| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |



From the Ludwig Institute for Cancer Research,* Stockholm Branch, Stockholm; the Ludwig Institute for Cancer Research,
Uppsala Branch, Uppsala; and the Department of Physiology and Pharmacology,
Karolinska Institutet, Stockholm, Sweden
| Abstract |
|---|
|
|
|---|
-myosin heavy chain promoter and created a transgenic mouse that exhibits cardiac fibrosis followed by hypertrophy with sex-dependent phenotypes. The transgenic mice developed several pathological changes including cardiac fibroblast proliferation and deposition of collagen, hypertrophy, vascular defects, and the presence of Anitschkow cells in the adult myocardium. Male mice developed a hypertrophic phenotype, whereas female mice were more severely affected and developed dilated cardiomyopathy, leading to heart failure and sudden death. The vascular defects initially included dilation of microvessels and vascular leakage. Subsequently, a marked loss of microvessels, formation of large vascular sac-like structures, and an increased density of smooth muscle-coated vessels were observed in the myocardium. In part, the observed vascular changes may be because of an up-regulation of vascular endothelial growth factor in cardiac fibroblasts of the transgenic hearts. This unique animal model reveals that a potent mitogen for cardiac fibroblasts result in an expansion of the interstitium that induce a secondary sex-dependent hypertrophic response in the cardiomyocytes.
Several types of growth factors are able to induce cardiac hypertrophy and fibrosis, among them tumor necrosis factor (TNF)-
and transforming growth factor-ß.6,7
Platelet-derived growth factors (PDGFs) are potent mitogens for many cell types of mesenchymal origin, including cardiac fibroblasts.8,9
The PDGF family consists of four different members; PDGF-A, PDGF-B, PDGF-C, and PDGF-D.9,10
The PDGF isoforms bind to and activate two receptor tyrosine kinases, PDGFR-
and PDGFR-ß, that are differentially expressed in target tissues. PDGF-A, -B, and -C chains bind to PDGFR-
with high affinity, whereas only PDGF-B and -D chains bind PDGFR-ß. The two novel PDGFs, PDGF-C and PDGF-D, differ from PDGF-A and -B in that they are secreted as latent factors that require proteolytic activation by removal of the N-terminal CUB domain for activity.11,12
In cardiovascular medicine, transgenic animals with induced myocardial diseases mimicking those found in humans are of great interest, and may provide unique opportunities to explore diverse aspects of the diseases, including drug development. Despite the well known roles of the PDGFs as potent mitogens for fibroblasts, potentially being directly involved in fibrotic reactions in a variety of organs,9
only a few attempts to overexpress PDGFs in vivo using transgenic techniques have been performed.13-16
In this work we have targeted transgenic overexpression of PDGF-C to the heart using the
-myosin heavy chain (
-MHC) promoter and have created a mouse model in which a potent fibroblast mitogen is overexpressed in the heart, leading to a progressive fibrosis and hypertrophy. Female mice were shown to develop a lethal dilated cardiomyopathy, whereas the males develop a more progressive hypertrophic phenotype. As a control, transgenic mice overexpressing the CUB domain only were also generated. These mice appeared primarily normal suggesting that the activated PDGF-C core domain is responsible for the pathological changes seen in the mice expressing full-length PDGF-C.
| Materials and Methods |
|---|
|
|
|---|
Transgenic mice overexpressing full-length PDGF-C in the heart were generated as earlier described using CBA/C57BL/6 mice.11 Transgenic mice were maintained by backcrossing onto C57BL/6 animals the first generation and then by brother-sister matings. The transgenic expression and the observed phenotypes were stable for at least five generations. All experiments were performed using heterozygous and wild-type animals.
To generate transgenic mice overexpressing the CUB domain of PDGF-C, mouse PDGF-C cDNA was subjected to polymerase chain reaction (PCR) mutagenesis using the following primers: 5' CGC GGT CGA CGC CCC AGT CAG CCA A (forward) including a flanking SalI site and 5' CGC GAA GCT TTT ACA AGT CTT CTT CAG AAA TGA GCT TTT GTT CTG TGA CTT GTG GCA (reverse) including the human c-Myc epitope and a flanking HindIII site. The PCR generated a 572-bp fragment that was digested with SalI/HindIII and cloned into the
-MHC vector17
(kindly provided by K. Alitalo, Helsinki University, Helsinki, Finland). The linearized and purified transgene fragment was injected into male pronuclei of fertilized mouse oocytes (Mouse Camp, Karolinska Institutet, Stockholm, Sweden). Tail lysate prepared from the resulting pups was screened for the presence of the transgene by PCR using the CUB domain-specific primer used in the cloning 5' CGC GGT CGA CGC CCC AGT CAG CCA A (forward) and the c-Myc/CUB-specific primer 5' ATG AGC TTT TGT TCT GTG AC (reverse). A 542-bp fragment was amplified in the transgenic founders. The animal experiments in this study were approved by the local committee of the Swedish National Board for Laboratory Animals (CFN).
Histology and Immunohistochemistry
Wild-type and heterozygous littermates of different ages were sacrificed and weighed. The hearts were dissected and weighed or frozen on dry ice for protein and RNA extraction, or fixed in 4% paraformaldehyde in phosphate-buffered saline overnight at + 4°C and processed for paraffin-embedding using standard protocols. A few hearts were collected from females that died from heart failure. Microphotographs of whole hearts were taken with a Nikon Digital Camera finePix S1 pro. The paraffin-embedded hearts were sectioned (6 µm) and the sections stained with hematoxylin and eosin (H&E), or with Massons trichrome, using standard procedures. Visualization of myofibrils was performed using a phosphotungstic acid hematoxylin staining kit (Bio Optica, Milano, Italy). Immunolocalization of PDGF-C was performed using TSA indirect (NEN Life Science, Boston, MA, USA) with an affinity-purified rabbit Ig fraction to human PDGF-C core domain protein (1 µg Ig/ml).11
Endothelial-specific staining was performed as above using rat anti-mouse CD31/platelet-endothelial cell adhesion molecule (PECAM) antibody (Pharmingen, San Diego, CA, USA) as earlier described.18
-Smooth muscle actin (SMA) staining was performed using a monoclonal anti-human
-SMA antibody 1A4 (DAKO, Glostrup, Denmark). Antigen retrieval was obtained by heating the tissue slides in 0.01 mol/L of citrate buffer, pH 6.0, at 94°C for 20 minutes. Vascular endothelial growth factor (VEGF) staining was performed using a rabbit polyclonal anti-VEGF antibody A 20 (Santa Cruz, Biotechnology, Santa Cruz, CA, USA). Antigen retrieval was obtained as above. Detection of proliferating cells was performed using a mouse monoclonal anti-proliferating cell nuclear antigen antibody (Chemicon, Temecula, CA, USA). For SMA, VEGF, and proliferating cell nuclear antigen stainings, Elite ABC Vectastain (Vector Laboratories, Burlingame, CA, USA) was used.
RNase Protection Assay
Total RNA extracted from hearts was analyzed by RNase protection assay using [32P]UTP-labeled riboprobes as earlier described.19 A ß-actin probe was used as an internal control. The results were visualized and quantified using a phosphorimager (Fuji Bas 1500).
Immunoblot Analysis
Proteins were extracted from heart tissue in lysis buffer including protease inhibitor mix (Complete; Roche, Mannheim, Germany) according to standard protocols. Aliquots were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12%) under reducing conditions. Immunoblotting was performed using the affinity-purified rabbit Ig fraction to human PDGF-C core domain PDGF-C (see above, 1 µg Ig/ml) or a rabbit polyclonal Ig against human c-Myc for detection of transgenic CUB domain (1/500, Santa Cruz). Bound antibodies were visualized using ECL+ (Amersham Biosciences, Buckinghamshire, England). Expression levels were compared using a Luminiscent Image Analyzer (Fuji Film, Japan). As loading control, the ER protein calnexin was visualized using a rabbit antiserum against human calnexin (kindly provided by Jonas Fuxe, Ludwig Institute for Cancer Research Stockholm Branch, Stockholm, Sweden).
Northern Blot Analysis
Total RNA was extracted from heart tissue by sonicating frozen tissue in lysis buffer according to the guanidinum thiocyanate/acid phenol method.20 Twenty µg of total RNA from each sample was subsequently subjected to agarose gel electrophoresis and blotted onto nylon filters. The hybridizations were performed in 50% formamide containing solutions at 42°C overnight and the filters were subsequently washed at high stringency. The results were visualized and quantified using a phosphoimager (Fuji Bas 1500). The probes were radiolabeled to high specific activity with [32P]dCTP (Amersham) using random priming as recommended by the supplier (Megaprime; Amersham). The probes were: GAPDH cDNA (200-bp PCR product generated using primers 5' ATGCCAGTGAGCTTCCCGTTCAGC (forward) and 5' TGGTATCGTGGAAGGACTCATGAC (reverse)), brain natriuretic peptide (BNP) DNA (500-bp PCR product generated using primer 5' GATCTCCTGAAGGTGCTGTCC (forward) and 5' ATCCGGTCTATCTTGTGCCCA (reverse)), and isolated inserts from IMAGE cDNA clones (Incyte Genomics, St. Louis, MO, USA) encoding atrial natriuretic peptide (ANP) (GenBank AI324503), and myosin light chain (MLC)-2 (GenBank AA434871).
PDGFR-
Analysis
Hearts were homogenized in lysis buffer containing 50 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 0.5 mmol/L vanadate, and protease inhibitors (Complete; Roche). Supernatants were collected and an equal amount of protein from each lysate was immunoprecipitated using PDGFR-
rabbit antiserum (R7) on ice followed by incubation with protein A-Sepharose. Beads were washed and boiled in 2x SDS loading buffer and subjected to 7% SDS-PAGE under reducing conditions. Immunoblotting was performed using rabbit serum against C-terminal PDGFR (CED), or a monoclonal anti-phosphotyrosine antibody (Py99, 1 µg/ml). Bound antibodies were visualized using ECL+ (Amersham).
Echocardiography
Mice were anesthetized using isoflurane (Forene, Baxter, Deerfield, IL, USA) in 40% oxygen. The analysis was performed using echocardiography (Philips ATL HTI5000E equipped with a 15 MHz probe, CL 15-7). Posterior wall thickness, end systolic and end diastolic left ventricle diameters, and ECGs were recorded simultaneously. Fractional shortening was calculated.
| Results |
|---|
|
|
|---|
Transgenic mice expressing full-length PDGF-C under the control of the
-MHC promoter were generated as earlier described.11
Newborn transgenic pups appeared normal and transgenic mice were born with the expected frequency in each litter. Immunoblotting of heart lysates under reducing conditions from 1- or 3-month-old animals showed that transgenic PDGF-C appeared as species of 45 kd (full length) and 35 kd (partially processed) (Figure 1a)
. To investigate whether there was a difference in the expression level or processing of transgenic PDGF-C between females and males, protein extracts from four different animals of each sex at the age of 1 month were compared. No differences were observed. In wild-type animals the expression of endogenous PDGF-C was below the level of detection. As a control, transgenic mice overexpressing the CUB domain only were generated and analyzed (see below).
|
-MHC is only expressed at low levels. After birth there is a switch in isoform expression and
-MHC becomes the major isoform.21,22
In the newborn transgenic mouse PDGF-C protein could only be detected in a small portion of cells. Gradually the expression expanded and in the adult mouse (3 months) the majority of cardiomyocytes expressed PDGF-C. Female and male mice showed a similar expression pattern. Because the overexpression of PDGF-C was driven by the
-MHC promoter the observed expression pattern was expected. These results show expression and in vivo processing of transgenic PDGF-C and support earlier findings.11
PDGFR-
Is Up-Regulated and Activated in PDGF-C Transgenic Heart
To investigate whether PDGFR-
was activated in vivo, tissue lysates from wild-type and transgenic littermates were subjected to immunoprecipitation using an antiserum to PDGFR-
, the precipitates were resolved by SDS-PAGE, and analyzed by immunoblotting using anti-phosphotyrosine antibodies, or an antiserum against PDGF receptors. In the transgenic hearts, PDGFR-
was strongly tyrosine phosphorylated, in contrast to the wild-type tissue (Figure 1c)
. Control immunoblottings, using the antiserum to PDGF receptors, visualized a 170-kd band corresponding to mature PDGFR-
in both wild-type and transgenic hearts. An additional faster migrating species of
140 kd was detected only in transgenic hearts. This species may correspond to immature and not fully processed PDGFR-
, suggesting enhanced synthesis of the receptor in transgenic tissue. Both female and male mice were used in the analysis and no sex difference was observed regarding receptor activation or expression. Analysis by RNase protection assay showed an almost three-fold up-regulation of PDGFR-
mRNA in transgenic hearts compared with the wild type, confirming the previous suggestion (Figure 1d)
. Immunostaining of tissue sections using an antibody against the proliferating cell nuclear antigen showed a significant increase of proliferating fibroblasts in the transgenic heart (Figure 1g
and Table 1
). These results suggest that transgenic PDGF-C becomes activated and is able to stimulate PDGFR-
expressed primarily by interstitial fibroblasts.8
The up-regulation of the PDGFR-
mRNA probably reflects the increased number of this cell type in the transgenic tissue (see below).
|
PDGF-C transgenic mice appeared normal during embryonic development, and at birth as compared to wild-type littermates. At 2 weeks, mild fibrosis but no hypertrophy was observed, and the animals appeared normal. At 1 month, heart to body weight ratios in age-matched animals were significantly higher in transgenic females compared to wild-type animals (Figure 1e)
. As the mice grew older, the difference increased dramatically, especially in females. The increase in heart:body weight ratios resulted from both larger hearts and a general weight loss probably caused by the dysfunctional heart. Starting from the age of 3 months, transgenic females died from heart failure. Abdominal swelling, because of edema, was sometimes observed and was probably a consequence of failing heart functions (data not shown). Male transgenic mice did not die spontaneously before sacrifice at 7 months. Generation of homozygous transgenic mice resulted in heart failure at younger age suggesting a dose-dependent phenotype, and these mice were not further analyzed in detail.
PDGF-C transgenic hearts developed a progressive hypertrophy (Figure 1f)
. In H&E-stained tissue sections several pathological changes were observed (Figure 2, a to h, o and p)
. The most striking feature was the increased number of interstitial fibroblasts in the transgenic hearts leading to a disorganized myocardial architecture, and increased thickness of the ventricular walls. Massons trichrome staining of tissue sections from transgenic mice of increasing age showed progressive collagen depositions in the transgenic hearts, suggesting that transgenic animals developed a progressive cardiac fibrosis (Figure 2, i to n)
.
|
24 kd (Figure 3a)
|
The effect of PDGF-C overexpression was partially sex-dependent (Figure 2h)
. Male and female mice displayed similar phenotypes up to 1 month of age, including the proliferation of interstitial cells, and some pathological changes in the myofibers. However, at the age of 3 months, prominent differences between the sexes had developed. Transgenic males developed the progressive cardiac hypertrophy, including a thickened left ventricle wall and reduced ventricle volume, whereas transgenic females developed dilated cardiomyopathy. To visualize muscle myofibrils heart sections were stained with phosphotungstic acid hematoxylin. In the transgenic male, muscle fibers were thickened (data not shown). We were unable to detect a similar hypertrophic response in the transgenic female myocardium before the dilatation. Atrial thrombosis was frequently observed in females with a failing heart and female transgenic mice were very seldom were alive at 6 months of age. There was a variability in the severity of the phenotypes between the male transgenic mice, probably as a result of nonhomogenous genetic background. Mild dilation of male hearts was observed in some cases.
Up-Regulation of Hypertrophic Markers in PDGF-C Transgenic Mice
Cardiac hypertrophy and fibrosis is frequently associated with re-expression of genes expressed during fetal and perinatal development, and up-regulation of some cardiac proteins (eg, ANP, BNP,
-SMA, and MLC-2).23,24
Northern blot analysis of RNA from wild-type and transgenic mice showed that ANP and BNP were up-regulated in the transgenic hearts compared to the wild-type. MLC-2 was slightly down-regulated in the females but was differentially regulated in males, which most likely reflects the variability in the severity of the phenotypes between the analyzed male transgenic mice (Figure 2q)
. The differences in expression levels were more prominent in females, supporting the observation that females develop a more severe dilated phenotype. By immunohistochemistry, expression of
-SMA was shown to be up-regulated in cardiomyocytes of transgenic hearts (Figure 4, i and j)
. In the CUB transgenic heart, SMA was also found to be up-regulated in the cardiomyocytes (data not shown).
|
To investigate the potential angiogenic activity of PDGF-C and its impact on the vasculature, blood vessels were identified by immunostaining of tissue sections for PECAM/CD31 expression. No differences in the structure of the vasculature were observed between wild-type and transgenic mice at 1 month of age (data not shown). However, as the mice grew older significant differences were observed (ages 3 to 4 and 6 to 7 months). The blood vessel densities, mainly capillaries, were generally lower in older transgenic hearts compared to wild-type (Figure 4, a to h
, and Table 2
). In transgenic hearts, the normal capillary network was gradually replaced by dilated capillaries, and sac-like structures. Also, normally larger vessels were enlarged in transgenic hearts. For quantification, corresponding areas of left ventricle were selected in sections from both transgenic and wild-type animals.
|
|
Immunohistochemical staining revealed an up-regulation of VEGF in interstitial fibroblasts of PDGF-C transgenic hearts (Figure 4, k and l)
. This up-regulation was observed already at the age of 2 weeks at the same time as proliferation of interstitial fibroblasts was first observed, before changes in the vasculature. These data show that the vasculature is significantly altered in the PDGF-C transgenic animals. The up-regulation of VEGF may at least in part explain the observed alterations.
Echocardiography Analysis of PDGF-C Transgenic Hearts
Transgenic animals and littermate controls (3.5 month of age) were analyzed by echocardiography and electrocardiography (ECG) (Figure 5)
. Posterior left ventricle wall thickness, end systolic and end diastolic left ventricle diameters, and ECG were recorded simultaneously. The contractile function was also estimated by calculating the fractional shortening (Figure 5
and Table 4
). The results essentially confirm the histological findings showing that PDGF-C overexpression leads to cardiac hypertrophy with decreased contractile function measured as fractional shortening, and that females develop a severe dilated phenotype. Expectedly, the conduction properties in the transgenic hearts were also severely affected with prolonged PQ interval, broadened QRS complex, and changes in the ST area. There was some variability in the degree of hypertrophy between transgenic males, probably because of a nonhomologous genetic background.
|
|
| Discussion |
|---|
|
|
|---|
. The hypertrophic induction of the cardiomyocytes in this model is interesting because it is generally believed that the hypertrophic response of the cardiomyocytes, or tissue damage is proceeding the expansion of the interstitium and subsequent fibrosis, and not vice versa. It should be noted that the increase in heart mass probably reflects an excessive number of fibroblasts as well as hypertrophic cardiomyocytes.
Interestingly,
-MHC promoter-driven overexpression of PDGF-A in the mouse heart leads to a phenotype similar to that observed in PDGF-C transgenic animals with the difference that the hypertrophic phenotype is seen already in postnatal animals (Christer Betsholtz, personal communication). The temporal differences may reflect the fact that PDGF-C is a latent growth factor11
and that proteolytic processing and activation is rate limiting in the PDGF-C transgenic animals. Only a portion of transgenic PDGF-C protein was processed, which may reflect the fact that PDGF-C is normally expressed at low levels in the adult mouse heart in contrast to human hearts where it is highly expressed.11,25
Therefore the necessary protease(s) may not be expressed at sufficient levels to be able to quantitatively process transgenic PDGF-C.
The general function of CUB domains is unclear.26
We have however shown that the CUB domain of PDGF-C has no pathological effect in the mouse heart because transgenic mice overexpressing this domain in the heart appear normal. The study also excluded that the
-MHC promoter itself caused any pathological changes. We suggest that the activated PDGF-C core domain is responsible for the phenotype in transgenic mice expressing full-length PDGF-C. It has been suggested that the CUB domain of PDGF-C expressed in Escherichia coli is able to stimulate proliferation of human artery smooth muscle cells.27
We could not confirm this result because we could not detect any obvious vascular abnormalities or proliferation of smooth muscle cells in the CUB transgenic mice.
One of the hallmarks of cardiac hypertrophy is an altered profile of gene expression. Genes normally expressed during fetal development are re-expressed during hypertrophy, eg,
-SMA, ANP, and BNP.28-32
The expression of certain cardiac genes expressed in adult myocardium is also up-regulated, such as MLC-2.23,24
In the hearts of adult PDGF-C transgenic mice, ANP and BNP mRNAs and SMA protein expression were up-regulated as expected, whereas MLC-2 mRNA was differentially regulated, which probably reflects the degree of hypertrophy. It is possible that up-regulation of MLC-2 is correlated with cardiomyopathies in which hypertrophy is the primary pathological change, whereas in our model, the primary histopathological change is the proliferation of fibroblasts.
We observed sex-dependent phenotypes with the transgenic males developing the progressive hypertrophy and the females developing a lethal dilated cardiomyopathy. The different phenotypes were also reflected in the regulation of the molecular markers in which the females displayed larger changes in expression levels compared to the males. The most striking feature was the up-regulation of BNP in females, supporting the suggestion that female transgenic mice suffered from heart failure.30 In humans, the risk of developing cardiovascular disease is lower in premenopausal women than in men, whereas postmenopausal women are more susceptible. The differences in susceptibility are believed to be related to estrogen status.33 Several animal models of cardiomyopathies are available, most of which affect males more seriously. However, atrial thrombosis, a common consequence in dilated cardiomyopathy occurs earlier in female hamsters than in males.1 A similar complication was observed in the PDGF-C transgenic females. The reason why females develop a more severe phenotype in our transgenic model is not clear (see below).
In a similar study in which TNF-
was overexpressed in mouse heart the animals developed opposite sex differences, with males having the dilated phenotype.6
Further analysis showed that the expression levels of the transgenic TNF-
, as well as several cytokines regulated by TNF-
signaling, were equal in both females and males. However, the expression of TNFR-1 and -2 as well as the TNF-
-responsive second messenger molecule, ceramide, was higher in males than in females. In the present study the expression level of transgenic PDGF-C is equal between the two sexes. Expression and activation of PDGFR-
does not seem to differ between the sexes. It is possible that the sex difference observed arises from the downstream targets of PDGF-C signaling or reflects a secondary response in the sensitivity to the induced fibrosis.
Characteristic vascular abnormalities developed in the PDGF-C transgenic hearts. The microvessels gradually became dilated and sometimes developed into large sac-like structures, similar to the large vessels and vascular pools seen in muscle tissue transplanted with myoblasts engineered to overexpress VEGF.34 In support of a role of VEGF in this phenotype is the observation that VEGF is up-regulated in cardiac fibroblasts in the transgenic hearts. The up-regulation of VEGF may be directly linked to PDGF-C overexpression and PDGF receptor-mediated signaling, or an indirect consequence of tissue damage, increased deposition of extracellular matrix, or tissue hypoxia. At least in part the increase in VEGF production may be due to PDGF-C overexpression because we observed abundant VEGF expression in the cardiac fibroblasts already in 2-week-old animals, at the early onset of fibroblast proliferation and before any detectable hypertrophy or any other myocardial abnormalities. In vitro studies have also shown that overexpression of PDGF-C in NIH/3T3 cells causes up-regulation of VEGF expression.35 In the cornea pocket assay, PDGF-C is a potent inducer of angiogenesis, but the underlying mechanism is unclear.36 It is possible that the role of PDGF-C in angiogenesis is indirect via induction of VEGF in connective tissue cells or that the activated fibroblasts produce a permissive extracellular matrix for blood vessels. However, regardless of mechanism, the outcome of PDGF-mediated stimulation of the vasculature appears site-specific because the PDGF-C transgenic mice initially developed a phenotype associated with the angiogenic properties of VEGF, but in later stages lose microvessels. Another feature of the vasculature in the transgenic animals is the increased number of smooth muscle-coated vessels. PDGF-C is a potent mitogen for vascular smooth muscle cells37 and the remodeling of the vascular tree is likely to be a direct consequence of increased numbers of these cells. This observation may have bearings on therapeutic angiogenesis using endothelial cell mitogens, like VEGF, that generate immature and fragile vessels in need of a stabilizing coat of perivascular cells. A combination therapy using VEGF and a mitogen for vascular smooth muscle cells may generate more stabile vessels, and PDGF-C is an attractive candidate for such a mitogen.
A striking feature of the transgenic adult myocardium is the presence of Anitschkow cells. It is currently believed that the caterpillar-like appearance of chromatin in Anitschkow cells indicates cellular immaturity and undifferentiation, rather than any specific cell type, and it has been shown to be a characteristic of human fetal cardiac myocytes. The presence of Anitschkow cells in the myocardium and cardiac valves is also known to be a hallmark of rheumatic fever, and so-called Aschoff nodules are reportedly composed of Anitschkow cells.38 Cells with Anitschkow-like chromatin have been shown to participate in response to trauma and foreign materials.39,40 It is unknown whether the Anitschkow cells in the PDGF-C transgenic myocardium are present as a consequence of hypertrophy and fibrosis, or whether these cells are induced to proliferate, or home to the myocardium by PDGF-mediated signaling. Further characterization of the Anitschkow cells is clearly warranted.
The data presented in this work suggests that overexpression of PDGFs induces fibrosis and a unique secondary sex-dependent hypertrophic response. It remains to be established whether PDGFs might also have a role in cardiac fibrosis and fibrous replacement reactions in humans.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the Swedish Research Council, the Novo Nordisk Foundation, and the Karolinska Institutet.
Present address of K. A.: Department of Oncology, Karolinska Hospital, CCK, Karolinska Institutet, S-171 76 Stockholm, Sweden.
Accepted for publication May 5, 2003.
| References |
|---|
|
|
|---|

and -
ß receptors. FASEB J 2002, 16:1575-1583This article has been cited by other articles:
![]() |
C. Leipner, K. Grun, A. Muller, E. Buchdunger, L. Borsi, H. Kosmehl, A. Berndt, T. Janik, A. Uecker, M. Kiehntopf, et al. Imatinib mesylate attenuates fibrosis in coxsackievirus b3-induced chronic myocarditis Cardiovasc Res, July 1, 2008; 79(1): 118 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Andrae, R. Gallini, and C. Betsholtz Role of platelet-derived growth factors in physiology and medicine Genes & Dev., May 15, 2008; 22(10): 1276 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sanchez-Guerrero, V. C. Midgley, and L. M. Khachigian Angiotensin II induction of PDGF-C expression is mediated by AT1 receptor-dependent Egr-1 transactivation Nucleic Acids Res., April 1, 2008; 36(6): 1941 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burstein, E. Libby, A. Calderone, and S. Nattel Differential Behaviors of Atrial Versus Ventricular Fibroblasts: A Potential Role for Platelet-Derived Growth Factor in Atrial-Ventricular Remodeling Differences Circulation, April 1, 2008; 117(13): 1630 - 1641. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burstein and S. Nattel Atrial Fibrosis: Mechanisms and Clinical Relevance in Atrial Fibrillation J. Am. Coll. Cardiol., February 26, 2008; 51(8): 802 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Eitner, E. Bucher, C. van Roeyen, U. Kunter, S. Rong, C. Seikrit, L. Villa, P. Boor, L. Fredriksson, G. Backstrom, et al. PDGF-C Is a Proinflammatory Cytokine that Mediates Renal Interstitial Fibrosis J. Am. Soc. Nephrol., February 1, 2008; 19(2): 281 - 289. [Full Text] [PDF] |
||||
![]() |
J. Floege, F. Eitner, and C. E. Alpers A New Look at Platelet-Derived Growth Factor in Renal Disease J. Am. Soc. Nephrol., January 1, 2008; 19(1): 12 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Konhilas and L. A. Leinwand The Effects of Biological Sex and Diet on the Development of Heart Failure Circulation, December 4, 2007; 116(23): 2747 - 2759. [Full Text] [PDF] |
||||
![]() |
L. Umans, L. Cox, M. Tjwa, V. Bito, L. Vermeire, K. Laperre, K. Sipido, L. Moons, D. Huylebroeck, and A. Zwijsen Inactivation of Smad5 in Endothelial Cells and Smooth Muscle Cells Demonstrates that Smad5 Is Required for Cardiac Homeostasis Am. J. Pathol., May 1, 2007; 170(5): 1460 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zymek, M. Bujak, K. Chatila, A. Cieslak, G. Thakker, M. L. Entman, and N. G. Frangogiannis The Role of Platelet-Derived Growth Factor Signaling in Healing Myocardial Infarcts J. Am. Coll. Cardiol., December 5, 2006; 48(11): 2315 - 2323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Tejada, L. Yu, J. Dong, K. Jung, G. Meng, F. V. Peale, G. D. Frantz, L. Hall, X. Liang, H.-P. Gerber, et al. Tumor-Driven Paracrine Platelet-Derived Growth Factor Receptor {alpha} Signaling Is a Key Determinant of Stromal Cell Recruitment in a Model of Human Lung Carcinoma. Clin. Cancer Res., May 1, 2006; 12(9): 2676 - 2688. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W.M. Schellings, M. Baumann, R. E.W. van Leeuwen, R. F.J.J. Duisters, S. H.P. Janssen, B. Schroen, C. J. Peutz-Kootstra, S. Heymans, and Y. M. Pinto Imatinib Attenuates End-Organ Damage in Hypertensive Homozygous TGR(mRen2)27 Rats Hypertension, March 1, 2006; 47(3): 467 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ponten, E. Bergsten Folestad, K. Pietras, and U. Eriksson Platelet-Derived Growth Factor D Induces Cardiac Fibrosis and Proliferation of Vascular Smooth Muscle Cells in Heart-Specific Transgenic Mice Circ. Res., November 11, 2005; 97(10): 1036 - 1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fredriksson, M. Ehnman, C. Fieber, and U. Eriksson Structural Requirements for Activation of Latent Platelet-derived Growth Factor CC by Tissue Plasminogen Activator J. Biol. Chem., July 22, 2005; 280(29): 26856 - 26862. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang and D. Qiu Linkage between elevated PDGF-C expression and myocardial fibrogenesis in coxsackievirus B3-induced chronic myocarditis Eur. Heart J., April 1, 2005; 26(7): 642 - 643. [Full Text] [PDF] |
||||
![]() |
|