onto PL/J. This is in contrast to Itgb2^tm1Bay N4 mice, in which more than 90% incidence of disease was observed.¹⁷ These data suggest that lowered, but not absent, expression of CD18 is required for the development of inflammatory skin disease in this model.

One possible explanation of these observations is that the initiation of psoriasiform dermatitis in these mice involves reduced ß₂ integrin expression and that complete elimination of these adhesion molecules prevents the onset of disease. Low-ß₂ integrin expression, resulting from this Itgb2^tm1Bay mutation, may result in reduced cellular interactions and/or alterations in intracellular signaling and lead the to the development of psoriasiform dermatitis in PL/J mice. From our data we would thus predict that these altered events may not occur in wild-type, Itgb2^tm1Bay heterozygous, and Itgb2^tm2Bay PL/J mice. Another possible explanation is that the initiating events mediating skin inflammation occur in Itgb2^tm2Bay mice, but the total absence of the ß₂ integrin expression inhibits leukocyte emigration into the skin, thus preventing the disease. However, previous studies have shown that there is significant overlap of function among the ß₂ integrin and other leukocyte adhesion molecules.²¹ Therefore, we think it is unlikely that the Itgb2^tm2Bay mutation prevents the disease from developing by blocking leukocyte emigration. Our data further suggests that the genetic requirements for the development of psoriasiform dermatitis in PL/J mice vary dependent on the level of CD18 expression. This is evident from our findings that approximately half of Itgb2^tm1Bay/Itgb2^tm2Bay (C57BL/6J x PL/J)F1 mice develop dermatitis, unlike Itgb2^tm1Bay (C57BL/6J x PL/J)F1 mice. This suggests that the PL/J susceptibility locus can sometimes act in either a heterozygous or homozygous state, dependent on the level of CD18 expression. However, the progression to the more severe psoriasiform phenotype requires PL/J homozygosity at another locus or loci.

In summary, our findings indicate that the psoriasiform phenotype in Itgb2^tm1Bay PL/J mice has a complex inheritance pattern. The development of this disease requires lowered CD18 expression and multiple PL/J alleles for progression to severe disease. Our ongoing efforts to localize and identify the PL/J loci that mediate skin disease susceptibility and severity will allow characterization of this complex inheritance and may have relevance to the genetics of human psoriasis and other chronic inflammatory diseases.

	Footnotes

 
Address reprint requests to Daniel C. Bullard, University of Alabama at Birmingham, Department of Genomics and Pathobiology, 640A Kaul Building, 720 20th St., Birmingham, AL 35294. E-mail: pike{at}uab.edu

Accepted for publication April 4, 2003.

	References

Top Abstract Materials and Methods Results Discussion References

 

1. Nickoloff BJ: The immunologic and genetic basis of psoriasis. Arch Dermatol 1999, 135:1104-1110[Free Full Text]
2. Duffy DL, Spelman LS, Martin NG: Psoriasis in Australian twins. J Am Acad Dermatol 1993, 29:428-434[Medline]
3. Capon F, Dallapiccola B, Novelli G: Advances in the search for psoriasis susceptibility genes. Mol Genet Metab 2000, 71:250-255[Medline]
4. Nair RP, Henseler T, Jenisch S, Stuart P, Bichakjian CK, Lenk W, Westphal E, Guo SW, Christophers E, Voorhees JJ, Elder JT: Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan. Hum Mol Genet 1997, 6:1349-1356[Abstract/Free Full Text]
5. Enerback C, Enlund F, Inerot A, Samuelsson L, Wahlstrom J, Swanbeck G, Martinsson T: S gene (Corneodesmosin) diversity and its relationship to psoriasis; high content of cSNP in the HLA-linked S gene. J Invest Dermatol 2000, 114:1158-1163[Medline]
6. Trembath RC, Clough RL, Rosbotham JL, Jones AB, Camp RD, Frodsham A, Browne J, Barber R, Terwilliger J, Lathrop GM, Barker JN: Identification of a major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by a two stage genome-wide search in psoriasis. Hum Mol Genet 1997, 6:813-820[Abstract/Free Full Text]
7. Gonzalez S, Martinez-Borra J, Del Rio JS, Santos-Juanes J, Lopez-Vazquez A, Blanco-Gelaz M, Lopez-Larrea C: The OTF3 gene polymorphism confers susceptibility to psoriasis independent of the association of HLA-Cw*0602. J Invest Dermatol 2000, 115:824-828[Medline]
8. Samuelsson L, Enlund F, Torinsson A, Yhr M, Inerot A, Enerback C, Wahlstrom J, Swanbeck G, Martinsson T: A genome-wide search for genes predisposing to familial psoriasis by using a stratification approach. Hum Genet 1999, 105:523-529[Medline]
9. Veal CD, Clough RL, Barber RC, Mason S, Tillman D, Ferry B, Jones AB, Ameen M, Balendran N, Powis SH, Burden AD, Barker JN, Trembath RC: Identification of a novel psoriasis susceptibility locus at 1p and evidence of epistasis between PSORS1 and candidate loci. J Med Genet 2001, 38:7-13[Abstract/Free Full Text]
10. Burden AD, Javed S, Bailey M, Hodgins M, Connor M, Tillman D: Genetics of psoriasis: paternal inheritance and a locus on chromosome 6p. J Invest Dermatol 1998, 110:958-960[Medline]
11. Nair RP, Stuart P, Henseler T, Jenisch S, Chia NV, Westphal E, Schork NJ, Kim J, Lim HW, Christophers E, Voorhees JJ, Elder JT: Localization of psoriasis-susceptibility locus PSORS1 to a 60-kb interval telomeric to HLA-C. Am J Hum Genet 2000, 66:1833-1844[Medline]
12. Oka A, Tamiya G, Tomizawa M, Ota M, Katsuyama Y, Makino S, Shiina T, Yoshitome M, Iizuka M, Sasao Y, Iwashita K, Kawakubo Y, Sugai J, Ozawa A, Ohkido M, Kimura M, Bahram S, Inoko H: Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene. Hum Mol Genet 1999, 8:2165-2170[Abstract/Free Full Text]
13. Matthews D, Fry L, Powles A, Weber J, McCarthy M, Fisher E, Davies K, Williamson R: Evidence that a locus for familial psoriasis maps to chromosome 4q. Nat Genet 1996, 14:231-233[Medline]
14. Capon F, Novelli G, Semprini S, Clementi M, Nudo M, Vultaggio P, Mazzanti C, Gobello T, Botta A, Fabrizi G, Dallapiccola B: Searching for psoriasis susceptibility genes in Italy: genome scan and evidence for a new locus on chromosome 1. J Invest Dermatol 1999, 112:32-35[Medline]
15. Lee YA, Ruschendorf F, Windemuth C, Schmitt-Egenolf M, Stadelmann A, Nurnberg G, Stander M, Wienker TF, Reis A, Traupe H: Genomewide scan in German families reveals evidence for a novel psoriasis-susceptibility locus on chromosome 19p13. Am J Hum Genet 2000, 67:1020-1024[Medline]
16. Kaluza W, Reuss E, Grossmann S, Hug R, Schopf RE, Galle PR, Maerker-Hermann E, Hoehler T: Different transcriptional activity and in vitro TNF-alpha production in psoriasis patients carrying the TNF-alpha 238A promoter polymorphism. J Invest Dermatol 2000, 114:1180-1183[Medline]
17. Bullard DC, Scharffetter-Kochanek K, McArthur MJ, Chosay JG, McBride ME, Montgomery CA, Beaudet AL: A polygenic mouse model of psoriasiform skin disease in CD18-deficient mice. Proc Natl Acad Sci USA 1996, 93:2116-2121[Abstract/Free Full Text]
18. Hynes RO: Integrins: a family of cell surface receptors. Cell 1987, 48:549-554[Medline]
19. Scharffetter-Kochanek K, Lu H, Norman K, van Nood N, Munoz F, Grabbe S, McArthur M, Lorenzo I, Kaplan S, Ley K, Smith CW, Montgomery CA, Rich S, Beaudet AL: Spontaneous skin ulceration and defective T cell function in CD18 null mice. J Exp Med 1998, 188:119-131[Abstract/Free Full Text]
20. Wilson RW, Ballantyne CM, Smith CW, Montgomery C, Bradley A, O’Brien WE, Beaudet AL: Gene targeting yields a CD18-mutant mouse for study of inflammation. J Immunol 1993, 151:1571-1578[Abstract]
21. Bullard DC: Knockout mice in inflammation research. Ley K eds. Physiology of Inflammation. 2001:pp 381-401 Oxford University Press, New York

This article has been cited by other articles:

				D. M. Danilenko Review Paper: Preclinical Models of Psoriasis Vet. Pathol., July 1, 2008; 45(4): 563 - 575. [Abstract] [Full Text] [PDF]

				D. Kess, A.-K. B. Lindqvist, T. Peters, H. Wang, J. Zamek, R. Nischt, K. W. Broman, R. Blakytny, T. Krieg, R. Holmdahl, et al. Identification of Susceptibility Loci for Skin Disease in a Murine Psoriasis Model J. Immunol., October 1, 2006; 177(7): 4612 - 4619. [Abstract] [Full Text] [PDF]

				S. Goebel, M. Huang, W. C. Davis, M. Jennings, T. J. Siahaan, J. S. Alexander, and C. G. Kevil VEGF-A stimulation of leukocyte adhesion to colonic microvascular endothelium: implications for inflammatory bowel disease Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G648 - G654. [Abstract] [Full Text] [PDF]

				S. C. Barlow, H. Xu, C. T. Weaver, J. R. Lindsey, T. R. Schoeb, and D. C. Bullard Development of dermatitis in CD18-deficient PL/J mice is not dependent on bacterial flora, and requires both CD4+ and CD8+ T lymphocytes Int. Immunol., February 1, 2004; 16(2): 345 - 351. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barlow, S. C. Articles by Bullard, D. C. Search for Related Content PubMed PubMed Citation Articles by Barlow, S. C. Articles by Bullard, D. C.