help button home button Am J Pathol JNCI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, B.
Right arrow Articles by Henke, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, B.
Right arrow Articles by Henke, C.
(American Journal of Pathology. 2003;163:789-801.)
© 2003 American Society for Investigative Pathology

Animal Model

An HSV-TK Transgenic Mouse Model to Evaluate Elimination of Fibroblasts for Fibrosis Therapy

Bin Tian, Lei Han, Jill Kleidon and Craig Henke

From the Department of Medicine, University of Minnesota, Minneapolis, Minnesota


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Pathological fibroproliferation after tissue injury is harmful and may lead to organ dysfunction. Unfortunately, fibroproliferative diseases remain intractable to current therapeutic strategies. Thus, new therapeutic approaches are needed. One possible approach is to promote resolution of physiological fibroproliferation that follows injury before it becomes pathological by activating apoptosis selectively in fibrotic lesions. However, it is not known whether selective elimination of fibroblasts will prevent fibrosis or impede repair or worsen injury by eliminating topographic signals essential to organ reconstitution. To address this question, a tractable in vivo model system is needed in which fibroblasts can be targeted to undergo apoptosis at a chosen time and place. We developed transgenic mice expressing HSV-TK from the type I collagen promoter to determine whether selective elimination of fibroblasts actively forming fibrotic lesions is an effective therapeutic strategy for fibroproliferative disorders. The transgene renders fibroblasts actively forming fibrotic tissue susceptible to ganciclovir. To validate the transgenic model we examined whether administration of ganciclovir prevents the development of fibrosis in sponges implanted subcutaneously in the backs of the transgenic mice. We demonstrate that fibroblasts/myofibroblasts isolated from sponges express HSV-TK protein and are selectively ablated by ganciclovir in vitro. In adult transgenic mice, ganciclovir treatment attenuated the development of fibrotic tissue in the sponges both biochemically and histologically. We conclude that this transgenic model system is an ideal approach to determine whether targeted ablation of fibroblasts is an effective therapeutic strategy for fibrotic diseases.

Fibroproliferative diseases can cause dysfunction of every major organ system and as a class of disorders is a major cause of death in the United States.1 Examples of fibroproliferative disease states include pulmonary fibrosis, cirrhosis, cardiac fibrosis, luminal occlusion after coronary artery angioplasty, glomerulosclerosis, and renal fibrosis. Each of these fibroproliferative disorders is characterized by injury resulting in alterations in normal parenchymal cell and connective tissue architecture by fibroblasts/myofibroblasts and their connective tissue products causing progressive organ dysfunction and, frequently, death.2-8 As a class of disorders, fibroproliferative diseases remain intractable to current therapeutic options.9 Based on advances in contemporary fibroblast biology novel therapeutic strategies for interdicting the fibroproliferative disorders can now be examined. One potential approach focuses on promoting the resolution of physiological fibroproliferation that follows tissue injury before it results in permanent fibrosis. This may be possible to accomplish by activating apoptosis selectively in newly formed fibrotic lesions.

Fibroblasts/myofibroblasts are the central effector cell resulting in organ fibrosis.7,8,10-13 Evidence indicates that myofibroblasts are activated fibroblasts and synthesize high levels of collagen.10,14 They constitute the fibroblastic foci of developing fibrotic lesions.8,14 A large body of data supports the concept that, during normal organ repair, resolution of fibroproliferation takes place when the physiological mechanism for elimination of fibroblasts/myofibroblasts, apoptosis, occurs in a timely fashion.11,15-22 However, no studies have been performed to examine whether the selective ablation of the myofibroblasts during the physiological fibroproliferation which results after injury will attenuate the development of organ fibrosis, impede repair, or worsen injury. To investigate whether the selective elimination of myofibroblasts actively forming fibrotic lesions is an effective therapeutic strategy for fibroproliferative diseases, a tractable in vivo model is needed in which myofibroblasts can be killed at a precise time and location. To address this issue, we have developed transgenic mice expressing HSV-TK from the type I collagen promoter. Cells actively producing HSV-TK metabolize the antiviral agent ganciclovir (GCV) to toxic nucleotide analogs that promote cell death.23,24 A property of fibroproliferative fibroblasts/myofibroblasts is active type I collagen production.8,25-29 Thus the transgene renders fibroblasts actively forming fibrotic lesions sensitive to GCV permitting us to therapeutically trigger fibroblast/myofibroblast apoptosis in evolving fibroblastic foci. Here we report characterization of the transgenic mice and validation of the model system. To validate this transgenic mouse model we have examined whether administration of GCV prevents the development of fibrotic tissue in sponges implanted subcutaneously into the backs of the transgenic mice. We demonstrate that in vitro sponge/wound fibroblasts/myofibroblasts are selectively ablated by GCV and that in vivo transgenic mice treated with GCV both biochemically and histologically have reduced fibrotic tissue within the sponge material compared to mice treated with saline. Our data indicate that this model system is an ideal approach to determine whether ablation of fibroblasts/myofibroblasts is an effective therapeutic strategy for acute or chronic fibrotic disease.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Type I Collagen-HSV-TK/GFP Fusion Gene Construct

The EGFP fragment in the promoter-less vector pEGFP-1 was replaced by the fragment IRES-EGFP from the vector pIRES2-EGFP (Clonetech, Palo Alto, CA). Next, the 1.5-kb HSV-TK cDNA coding sequence was amplified by primer chain reaction (PCR) from the plasmid pTK-1 (gift from Dr. Victor Canfield, Penn State College of Medicine). The 5' primer (GGATCTTGGTCGACTGAAACTCCCG) is located at -58 bp and generated a SalI site. The 3' primer (GTCATAGCGCGGGATCCTTCCGG) is located at +1172 bp right before the transcriptional termination signal and generated a BamHI restriction site. The PCR-generated TK fragment was subcloned into the SalI-BamHI site of the multiple cloning site of vector pIRES-EGFP. A 6-kb fragment of the mouse {alpha} 2 type I collagen enhancer (BglII-BglII, -19.3 to -13.5 kb) and the "minimal" {alpha} 2 type I collagen promoter (-350 to +54 bp) (plasmid pRM350–6kb-lacZminus, a gift from Dr. Benoit de Crombrugghe, M.D. Anderson Cancer Center) was placed in front of the TK sequence by blunt-end ligation to generate the expression cassette plasmid pCol1-tk/IRES-EGFP (Figure 1A) . The col1-HSV-TK/GFP fusion gene construct was excised and purified by gel electrophoresis.



View larger version (40K):
[in this window]
[in a new window]
  		Figure 1. In vivo expression of the type I collagen-HSV-TK transgene. A: {alpha} 2 type I collagen-HSV-TK/GFP fusion gene construct. It is a bicistronic construct consisting of the HSV-TK cDNA separated from EGFP cDNA by IRES. The construct is under the control of the {alpha} 2 type I collagen far upstream enhancer linked to the minimal {alpha} 2 type I collagen promoter. B: Southern blot of BamHI-digested genomic DNA from founder mice and non-transgenic littermates. P and N denote positive and negative controls, respectively. C: Western blot of whole lung extracts from transgenic progeny of founder line 21 following bleomycin-induced lung fibrosis. Bleomycin (2 units/kg) was instilled intratracheally and the lungs were harvested 3 weeks later for examination of HSV-TK protein expression. HSV-TK migrates at 45 kd with several minor bands at ~40 to 43 kd as has been previously described.31

 
Animals

The C57BL/6 strain of mice, which is bleomycin-sensitive, was used for microinjections. Microinjections were performed by Dr. Thomas Wagner (Oncology Research Institute, Greenville, South Carolina). DNA obtained by tail biopsy from resulting mice were digested with BamHI and screened by Southern blot using the 1.5-kb HSV-TK probe. Six- to eight-week-old adult animals were used for all experiments.

Surgical Procedures and Tissue/Sponge Harvest

Surgical procedures were performed under anesthesia with ketamine (8 mg/100 g; Ketamine, Phoenix Pharmaceutical, Inc., St. Joseph, MO) and xylazine (2 mg/100 g). Sponges were subcutanesously implanted into the backs of the transgenic mice as previously described.5 To harvest sponges or organ tissue, the mice were killed by terminal barbiturate anesthesia. The sponge/organ tissues were either frozen in liquid nitrogen and stored at -70°C or fixed in 4% paraformaldehyde and processed for hematoxylin and eosin (H&E)- or trichrome-stained paraffin sections.

GCV Administration

GCV diluted in sterile saline was administered continuously at a rate of 100 mg/kg/day for 14 days via subcutaneously implanted mini-osmotic pumps (Alzet, Model 2002). This dose has been reported to kill cells expressing HSV-TK in transgenic mice30,31

Sponge Cell Isolation and Characterization

Sponge/wound cell cultures were developed by mechanical and enzymatic dispersion of sponge/wound tissue as previously described.5,32 The cells were cultured in DMEM + 10% FCS. Subcultivation was performed weekly at a split ratio of 1:3. Cells were used for studies at passages 2 and 3. The sponge/wound cells grown on tissue culture plastic were characterized by morphological and immunological criteria. Primary antibodies used to characterize the sponge cells/tissue included anti-{alpha}-smooth muscle actin (Sigma Chemical Co., St. Louis, MO), anti-vimentin (Sigma), anti-CD36 (Santa Cruz Biotechnology Inc., Santa Cruz, CA), anti-Factor VIII (Accurate Chem. & Sci. Corp., Westbury, NY), and anti-HSV-TK (a gift from Dr. William Summers, Yale University).

Western Analysis

Sponge/wound tissues were powdered in liquid nitrogen, lysed with lysis buffer containing protease inhibitors, and centrifuged at 10,000 x g. Equal amounts of protein from the cell lysates (supernatent proteins) were separated on SDS-PAGE and transferred to nitrocellulose membranes as described.33 The primary antibody for HSV-TK expression was a polyclonal rabbit anti-HSV-TK antibody obtained from Dr. William Summers, Yale University.

Histology and Immunohistochemical Analysis

Sponge/wound tissues were fixed with 4% paraformaldehyde and paraffin sections stained by H&E or trichrome. Immunohistochemical analysis was performed as previously described.34,35 Briefly, for immunofluorescent staining paraffin-embedded tissue sections were de-waxed, rehydrated, and permeated (1X tris-buffered saline (TBS) containing 0.5% Triton X-100 for 5 minutes) before blotting with blotting buffer (1X TBS containing 2% bovine serum albumin (BSA) and 0.25% Tween 20 for 1 hour at 37°C). The procedures for cultured cells were the same as that for tissue except that the cells were fixed directly with 100% cold methanol for 10 minutes. The slides were then incubated with appropriate primary antibodies in blotting buffer. The slides were washed three times (1X tween tris-buffered saline (TTBS), 15 minutes each wash at 37°C), incubated with the appropriate fluorescent-labeled secondary antibodies (1:200 dilution) or Hoescht stain in blotting buffer (1 hour at 37°C) followed by three additional washes. The image data were collected using fluorescent phase-contrast and confocal microscopic systems. For immunohistochemical staining the procedures were the same as described above except that horseradish peroxidase (HRP)-labeled secondary antibodies were used. After incubation with HRP-conjugated secondary antibodies the signal was visualized by incubating the slides with 3-3'-diaminobenzidine (DAB; Sigma).

Hydroxyproline Assay

Hydroxyproline content was assessed as previously reported.36,37 Frozen sponge/wound tissues were powdered and digested with 6 N HCL at 110°C for 16 hours. The supernatant was neutralized with equal volume of 6 N NaOH and dried at 70°C in an incubator. The samples were resuspended in 0.2 ml of water followed by addition of equal volume of 0.05 mol/L chloramine-T and incubated at room temperature for 25 minutes. Then 0.2 ml of 3.15 mol/L perchloric acid and Erlich’s reagent were added. The samples were mixed well and incubated at 60°C in water bath for 20 minutes and read in a plate reader at 560 nm, and the amount of hydoxyproline was calculated from a standard curve constructed using hydroxy-L-proline at concentrations of 0.25 to 40 µg/ml. The final hydroxyproline content was adjusted according to the wet weight of the sponge tissue.

Statistical Analysis

All data are expressed as means ± SE. Experiments were performed three times. Paired evaluations were made for experimental and control conditions within each experiment and significance was determined by Student’s t-test. Significance level was set at P < 0.05.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Generation of HSV-TK-Expressing Transgenic Mice

Progeny resulting from the pronuclear injection of the {alpha} 2 type I collagen enhancer/promoter-HSV-TK/GFP fusion gene construct (colI-HSV-TK/GFP) were screened by Southern analysis for successful integration of the transgene (Figure 1B) . Transgenic lines were established from four founder mice. To identify which line of animals expressed the highest level of HSV-TK protein during a fibroproliferative response, bleomycin (2 units/kg) was instilled intratracheally, and after 3 weeks the lungs were harvested and whole lung extracts were examined by Western analysis. Of these, line 21 displayed the highest and most consistent expression of HSV-TK protein during the fibroproliferative response after bleomycin-induced lung fibrosis (Figure 1C) . Males of line 21 had fertility problems in accord with prior reports of male infertility in HSV-TK-expressing transgenic mice.38 Experimental mice were generated by mating heterozygous females from line 21 with wild-type males, followed by genotyping by Southern blot and demonstration of HSV-TK expression by Western analysis. Therefore, the genetic backgrounds of transgenic and nontransgenic control mice were similar.

ColI-HSV-TK Transgenic Sponge/Wound Myofibroblasts Are Susceptible to GCV Mediated Killing in Vitro

This study was designed to validate our HSV-TK transgenic mice as a model system to determine whether selective elimination of fibroblasts is a valid treatment approach for fibroproliferative disorders. We chose a sponge implantation approach to validate our model. The sponge approach was chosen because the sponges before implantation do not contain type I collagen, eliminating any background collagen that may make it difficult to assess the effect of GCV on developing fibrotic tissue. In addition, after subcutaneous implantation, the sponges become organized by fibrotic tissue after several weeks. The sponges are easy to remove thus permitting isolation and characterization of the cells involved in the sponge-induced fibrotic response. Furthermore, both hydroxyproline analysis and trichrome staining can be performed on the sponge/wound tissue. Therefore, the sponge approach is ideal for validating our transgenic mice as a tool to assess the efficacy of ablation of fibroblasts as anti-fibrotic therapy.

Cells were isolated from sponges 21 days after sponge implantation. Isolated cells were characterized morphologically by phase contrast and confocal microscopy followed by immunostaining for cell identification and HSV-TK expression. Phase contrast and confocal microscopy demonstrated a mixed population of cells morphologically (Figure 2A , panel A). Many of the cells before GCV treatment were large, well-spread cells with the typical elongated, spindle shape of fibroblasts/myofibroblasts. There were also many smaller cells with a more round appearance. Immunohistochemical studies indicated that the majority of the large, well-spread cells isolated from sponges derived from transgenic mice expressed determinants characteristic of fibroblasts/myofibroblasts ({alpha}-smooth muscle actin and vimentin) but were negative for endothelial cell determinants (CD36) (Figure 2A , panels A and B). These large, well-spread {alpha}-smooth muscle actin-positive cells also stained positive for HSV-TK (Figure 2A , panel F). Immunostaining indicated that many of the smaller, more round cells had determinants characteristic of endothelial cells (CD36 and vimentin-positive and {alpha}-smooth muscle actin-negative) (Figure 2A , panels B and C). These cells did not stain positive for HSV-TK. Similar results were obtained using sponge cells isolated from nontransgenic control mice except that nontransgenic fibroblasts/myofibroblasts did not stain positive for HSV-TK (Figure 2B , panel E).



View larger version (56K):
[in this window]
[in a new window]
  		Figure 2. In vitro characterization of transgenic sponge/wound cells. Sponges were implanted subcutaneously into the backs of the transgenic mice and were harvested 21 days later. Cell cultures were prepared as described in the Materials and Methods section. Shown are the confocal microscopic appearance of immunostained cells isolated from sponges 21 days after implantation. A: Double immunofluorescence analysis of day 21 isolated untreated transgenic sponge cells (panels A–C) and GCV-treated cells (panels D and E) (magnification, x200). Panel A: Anti-{alpha}-smooth muscle actin (green) and anti-vimentin (red). Panel B: Anti-{alpha}-smooth muscle actin (green) and anti-CD36 (red). The {alpha}-smooth muscle actin-positive cells (green) stained negative for CD36 (red). Panel C: Anti-vimentin (red) and anti-CD36 (green). Cells staining positive for both appear yellow (arrowheads). Panel D: Anti-{alpha}-smooth muscle actin (green) and anti-vimentin (red). Panel E: Anti-vimentin (red) and anti-CD36 (green). Cells staining for both appear yellow (arrowheads). Panel F: DAB immunostaining for HSV-TK (magnification, x600; arrowhead). Shown in the inset is colocalization of HSV-TK expression with {alpha}-smooth muscle actin (green). B: Immunostaining analysis of isolated untreated transgenic sponge cells (panels A and B) and cells treated with GCV for 5 days (panels C and D) using anti-vimentin (panels A and C, green) and anti-HSV-TK (panels B and D, red). Panels A–D represent identical cells stained with either anti-vimentin or anti-HSV-TK. Note in panel C that the remaining cells were vimentin-positive but were negative for HSV-TK (panel D). Panel E is HSV-TK immunostaining of nontransgenic sponge cells as a control. Some background staining is apparent.

 
We examined our transgenic and nontransgenic wound/sponge cells for HSV-TK expression by Western analysis. Western blots demonstrated that only wound/sponge cells from transgenic mice expressed HSV-TK protein (Figure 3A) . To examine the vulnerability of transgenic and nontransgenic sponge/wound cells to GCV, subconfluent, proliferating cultures of sponge/wound cells derived from HSV-TK transgenic mice were exposed to GCV at varying concentrations (0, 0.02, 0.2, 0.5, 2, and 5 µmol/L) for 5 days. Sponge/wound cells isolated from transgenic mice were killed by GCV in a dose-dependent fashion (Figure 3, B and C) . Exposure to GCV (2 µmol/L for 5 days) caused a mean cell loss of ~60% in cultures of transgenic sponge/wound cells (Figure 3C) . The intensity of kill was such that after 5 days of GCV there was an ~40% reduction in transgenic sponge/wound cell number with the lowest concentration of GCV tested (0.02 µmol/L). In contrast, sponge/wound cells isolated from nontransgenic littermate mice and exposed to GCV remained largely viable (Figure 3C) . However, there was evidence of non-specific toxicity of GCV to nontransgenic cells especially with the highest dose of GCV tested (5 µmol/L).



View larger version (49K):
[in this window]
[in a new window]
  		Figure 3. Vulnerability of transgenic sponge fibroblasts/myofibroblasts to GCV in vitro. A: HSV-TK Western analysis of whole sponge extracts from transgenic (T) and non-transgenic (NT) mice. Only sponge/wound cells derived from transgenic mice express HSV-TK protein. B: Phase contrast picture of transgenic sponge cells treated with various doses of GCV for 5 days (0, 0.02, 0.5, 0.2, 2 and 5 µmol/L; panels A–F, respectively) C: Transgenic and nontransgenic sponge fibroblasts/myofibroblasts were exposed to GCV in varying concentrations for 5 days. The number of viable cells were quantified by Hoescht staining (bis-benzimide, Hoescht 33258).

 
We also characterized the transgenic sponge cells that survived 5 days of GCV treatment to identify which cells were susceptible to GCV. Morphologically, the cells remaining after GCV also consisted of a mixed population. However, in marked contrast to pre-GCV treatment in which many of the cells were large, well-spread, and elongated (Figure 2A , panel A), after GCV treatment the majority of remaining cells were smaller and less spread in appearance (Figure 2A , panel D). The vast majority of the larger well-spread cells with determinants characteristic of fibroblasts/myofibroblasts ({alpha}-smooth muscle actin- and vimentin-positive) had been eliminated (Figure 2A , compare panels A and D). Moreover, virtually all HSV-TK-expressing cells were eliminated (Figure 2B , compare panels B and D). However, a population of vimentin-positive cells not expressing HSV-TK remained after GCV (Figure 2B , panel C). Further characterization of these cells by immunostaining indicated that many of the remaining smaller, round cells had determinants characteristic of endothelial cells (CD36- and vimentin-positive and {alpha}-smooth muscle actin-negative) (Figure 2A , panel E). There were also a few cells after GCV that were vimentin-positive and CD36-negative. It is unclear whether these cells were quiescent fibroblasts that did not express HSV-TK or myofibroblasts resistant to GCV. Collectively, the in vitro data indicate that GCV preferentially targets HSV-TK transgenic fibroblasts/myofibroblasts for kill but not nontransgenic fibroblasts/myofibroblasts and appears to spare endothelial cells.

Subcutaneous GCV Treatment Attenuates the Development of Fibrotic Tissue in Sponges Implanted in ColI-HSV-TK Transgenic Mice

The ability of continuously administered GCV to kill fibroblasts/myofibroblasts and limit the development of fibrotic tissue was examined by implanting sponges subcutaneously into the backs of the transgenic mice. Fibroblast/myofibroblast invasion into and organization of sponge tissue requires several weeks.5 In addition, our in vitro experiments indicated that prolonged exposure to GCV was required to achieve significant ablation of transgenic sponge/wound cells. Therefore, GCV (or saline for controls) was delivered continuously in vivo by subcutaneous osmotic minipump from days 7 through 21 after sponge implantation. At day 21 the sponges were removed. Histological and biochemical analysis of sponge/wound tissue was performed to determine the effect of GCV on fibrotic tissue development.

The development of fibrotic tissue in the sponge material was robust in transgenic mice treated with sterile saline (the vehicle for GCV). Shown in Figure 4A and B , H&E staining revealed the presence of plump islands of newly formed fibrotic tissue interspersed between sponge material. Immunostaining demonstrated that the cellular composition of the fibrotic tissue consisted of predominantly vimentin- and {alpha}-smooth muscle actin-positive cells, determinants characteristic of fibroblasts/myofibroblasts (Figure 5A–C) . Importantly, immunohistochemical analysis revealed the presence of abundant {alpha}-smooth muscle actin- and HSV-TK-positive cells in the islands of fibrotic tissue in sponges treated with saline (Figure 6A , panels A–C). In contrast, H&E staining of sponge tissue derived from transgenic mice treated with GCV for 14 days demonstrated the presence of sparse, non-nucleated cells and scant, thin strands of mostly acellular fibrotic tissue (Figure 4, C and D) . Furthermore, immunostaining showed a reduction in vimentin- and {alpha}-smooth muscle-positive cells (Figure 5, D–F) and the virtual disappearance of {alpha}-smooth muscle actin- and HSV-TK-positive cells following 14 days of GCV (Figure 6A , panels D–F) suggesting that fibroblasts/myofibroblasts were eliminated by GCV. Shown in Figure 6A , panels G and H are negative controls (no primary antibody). No significant immunoreactivity of transgenic sponge tissue was apparent in the negative controls. To confirm our confocal immunofluorescence studies, we also immunostained sponge tissue from saline- and GCV- treated animals using DAB to analyze the effect of GCV on HSV-TK expression. Consistent with our immunofluorescence data we found that GCV reduced the number of HSV-TK-positive cells in the sponge fibrotic tissue (Figure 6B) .



View larger version (114K):
[in this window]
[in a new window]
  		Figure 4. Histological analysis of sponge material from transgenic animals treated with either saline or GCV for 14 days (days 7 through 21 after sponge implantation). Sponges were harvested on day 21. A and B: H&E staining of sponge tissue from a transgenic mouse after treatment with saline. Magnification, x100 and x400, respectively. C and D: H&E staining of sponge tissue from a transgenic mouse after treatment with GCV. Magnification, x100 and x400, respectively. E and F: H&E staining of sponge tissue derived from a nontransgenic mouse after 14 days of GCV. Magnification, x100 and x400, respectively.

 


View larger version (52K):
[in this window]
[in a new window]
  		Figure 5. In vivo immunohistochemical characterization of sponge/wound fibrotic tissue. Immunofluorescence staining (magnification, x200) of sponge tissue from saline (A–C) and GCV (D–F) treated mice with anti-{alpha}-smooth muscle actin (A and D, green), anti-vimentin (B and E, red) and combined (C and F).

 


View larger version (68K):
[in this window]
[in a new window]
  		Figure 6. Immunohistochemical analysis of the effects of GCV on HSV-TK expression in sponges in vivo. A: Immunofluorescence studies (magnification, x200) of HSV-TK expression in transgenic mice treated with saline (panels A–C) and GCV (panels D–F) using anti-HSV-TK (A and D, red), anti-{alpha}-smooth muscle actin (B and E, green), and combined (C and F). Panels G and H are negative controls without primary antibodies. B: DAB immunostaining (magnification, x400) of sponge tissue to analyze HSV-TK expression in saline treated- (panel A) and GCV treated- (panel B) transgenic mice.

 
As a semi-quantitative measure of the effects of GCV on HSV-TK expression, whole sponge extracts derived from transgenic mice receiving either saline or GCV were analyzed by Western blot. Western analysis demonstrated that HSV-TK protein expression in sponge/wound tissue was not detectable in GCV-treated transgenic mice compared to saline-treated transgenic mice (Figure 7) . Western analysis was also performed to semi-quantitatively measure the effect of GCV on {alpha}-smooth muscle actin expression and therefore serving as a rough measure of the effect of GCV on fibroblast/myofibroblast numbers. Western analysis of whole sponge extracts showed that {alpha}-smooth muscle actin expression markedly decreased after GCV treatment compared to saline-treated mice (Figure 7) . Our in vivo data are consistent with the in vitro results and strongly suggest that fibroblasts/myofibroblasts actively involved in the fibroproliferative response are preferentially eliminated by GCV.



View larger version (19K):
[in this window]
[in a new window]
  		Figure 7. Effects of GCV on HSV-TK and {alpha}-smooth muscle actin expression. Western analysis of whole sponge extracts from saline- and GCV-treated transgenic mice using a polyclonal HSV-TK antibody and a monoclonal {alpha}-smooth muscle actin antibody. Shown are the results from two separate sponge experiments. HSV-TK protein immunoreactivity is at 45 kd. {alpha}-smooth muscle actin immunoreactivity is at 43 kd.

 
As a control, GCV was administered for 14 days to nontransgenic littermate mice in whom sponges had been implanted. In contrast to transgenic mice, abundant fibrotic tissue was present in the sponge material indicating that GCV had no detectable effect on the formation of fibrotic tissue in sponges implanted in nontransgenic littermates (Figure 4, E and F , H&E stain; Figure 8A , panels E and F, trichrome stain). Immunostaining analysis of sponge tissue from nontransgenic mice showed a similar distribution of {alpha}-smooth muscle actin- and vimentin-positive cells in the newly formed fibrotic tissue (data not shown). Immunostaining with anti-HSV-TK showed background staining only.



View larger version (80K):
[in this window]
[in a new window]
  		Figure 8. Effects of GCV on sponge collagen content. A: Trichrome staining of sponge tissue from saline- (panels A and B) and GCV- (panels C and D) treated transgenic mice. Magnification, x100, panels A and C and x100, panels B and D, respectively. Trichrome staining of sponge tissue derived from a nontransgenic mouse treated with GCV for 14 days (panels E and F). B: Hydroxyproline content of sponge tissue from saline- and GCV treated-transgenic mice. *, P < 0.02.

 
Histological analysis by trichrome staining of sponges obtained from transgenic mice treated with saline showed marked collagen deposition within the islands of fibrotic tissue interspersed between the sponge material at day 21 (Figure 8A , panels A and B). In contrast, in transgenic mice treated with GCV for 14 days there were scant, thin strands of collagen fibrils deposited in between the sponge material (Figure 8A , panels C and D). To confirm the trichrome staining findings and to quantitatively measure the amount of collagen deposited in the sponge/wound tissue, hydroxyproline analysis was performed. The hydroxyproline content of sponges derived from transgenic mice treated with saline for 14 days was 1634.6 ± 380.8 µg/g of sponge tissue. The hydroxyproline content of sponges obtained from transgenic mice treated with GCV for 2 weeks was decreased >3-fold compared with saline-treated mice (531.5 ± 237.6 µg/g of sponge tissue; P < 0.02) (Figure 8B) . Collectively, these data demonstrate that GCV administration to our HSV-TK transgenic mice kills HSV-TK-expressing fibroblasts/myofibroblasts in vitro and attenuates the development of fibrotic tissue in the implanted sponge material.

We did not examine the skin incision wound that was created to insert the sponges subcutaneously because removal of the sponges altered its integrity. However, we did not note any differences in wound closure between GCV- and saline-treated mice. It should be noted that the purpose of this study was not to examine in a comprehensive fashion the effect of fibroblast ablation on wound healing. Instead, the purpose was to validate the transgenic mouse model by examining whether GCV treatment can eliminate fibroblasts/myofibroblasts involved in a fibroproliferative response.

Administration of GCV for 14 Days Did Not Cause Overt Organ Abnormalities in Uninjured Transgenic Mice

Although the transgene should preferentially eliminate those fibroblasts actively forming fibrotic tissue (eg, actively producing type I collagen), non-specific toxicity to other organs was a concern given that HSV-TK expression was driven by the {alpha} 2 type I collagen enhancer/promoter. Of specific concern was the skin and lung where collagen turnover is felt to be high compared to other organs.28 To begin to address this issue, we performed Western analysis on whole organ extracts (partial extract for skin) of major organs (heart, aorta, lung, liver, kidney, GI tract, and skin) from uninjured immature, developing 4-week-old transgenic mice and mature, adult, 4-month-old transgenic mice to examine the level of HSV-TK expression. In developing mice, HSV-TK expression was present in all major organs with the skin, lung, and aorta showing the highest level of expression (Figure 9) . In contrast, Western blots demonstrated that in fully developed mice only the lung and skin displayed some HSV-TK expression (Figure 9) . However, HSV-TK protein expression in other major organs was either barely detectable or not detectable at all. No gross or histopathological abnormalities were detected in major organs including the skin and lung in untreated adult transgenic mice or in uninjured adult transgenic mice treated with GCV for 14 days (data not shown). Furthermore, uninjured adult transgenic mice treated with GCV for 14 days appeared healthy and had stable body weight. Therefore, 2 weeks of GCV treatment did not cause overt, gross evidence of organ toxicity in uninjured adult transgenic mice although less readily identifiable organ injury remains a possibility.



View larger version (14K):
[in this window]
[in a new window]
  		Figure 9. Western analysis of whole organ extracts (partial extract for skin) of major organs (heart, lung, aorta, liver, kidneys, GI tract, and skin) using a polyclonal HSV-TK antibody. Upper panel: Immature developing transgenic mice (4 weeks of age). Lower panel: Mature fully developed transgenic mice (4 months of age).

 
It is important to note that following organ injury and induction of a fibroproliferative response (bleomycin-induced lung injury) HSV-TK expression is markedly up-regulated in the injured organ of the mature adult transgenic mice. Compare Western blots of whole lung extracts in Figure 1C (transgenic mouse line 21, bleomycin injured 4-month-old adult mouse) with Figure 9 (uninjured 4-month-old adult mouse). This illustrates that with induction of a fibroproliferative response HSV-TK expression driven by the active type I collagen promoter is up-regulated. Furthermore, HSV-TK expression was selectively up-regulated in the injured lung only. Western analysis of whole organ extracts from other uninjured organs did not show up-regulated HSV-TK expression (data not shown). As supported by our validation study, these data suggest that fibroblasts/myofibroblasts actively forming fibrotic lesions in the localized areas of organ injury will be vulnerable to GCV-mediated ablation.


   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
We developed transgenic mice expressing HSV-TK from the type I collagen promoter to evaluate whether the selective elimination of fibroblasts in evolving fibroblastic lesions is an effective therapeutic strategy for fibroproliferative diseases. To validate our transgenic model, we examined the effects of GCV on developing fibrotic tissue in subcutaneously implanted sponges. Our in vitro data demonstrate that transgenic sponge fibroblasts/myofibroblasts involved in the fibroproliferative response express HSV-TK and are selectively eliminated by GCV. Consistent with this, our in vivo studies indicate that following GCV treatment the development of fibrotic tissue in sponges from transgenic mice is attenuated. This study validates our transgenic model and indicates that this model system is an ideal approach to determine whether ablation of fibroblasts is an effective therapeutic strategy for fibrotic diseases.

HSV-TK Transgenic Murine Model

The HSV-TK transgenic approach has been used to selectively ablate specific cell populations.24,30,31,39 This method is based on the selective toxicity of GCV to cells expressing the HSV-TK gene.23,40 HSV-TK is capable of phosphorylating specific nucleoside analogs, such as GCV, to nucleoside metabolites that become incorporated into DNA leading to disruption of DNA synthesis and induction of cell death.40,41 Two valuable features of this approach include the ability to selectively target a specific cell type by choice of promoter to drive HSV-TK expression and that elimination of the cell type is inducible and can be temporally regulated by when GCV is administered.

We used the HSV-TK transgenic approach to address the question of whether selective ablation of fibroblasts actively forming fibrotic tissue can be used as a therapeutic strategy for fibroproliferative diseases. Fibroblasts/myofibroblasts are the central effector cell resulting in organ fibrosis.7,8,10-13 Evidence indicates that myofibroblasts are activated fibroblasts and synthesize high levels of collagen. They constitute the fibroblastic foci of developing fibrotic lesions.8,14 Therefore, the cell type we wanted to target for elimination was the fibroblast/myofibroblast. We selected the {alpha} 2 type I collagen promoter to drive HSV-TK expression and target these cells for elimination because expression is seen only in type I collagen producing cells; this promoter has relatively selective expression by fibroblasts; and it has proven to be successful in driving the expression of reporter genes in transgenic mice.42,43 By using the type I collagen promoter to drive HSV-TK expression we selected a promoter that would render fibroblasts actively forming fibrotic lesions susceptible to GCV.

Validation of the Transgenic Model

We chose a sponge implantation approach to examine whether our transgenic model would behave as anticipated. When sponges are implanted subcutaneously they generate an inflammatory and subsequent fibroproliferative response with the formation of fibrotic tissue in the sponges by several weeks. The sponges are then harvested and the cells involved in the fibroproliferative response isolated and characterized. Immunostaining revealed a mixed population of cells isolated from our sponges that included predominantly {alpha}-smooth muscle actin- and vimentin-positive cells (determinants characteristic of myofibroblasts) and vimentin-and CD36-positive cells (determinants characteristic of endothelial cells). Although myofibroblasts typically express {alpha}-smooth muscle actin and vimentin, other cells such as fibroblasts and mesothelial cells may express these determinants in cell culture. Thus, although the precise identity of these cells is unknown, the morphological and immunohistochemical profile of the cells strongly suggests they are fibroblasts/myofibroblasts. The fibroblasts/myofibroblasts expre-ssed HSV-TK and were vulnerable to GCV-induced killing in vitro while endothelial cells did not express HSV-TK and were spared. We also examined our sponges in vivo using immunohistochemical techniques to identify the cellular composition of the developing fibrotic tissue. This fibrotic tissue consisted of a population of cells that expressed determinants characteristic of fibroblasts/myofibroblasts (vimentin- and {alpha}-smooth muscle actin-positive) and expressed HSV-TK. Consistent with our in vitro results, GCV-mediated kill in vivo also appeared to be highly selective. We found that the majority of the {alpha}-smooth muscle actin-, vimentin-, and HSV-TK-positive cells within these newly formed fibroblastic lesions were selectively targeted for ablation. Semi-quantitative analysis by Western blotting of whole sponge extracts showed that both {alpha}-smooth muscle actin and HSV-TK protein expression virtually disappeared in transgenic mice treated with GCV. Consistent with our in vitro studies, our in vivo immunohistochemical studies indicate that cells expressing {alpha}-smooth muscle actin and vimentin (determinants characteristic of fibroblasts/myofibroblasts) as well as HSV-TK are selectively eliminated by GCV.

An advantage of using the sponge approach to validate our transgenic model is that sponges do not contain collagen. This eliminates the presence of background collagen that could make it difficult to assess the effect of GCV on fibrotic tissue development. Compared to saline, we found that GCV treatment attenuated the development of fibrotic tissue in the sponges, both histologically and biochemically. These results demonstrate that fibroblasts/myofibroblasts derived from sponge fibrotic lesions express HSV-TK and are selectively targeted for GCV-mediated kill in vitro and that the development of fibrotic tissue can be attenuated in vivo.

The preferential nature by which fibroblasts/myofibroblasts are eliminated in our transgenic mice suggested that non-specific toxicity due to ablation of fibroblasts in other organs may be limited. Consistent with this, after 14 days of GCV treatment, major organs did not display gross or identifiable histological abnormalities although less overt injury remains a possibility. This suggests that without induction of a fibroproliferative response the expression of HSV-TK in fibroblasts present in major organs of mature mice may not be high enough for GCV to have a toxic effect. In support of this, we have found that, in developing mice, HSV-TK expression is present in major organs with the skin, lung, and aorta showing the highest expression. However, in uninjured mature mice the level of expression is much lower with only the lung and skin showing some expression. The relatively sparse nature of fibroblasts populating some of these organs in addition to relatively low type I collagen synthesis in the uninjured state may explain the lack of overt GCV toxicity. Finally, it should be noted that angiogenesis might influence the development of fibrotic tissue in certain fibrotic diseases. In this study we did not examine the effect of GCV on angiogenesis. The purpose of this study was to determine the effect of GCV on fibroblast/myofibroblast removal. Thus, it remains possible that some of the decrease in fibrotic tissue formation by GCV could be due to inhibition of angiogenesis. Additional studies examining the effect of GCV on angiogenesis and wound repair may resolve this issue.

Fibroblast Ablation as a Treatment Strategy for Fibrotic Diseases

We developed this transgenic model to determine whether promoting resolution of physiological fibroproliferation before it becomes pathological by activating apoptosis selectively in fibrotic lesions might be an effective therapeutic strategy for fibrotic diseases. We have demonstrated that the fibroblast/myofibroblast, the primary effector cell of fibrotic disease,8,14 is selectively ablated. We anticipate that organ injury in our transgenic mice will cause the development of a highly concentrated population of myofibroblasts actively producing type I collagen and HSV-TK. Thus these cells should be susceptible to GCV-mediated kill. In support of this, we found that HSV-TK expression in the lung is up-regulated following bleomycin-induced injury (Figure 1C and Reference 44). The major question to be answered is whether ablation of myofibroblasts will have a beneficial effect in terms of limiting fibrosis or whether it will impede repair or worsen injury. We suspect that the timing of GCV-mediated kill during organ repair after injury will be important in determining whether the outcome is favorable in terms of facilitating repair. It is possible that the presence of fibroblasts is essential for parenchymal cell repair and that their premature removal may be detrimental.45 An important feature of this transgenic model is that fibroblast kill can be precisely timed by when GCV is administered. This enables us to determine the effects of fibroblast ablation on tissue repair at various times after injury.

Potential Applications of this HSV-TK Transgenic Model

In this report we describe an HSV-TK transgenic murine model that can be used to study the efficacy of ablation of fibroblasts on the development of organ fibrosis in fibroproliferative disease processes that can be modeled in the mouse. Its potential experimental applications are broad and include examining the effect of fibroblast ablation on the development of pulmonary fibrosis after bleomycin or hyperoxic exposures, chemical-induced cirrhosis, cardiac fibrosis, and late remodeling after myocardial infarction or aortic banding, glomerulosclerosis, and renal fibrosis. In addition, the role of fibroblasts during development could also be examined.


   Acknowledgements
 
We thank Drs. Benoit de Crombrugghe and Victor Canfield for the type I collagen enhancer/promoter and HSV-TK plasmids, respectively. We also thank Dr. Thomas Wagner for performing the microinjections and Dr. Brett Levay Young for assistance with the sponge experiments.


   Footnotes
 
Address reprint requests to Craig A. Henke, M.D., Box 276, University of Minnesota, 420 Delaware Street SE, Minneapolis, MN 55455. E-mail: henke002{at}umn.edu

Supported by the Minnesota Medical Foundation, an American Heart Association Grant-In-Aid, an American Lung Association Career Investigator Award, and National Instiutes of Health grants RO1 HL67794 and P50HL50152.

Accepted for publication May 5, 2003.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bitterman PB, Henke CA: Fibroproliferative disorders. Chest 1991, 99((Suppl 3)):81S-84S
  2. Basset F, Ferrans VJ, Soler P, Takemura T, Fukuda Y, Crystal RG: Intraluminal fibrosis in interstitial lung disorders. Am J Pathol 1986, 122:443-461[Abstract]
  3. Ferns GAA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R: Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science 1991, 253:1129-1132[Abstract/Free Full Text]
  4. Gibbons GH, Dzau VJ: The emerging concept of vascular remodeling. N Engl J Med 1994, 330:1431-1438[Free Full Text]
  5. Henke C, Fiegel V, Peterson M, Wick M, Knighton D, McCarthy J, Bitterman P: Identification and partial characterization of angiogenesis bioactivity in the lower respiratory tract after acute lung injury. J Clin Invest 1991, 88:1386-1395
  6. Norman JT, Fine LG: Progressive renal disease: fibroblasts, extracellular matrix, and integrins. Exp Nephrol 1999, 7:167-177[Medline]
  7. Svee K, White J, Vaillant P, Jessurun J, Roongta U, Krumwiede M, Johnson D, Henke C: Acute lung injury fibroblast migration and invasion of a fibrin matrix is mediated by CD44. J Clin Invest 1996, 98:1713-1727[Medline]
  8. Friedman SL: Molecular regulation of hepatic fibrosis; an integrated cellular response to tissue injury. J Biol Chem 2000, 275:2247-2250[Free Full Text]
  9. Hunninghake GW, Kalica AR: Approaches to the treatment of pulmonary fibrosis. Am J Respir Crit Care Med 1995, 151:915-918[Abstract]
  10. Darby I, Skalli O, Gabbiani G: {alpha}-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest 1990, 63:21-29[Medline]
  11. Desmouliere A, Redard M, Darby I, Gabbiani G: Apoptosis mediates the decrease in cellularity during the transition between granulation tissue and scar. Am J Pathol 1995, 146:56-66[Abstract]
  12. Fukuda Y, Ishizaki M, Musada Y, Kimuri G, Kawanami O, Masugi Y: The role of intra-alveolar fibrosis in the process of pulmonary structural remodeling in patients with diffuse alveolar damage. Am J Pathol 1987, 126:171-182[Abstract]
  13. Zeisberg M, Strutz F, Muller GA: Role of fibroblast activation in inducing interstitial fibrosis J Nephrol 2000, 13((Suppl 3)):S111-S120
  14. Kuhn C, McDonald JA: The roles of the myofibroblast in idiopathic pulmonary fibrosis. Am J Pathol 1991, 138:1257-1265[Abstract]
  15. Arends MJ, Wyllie AH: Apoptosis: mechanisms and roles in pathology. Int Rev Exp Pathol 1991, 32:223-254[Medline]
  16. Ellis RE, Yuan JY, Horvitz HR: Mechanisms and functions of cell death. Annu Rev Cell Biol 1991, 7:663-698[Medline]
  17. Kapanci Y, Weibel ER, Kaplan HP, Robinson FR: Pathogenesis and reversibility of the pulmonary lesions of oxygen toxicity in monkeys. Lab Invest 1969, 20:101-118[Medline]
  18. Meduri GU, Belenchia JM, Estes RJ, Wunderink R, Eltorkey M, Leeper KV: Fibroproliferative phase of ARDS: clinical findings and effects of corticosteroids. Chest 1991, 100:943-952[Abstract/Free Full Text]
  19. Meduri GU, Chinn AJ, Leeper KV, Wunderink RG, Tolley E, Winer-Muram HT, Khare V, Eltorky M: Corticosteroid rescue treatment of progressive fibroproliferation in late ARDS: patterns of response and predictors of outcome. Chest 1994, 105:1516-1527[Abstract/Free Full Text]
  20. Polunovsky VA, Chen B, Henke C, Snover D, Wendt C, Ingbar DH, Bitterman PB: Role of mesenchymal cell death in lung remodeling after injury. J Clin Invest 1993, 92:388-397
  21. Suchyta MR, Elliott CG, Colby T, Rasmusson BY, Morris AH, Jenson RL: Open lung biopsy does not correlate with pulmonary function after the adult respiratory distress syndrome. Chest 1991, 99:1232-1237[Abstract/Free Full Text]
  22. Tian B, Lessan K, Kahm J, Kleidon J, Henke C: ß1 integrin regulates fibroblast viability during collagen matrix contraction through a phosphatidylinositol 3-kinase/Akt/protein kinase B signaling pathway. J Biol Chem 2002, 277:24667-24675[Abstract/Free Full Text]
  23. Borrelli E, Heyman R, His M, Evans RM: Targeting of an inducible toxic phenotype in animal cells. Proc Natl Acad Sci USA 1988, 85:7572-7576[Abstract/Free Full Text]
  24. Borrelli E, Heyman RA, Arias C, Sawchenko PE, Evans RM: Transgenic mice with inducible dwarfism. Nature 1989, 339:538-541[Medline]
  25. Burkhardt A: Alveolitis and collapse in the pathogenesis of pulmonary fibrosis. Am Rev Respir Dis 1989, 140:513-524[Medline]
  26. Goldstein RH: Control of type I collagen formation in the lung Am J Physiol 1991, 261:L29-L40
  27. Kuhn C, III, Boldt J, King TE, Jr, Couch E, Vartio T, McDonald JA: An immunohistochemical study of architectural remodeling and connective tissue synthesis in pulmonary fibrosis Am Rev Respir Dis 1989, 140:1693-1703[Medline]
  28. Laurent GJ: Dynamic state of collagen: pathways of collagen degradation in vivo and their possible role in regulation of collagen mass. Am J Physiol 1987, 252:C1-C9
  29. Lazenby AJ, Crouch EC, McDonald JA, Kuhn C, III: Remodeling of the lung in bleomycin-induced pulmonary fibrosis in the rat Am Rev Respir Dis 1990, 142:206-214[Medline]
  30. Wallace H, Ledent C, Vassart G, Bishop JO, Al-Shawi R: Specific ablation of thyroid follicle cells in adult transgenic mice. Endocrinology 1991, 129:3217-3226[Abstract]
  31. Bush TG, Savidge TC, Freeman TC, Cox HJ, Campbell EA, Mucke L, Johnson MH, Sofroniew MW: Fulminant jejuno-ileitis following ablation of enteric glia in adult transgenic mice. Cell 1998, 93:189-201[Medline]
  32. Chen B, Polunovsky V, White J, Blazar B, Nakhleh R, Jessurun J, Peterson M, Bitterman P: Mesenchymal cells isolated after acute lung injury manifest an enhanced proliferative phenotype. J Clin Invest 1992, 90:1778-1785
  33. Henke CA, Roongta U, Mickelson DJ, Knutson JR, McCarthy JB: CD44-related chondroitin sulfate proteoglycan, a cell surface receptor implicated with tumor cell invasion, mediates endothelial cell migration on fibrinogen and invasion into a fibrin matrix. J Clin Invest 1996, 97:2541-2552[Medline]
  34. Tian B, Carlyle WC, Weigold WG, McDonald K: M, Judd DL, Toher CA, Homans DC, Cohn JN: Localization of changes in ß-actin expression in remodeled canine myocardium. J Mol Cell Cardiol 1999, 31:751-760[Medline]
  35. Tian B, Liu L, Bitterman PB, Bache RJ: Mechanisms of cytokine induced NO-mediated cardiac fibroblast apoptosis. Am J Physiol 2002, 283:H1958-H1967
  36. Berg RA: Determination of 3- and 4- hydroxyproline. Methods Enzymol 1982, 82:372-398
  37. Mukherjee D, Sen S: Collagen phenotypes during development and regression of myocardial hypertrophy in spontaneously hypertensive rats. Circ Res 1990, 67:1474-1480[Abstract/Free Full Text]
  38. Al-Shawi R, Burke J, Jones CT, Simons JP, Bishop JO: A MUP promoter-thymidine kinase reporter gene shows relaxed tissue-specific expression and confers male sterility upon transgenic mice. Mol Cell Biol 1988, 8:4821-4828[Abstract/Free Full Text]
  39. Canfield V, West AB, Goldenring JR, Levenson R: Genetic ablation of parietal cells in transgenic mice: a new model for analyzing cell lineage relationships in the gastric mucosa. Proc Natl Acad Sci USA 1996, 93:2431-2435[Abstract/Free Full Text]
  40. Heyman RA, Borrelli E, Lesley J, Anderson D, Richman DD, Baird SM, Hyman R, Evans RM: Thymidine kinase obliteration: creation of transgenic mice with controlled immune deficiency. Proc Natl Acad Sci USA 1989, 86:2698-2702[Abstract/Free Full Text]
  41. Frank KB, Chiou JF, Cheng YC: Interaction of herpes simplex virus-induced DNA polymerase with 9-(1, 3-dihydroxy-2-propoxymethyl) guanine triphosphate. J Biol Chem 1984, 259:1566-1569[Abstract/Free Full Text]
  42. Bou-Gharios G, Garrett LA, Rossert J, Niederreither K, Eberspaecher H, Smith C, Black C, de Crombrugghe B: A potent far-upstream enhancer in the mouse pro{alpha}2(I) collagen gene regulates expression of reporter genes in transgenic mice. J Cell Biol 1996, 134:1333-1344[Abstract/Free Full Text]
  43. Chen SS, Ruteshouser EC, Maity SN, de Crombrugghe B: Cell-specific in vivo DNA-protein interactions at the proximal promoters of the pro{alpha}1(I) and the pro{alpha}2(I) collagen genes. Nucleic Acids Res 1997, 25:3261-3268[Abstract/Free Full Text]
  44. Han L, Tian B, Kleidon J, Henke C: Fibroblast ablation as treatment for pulmonary fibrosis Am J Respir Crit Care Med 2002, 165:A365(Abstract)
  45. Panos RJ, Rubin JS, Aaronson SA, Mason RJ: Keratinocyte growth factor and hepatic growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J Clin Invest 1993, 92:969-977



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Zeng, M.-j. Chen, D. A. Baldwin, Z.-j. Gong, J.-b. Yan, H. Qian, J. Wang, X. Jiang, Z.-r. Ren, D. Sun, et al.
Multiorgan engraftment and differentiation of human cord blood CD34+Lin- cells in goats assessed by gene expression profiling
PNAS, May 16, 2006; 103(20): 7801 - 7806.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tian, B.
Right arrow Articles by Henke, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tian, B.
Right arrow Articles by Henke, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS