help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Conway, E. M.
Right arrow Articles by Collen, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Conway, E. M.
Right arrow Articles by Collen, D.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*OXYGEN
(American Journal of Pathology. 2003;163:935-946.)
© 2003 American Society for Investigative Pathology

Survivin-Dependent Angiogenesis in Ischemic Brain

Molecular Mechanisms of Hypoxia-Induced Up-Regulation

Edward M. Conway*, Femke Zwerts*, Veerle Van Eygen*, Astrid DeVriese*, Nobuo Nagai{dagger}, Wei Luo* and Désiré Collen*{dagger}

From the Center for Transgene Technology and Gene Therapy,*Flanders Interuniversity Institute for Biotechnology, and the Center for Molecular and Vascular Biology,{dagger}University of Leuven, Leuven, Belgium


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Approaches to regulating angiogenesis in the brain, which may diminish parenchymal damage after stroke, are lacking. Survivin, the inhibitor of apoptosis protein, is up-regulated in vitro in vascular endothelial cells by angiogenic factors, including vascular endothelial cell growth factor (VEGF). To evaluate the in vivo role of survivin in the brain in response to hypoxia/ischemia, we used a mouse model of stroke and show that 2 days after permanent middle cerebral artery occlusion, survivin is uniquely expressed by microvessels that form in the peri-infarct and infarct regions. The extent of vascularization of the infarct is dependent on expression of survivin, since vessel density is significantly reduced in mice with heterozygous deficiency of the survivin gene (survivin+/- mice), even though infarct sizes were not different. Hypoxia alone induces survivin expression in the brain, by cultured endothelial cells and by embryonic stem cells, but this response is at least partially independent of VEGF, hypoxia inducible factor 1{alpha}, or placental growth factor. Delineating the spatiotemporal pattern of expression of survivin after stroke, and the molecular mechanisms by which this is regulated, may provide novel approaches to therapeutically optimize angiogenesis in a variety of ischemic disorders.

Following acute cerebral ischemia due to diminished blood supply to the brain, deprivation of oxygen and glucose results in a series of biochemical events, leading eventually to cell death and often devastating functional neurological disturbances. Observations that postischemic neovascularization in the infarct and peri-infarct regions correlated with survival in patients with stroke1 strongly suggested that angiogenesis might be a compensatory protective mechanism, and thus a potential therapeutic target. Therefore, major efforts are being made to delineate the molecular events that regulate angiogenesis in the setting of stroke.

In rodent stroke models, neovascularization is evident within 1 to 3 days after middle cerebral artery occlusion (MCAO).2 This occurs concomitantly with increased expression, by neurons, microglial cells, astrocytes and vessels, of the angiogenic molecule, vascular endothelial growth factor (VEGF).3,4 VEGF is the most prominent of the angiogenic factors, exerting its effects predominantly via VEGF tyrosine kinase receptors, VEGFR-1 and VEGFR-2, and neuropilins-1 and -2 (NP-1 and NP-2) (for review5 ). VEGF augments vascular endothelial cell growth and migration, but is also a potent vascular permeability factor. It further interferes with vascular endothelial apoptosis by promoting expression of inhibitors of apoptosis, including survivin6,7 and other cell-survival proteins such as Akt.8 While minimally expressed in normal adult brain,9 VEGF rapidly accumulates after ischemia, appearing in the peri-infarct and infarct regions10 and persisting for at least 7 days.11 The postischemia neovascular response, driven largely by hypoxia-induced up-regulation and stabilization of VEGF, is initiated and maintained at least in part via hypoxia-inducible transcription factors, HIF1{alpha} and HIF2{alpha}.2 In concert with enhanced expression of VEGF and its receptors, other growth factors and cellular receptors, including placental growth factor (Plgf), angiopoietin-1 and angiopoietin-2, tie-1 and tie-2,12,13 basic fibroblast growth factor (bFGF), thrombospondin-1 and thrombospondin-2,14 are also differentially regulated in highly specific spatio-temporal expression patterns, orchestrated to acutely minimize parenchymal damage, and to optimize subsequent healing and recovery (for review see9,15 ).

Armed with these new insights, angiogenic agents are currently being evaluated for treating stroke. In this regard, a major focus has been directed toward testing the efficacy of VEGF. Administration of VEGF to rats 48 hours after middle cerebral artery (MCA) ischemia yielded beneficial effects with improved neurological recovery associated with enhanced angiogenesis.16 Furthermore, in a transient model of MCAO in rats, continuous infusion of VEGF into the lateral ventricle reduced infarct volume and cerebral edema, and appeared to have a direct neuroprotective effect.17 Nitric oxide, administered 24 hours after cerebral artery occlusion in rats, also enhanced angiogenesis in the ischemic brain, a response that was in part mediated by VEGF.18 In contrast to these promising findings, however, administration of VEGF after 1 hour of ischemia was complicated by blood brain barrier (BBB) leakage, hemorrhage, and larger ischemic lesions.16 This undesirable outcome, believed to result from vascular permeability-inducing properties of VEGF, was not observed when VEGF was administered directly and somewhat later to the surface of the postischemic brain.19 The early injurious effect of VEGF likely reflected relatively low-level expression of vasculo-protective molecules, such as angiopoietin-1, that at later postischemia time points are increased and protect the stability of the vessels.9,13 Thus, administration of angiopoietin-1, believed to enhance vascular integrity, plus VEGF, provided some protection against VEGF-induced BBB leakage shortly after focal ischemia.20 Despite these advances, major gains in terms of stroke management have yet to be seen in the clinic. Further research is required to delineate the molecular mechanisms by which angiogenesis proceeds in the postischemic brain, so that a stable vascular network can be rapidly provided to rescue neurons from apoptosis/necrosis and to promote healing.

As noted, VEGF also promotes vascular endothelial cell survival by interfering with apoptosis. In vitro and in vivo studies have established that regulation of apoptotic pathways may impact stroke outcome.21 In models of cerebral ischemia, inhibition or gene-inactivation of caspase-3 or caspase-1 results in mice that are partially resistant to ischemia,22,23 while gene transfer of inhibitor of apoptosis proteins (IAPs) in normal rats also attenuates ischemic damage.24 Survivin is a member of the IAP family, containing a single baculovirus IAP repeat (BIR) that facilitates interactions with caspase-3, caspase-7, and caspase-9.25 Survivin has additional unique cell-survival properties, in that it is crucial for mitosis and cell-cycle progression.26-30 Notably, survivin is up-regulated in cultured vascular endothelial cells in response to angiogenic growth factors, including VEGF, angiopoietin-1, bFGF, and Plgf.6,7,31-33 Furthermore, while survivin expression is detected in several organs during development, it is prominent in the fetal brain,34 maintaining expression into adulthood, where it is present in the choroid plexus, ependymal cells, neurons, astrocytes, and oligodendrocytes.35

In view of the unique cell survival properties of survivin, its expression in ischemia-sensitive regions of the brain, and most notably its differential regulation in endothelial cells in response to VEGF and other angiogenic factors, we used a mouse model of stroke to test the hypothesis that survivin plays a crucial role in neovascularization and repair after cerebrovascular occlusion.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Transgenic Mice

Generation of survivin+/- mice by homologous recombination in embryonic stem (ES) cells has been previously reported.36 For the current studies, transgenic mice were bred onto a Swiss:129s (~94:6) background. These animals express ~50% levels of survivin mRNA, and respond with increased sensitivity to FasL-induced hepatic apoptosis. No other phenotypic abnormalities have been identified. Survivin+/+ littermates were used as controls for experiments on survivin+/- mice. In other experiments to evaluate temporal changes in response to stroke, BALB/c mice were used.

Focal Cerebral Ischemia

Focal cerebral ischemia was achieved by permanent occlusion of the MCA according to established methods.37 Briefly, 10- to 12-week-old mice weighing 20 to 30 g were anesthetized by intraperitoneal injection of ketamine and xylazine. Atropine (1 mg/kg) was administered intramuscularly, and body temperature was maintained at 37°C. A U-shaped incision was made between the left ear and left eye. The cranial and dorsal segments of the temporalis muscle were transected and retracted, thereby exposing the skull. A 2-mm-diameter opening was made in the region over the MCA with a handheld drill, with saline superfusion to prevent heat injury. The meninges were removed with a forceps, and the MCA was occluded with three adjacent ligations with 10-0 nylon thread (Ethicon, Johnson and Johnson, Dilbeek, Belgium). Finally, the artery was transected distal to the ligation. The temporalis muscle and skin were reconstructed, and the mice were allowed to recover. Control (sham) mice were treated identically, excluding ligation of the MCA. Mortality during the procedure did not exceed 10%. At different times (6 hours to 7 days) after MCAO, the mice were re-anesthetized and the brains were quickly removed and either fixed in 4% paraformaldehyde for 3 hours at 4°C and embedded in paraffin for subsequent histological analyses, or the intact brain was cut into slices and immersed in 2% 2,3,5-triphenyltetrazolium chloride (TTC) in saline for quantitation of infarct volume (see below). In each case, a minimum of 4 to 7 mice was used at each interval.

Immunohistochemical and Vessel Density Studies

For histological analyses, 7-µm brain sections were cut. Sections were dewaxed, rehydrated, antigen retrieval was performed, and they were incubated with proteinase K (20 mg/ml Tris-HCl, pH7.5) for 30 minutes at 37°C. Immunoperoxidase staining was performed according to standard techniques using the following antibodies: Specific rabbit anti-murine survivin antibodies were generated as described.38 Rabbit anti-rat thrombomodulin (anti-TM) antibodies were a gift from Dr. R.W. Jackman (Harvard University, Boston, MA). All other antibodies were obtained from SanverTECH (Boechout, Belgium). Vessel density was quantified by visually counting TM-staining vessels in 5 non-adjacent (>100 µm distant) cross-sections per mouse (n = 4) in at least 4 high-power fields per section,13 and dividing by the measured areas. Results are expressed as number of vessels/mm2. The selected areas encompassed the entire penumbra and central infarct region. The leptomeninges, which is usually a site of increased vascularity postischemia, was excluded because the entire leptomeninges was not uniformly intact in all specimens after processing for immunohistologic analyses. All assessments were performed by one blinded microscopist. The mean value from each mouse was used to calculate the overall mean ± SEM.

Immunofluorescent Studies

Paraffin-embedded brain sections were processed as above, and co-incubated with primary endothelial cell-specific goat anti-Glut139 antibodies (Santa Cruz Biotechnology, SanverTECH) and biotinylated rabbit anti-survivin antibodies, or combinations of the corresponding pre-immune antibodies. After washes, sections were further incubated with rhodamine-conjugated anti-goat antibodies and FITC-conjugated streptavidin. Analyses were performed using a confocal laser-scanning microscope (Leica, Wetzlar, Germany). Settings to exclude non-specific background were determined by using the corresponding primary pre-immune antibodies.

Infarct Volume Measurement

After surgical removal of the brain and immersion of 1-mm slices in TTC, the stained sections were photographed, and the well-defined necrotic and apparently viable areas were quantified by planimetry, after which the infarct volume was calculated.40 The intact contralateral hemispheric volume was also determined, and there was ~2.5% intermouse variability within the same strain of mice. Thus, absolute infarct volumes were used for the purposes of comparison.

Quantification of mRNA levels

Total RNA was isolated from homogenized tissue in TRIzol reagent (Life Technologies, Merelbeke, Belgium) according to the manufacturer’s instructions. Standard curves for quantitative real-time polymerase chain reaction (PCR) were generated from plasmids containing cDNAs encoding murine survivin140, VEGF, Plgf, HIF1{alpha}, HIF2{alpha}, and p53. Concurrent PCR to detect expression of the reference gene HPRT, using primers HPRTF (sense 5' ttatcagactgaagagctactgtaatgatc) and HPRTR (antisense 5' ttaccagtgtcaattatatcttcaacaatc) and probe 5'-(JOE)-tgagagatcatctccaccaataacttttatgtccc-(TAMRA)-3') allowed for relative quantitation of expression of gene transcripts as a function of HPRT copy number. Real-time PCR measurements were done in triplicate, with duplicate or triplicate samples under the same condition. Entire experiments were performed a minimum of two times.

Western Immunoblot

Cells were washed and lysed on ice in a solution containing 0.5% Triton X-100, 50 mmol/L NaCl, 5 mmol/L ethylenediaminetetraacetate, 10 mmol/L Tris-HCl pH7.5 in the presence of protease inhibitors. 100 µg were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under non-reducing conditions and transferred to a nylon filter which was blocked with 3% bovine serum albumin in TBS with 0.01% Tween and incubated for 2 to 18 hours with the primary antibody. After washing and incubation of the filter with the appropriate secondary antibody conjugated to horseradish peroxidase, detection was accomplished using the enhanced chemiluminescence method (Amersham-Pharmacia, Freiburg, Denmark). Equivalent loading was confirmed by re-blotting the filters for detection of actin.

Hypoxia Treatment of Mice

A regulated hypoxia chamber, maintained at room temperature, was used to expose mice to an ambient oxygen tension of 5.5% overnight. Mice were immediately sacrificed for analyses subsequent to hypoxia. Oxygen tensions were continuously monitored during experiments, and there was less than 1% variation from the target in the recorded oxygen tension during any experiment.

Cell Culture

ES cells lacking both alleles for the genes encoding VEGF and HIF1{alpha}, with corresponding wild-type control cells, were generated at the Center for Transgene Technology and Gene Therapy by high G418 selection of ES cells heterozygous for each gene. ES cells were routinely cultured on fibroblast feeders and in the presence of leukemia inhibitory factor to prevent differentiation. Human umbilical vein endothelial cells (HUVECs) were cultured as previously described.41 Before hypoxia exposure, cells were split onto gelatin-coated plates, refed with complete media, and 24 hours later, incubated in a humidified hypoxia chamber for 20 hours before processing for RNA or Western blot analyses. An oxygen tension of 2% (5% CO2, balance N2) was selected due to reported effects on transcription of angiogenesis-related genes in endothelial cells under similar conditions.42,43 Studies were performed at least twice, with different ES cell clones, and real-time PCR was done in triplicate.

Animal Care

Animal experiments were approved by the Institutional Animal Care and Use Committee of the University of Leuven.

Statistical Analyses

Statistical analyses of data were conducted with the StatView computer program (Abacus Concepts Inc., Berkeley, CA) or with InStat 3 (MacKiev Company, Cupertino, CA). Student’s t-test was used to compare groups in which the standard deviations were not significantly different. The data are represented as the mean ± SE.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Survivin Expression in the Normal Brain

Using specific anti-survivin antibodies for immunoperoxidase staining of sections of fixed brain tissues, we first examined the expression pattern of survivin in the brains of normal adult BALB/c mice. Low levels of survivin were detected in neurons within the CA-1, CA-2, and CA-3 regions of the hippocampus, the dentate gyrus, and the pyramidal cells of the cortex (Figure 1, A to C) , as similarly reported.35 Survivin was not otherwise detectable in any other sites. Specifically, there was no expression in or around the vasculature. In adjacent sections, no signal was detectable when pre-immune Ig was used (Figure 1D) , or when the primary antibody was excluded (not shown).



View larger version (132K):
[in this window]
[in a new window]
  		Figure 1. Survivin expression in the brain. Expression of survivin was detected with specific anti-survivin antibodies visualized by immunoperoxidase staining in the hippocampus (A and B) and pyramidal cells in the cortex of the normal brains from BALB/c mice (C). There was no immunoperoxidase staining in the hippocampus (D) or in the cortex when pre-immune primary antibody was used. E: In a representative stroke 2 days after MCAO, H&E staining of a region within the frontal cortex reveals the area of infarct (i) above the dashed line in which nuclei are condensed and retracted (arrows), as compared with healthy-appearing cells (arrowheads) in the non-affected region below the line.

 
Survivin Expression by Brain Microvascular Endothelium after MCAO

Survivin expression in response to stroke was evaluated by using a murine model of permanent focal cerebral ischemia in which the MCA was ligated. Adult BALB/c mice were used because in pilot studies cerebral infarct volumes were consistently larger and there was less mouse-to-mouse variability than in other strains (eg, Swiss, 129s, C57Bl6). Demarcation of infarcts was readily identified by hematoxylin and eosin (H&E) staining (Figure 1E) as nuclei of cells within the infarct were condensed, and the cells retracted. From 6 hours to 7 days after MCAO, the expression of survivin remained detectable in both cerebral hemispheres in the neurons of the hippocampus, dentate gyrus, and cortex. The pattern and intensity of staining was similar to that seen in normal (untreated) or sham-treated (surgery, but without ligation of the MCA) mice. Only in the infarct region itself was survivin not identified in the neurons from 6 hours onwards. Furthermore, 6 hours post-MCAO (Figure 2A) , survivin was also noted in the pia mater and pia vessels predominantly overlying the region of the infarct, while it was absent in corresponding sites in the contralateral, unaffected hemisphere. The same pattern and extent of expression was evident at 1 day post-MCAO (not shown). However, at 2 days post-MCAO prominent changes occurred. Survivin was detectable in what appeared morphologically to be microvessels within the peri-infarct and infarct regions (Figure 2, B and C) , in a pattern suggestive of endothelial cell staining. Survivin expression was entirely absent in the vasculature of non-ischemic areas of the brain, the latter identified throughout the brain by endothelial-specific anti-TM antibodies. However, there was more intense survivin staining of pia mater and pia vessels in areas adjacent to and overlying the infarct (Figure 2C) . Survivin was absent, however, in the corresponding regions of the contralateral hemisphere. This pattern of staining for survivin within the infarct was similar, although with slightly more prominent vascularity, at 3 days post-MCAO. Sections at all time points were stained in parallel with pre-immune primary antibody, and no signal was detected, thus excluding the possibility that the survivin-specific signals were artifactual (an example is shown in Figure 2H at 3 days post-PCAO). The similar pattern of staining in the peri-infarct and infarct regions with anti-TM antibodies provided additional support that survivin was being expressed by vascular endothelial cells (Figure 2D) . Further confirmation, however, was accomplished by demonstrating co-localization of survivin to cells expressing the endothelial cell specific Glut139 (Figure 3) . In the infarct region of the brain of mice 3 days post-MCAO (when vascular endothelial proliferation is reportedly maximal2 ), the patterns of staining for survivin and Glut1 (Figure 3A) were entirely overlapping. Non-specific signals from each labeled antibody were excluded by the use of corresponding preimmune antibodies in place of either anti-survivin antibody (Figure 3B.1) or anti-Glut1 antibody (Figure 3C.2) . In the cortex of the contralateral hemisphere with respect to the stroke, Glut1 could be detected in vessels, while survivin was absent (Figure 3D) . At 7 days post-MCAO, in concert with an increase in survivin and TM expression in the region of the infarct (Figure 2E to G) , an irregular complex of vessels developed, extending apparently from the penumbra and the pia and leptomeninges overlying the infarct region, appearing to invade the core of the infarct.



View larger version (98K):
[in this window]
[in a new window]
  		Figure 2. Expression of survivin and thrombomodulin in the brain post-MCAO. Representative sections of brains from BALB/c mice post-MCAO were immunostained for survivin or for thrombomodulin (TM). A: At 6 hours post-MCAO, survivin is most readily detected in the pia mater overlying the infarct region (arrows to the right of the dashed line) and in cortical pyramidal cells in the non-ischemic region (arrowheads to the left of the dashed line), while it is absent elsewhere. B and C: At 2 days post-MCAO, survivin staining appears in microvascular endothelial cells in the peri-infarct (B) and infarct (C) regions (arrowheads) and in the pia mater (arrows) and pia vessels. D: TM staining of microvascular endothelium is evident in the cortex of the brain 2 days post-MCAO, and is most prominent in the peri-infarct and infarct zone, which is to the right of the dashed line. The non-infarct region is to the left of the dashed line. The pattern of cell staining for TM in the infarct region (F, right of dashed line) is similar to that for survivin, as seen in B and C. E to G: At 7 days post-MCAO, brain sections were stained for survivin (E and F) and TM (G). The staining patterns of survivin and TM are similar in the penumbra (pen), pia mater and in the complex network of vascular endothelium (arrows) in the cortical infarct region. H: An example of the absence of non-specific immunoperoxidase staining of vascular endothelial cells (arrows) in the center of the cortical infarct region of the brain (3 days post-MCAO) when pre-immune antibodies were used.

 


View larger version (36K):
[in this window]
[in a new window]
  		Figure 3. Localization of survivin in cerebrovascular endothelium. Paraffin-embedded sections of brains from BALB/c mice 3 days post-MCAO were incubated with biotinylated-rabbit anti-survivin antibodies (A.1, C.1, D.1) and goat anti-Glut1 antibodies (A.2, B.2, D.2) or the appropriate pre-immune antibodies (B.1, C.2), and detected with FITC-conjugated streptavidin (left), and in the same microscopic fields, with rhodamine-conjugated anti-goat antibody (right), respectively. Positive staining is denoted with arrows. In the infarct region (A to C), endothelial cells are identified by staining with anti-Glut1 antibodies (A.2 and B.2), and colocalize with survivin (A.1). FITC-labeled pre-immune antibodies exhibit no non-specific signal (B.1), nor do rhodamine-labeled pre-immune antibodies (C.2), in a region of the infarct where survivin is detected in endothelium (C.1). In the contralateral hemisphere (unaffected by the MCAO), Glut1 is readily detected in the vascular endothelium (D.2), while survivin is absent in the same field of view (D.1).

 
Expression of VEGF post-MCAO

Since VEGF up-regulates survivin in vascular endothelial cells in vitro,6,32 we examined its expression pattern in the brains after stroke. Similar to previous reports,2,15 we detected low levels of VEGF in the hippocampus bilaterally in normal and sham-treated BALB/c mice (Figure 4A) . At 6 hours post-MCAO, VEGF was also detected in the leptomeninges and pia overlying the infarct region (Figure 4B) , and within the infarct in scattered glia-like cells, which were occasionally adjacent to vessels (Figure 4C) . By 3 days post-MCAO, there was more VEGF staining by glia-like cells within the infarct region, particularly in the cortex, and close to vessels. The intensity of staining in the same spatial pattern was enhanced by 7 days post-MCAO, when VEGF expression was most prominent throughout the peri-infarct and leptomeningeal regions. At this time, there was also somewhat less intense but readily identifiable VEGF expression within the core of the infarct, often adjacent to microvessels (Figure 4, D and E) . Notably, from 3 to 7 days post-MCAO, the spatial pattern of expression of VEGF in and around the ischemic region was similar to that observed with survivin (Figure 2F) , although the cellular source was clearly different.



View larger version (159K):
[in this window]
[in a new window]
  		Figure 4. Expression of VEGF in the brain post-MCAO. Representative sections of brains from BALB/c mice 0 hours (A), 6 hours (B and C), and 7 days (D and E) after MCAO were stained for VEGF. VEGF is normally present in cells of the hippocampus (CA1 region is shown) (A). VEGF expression is initially detectable 6 hours after MCAO in the pia overlying the infarct region (arrows in B), and in scattered glia-like cells in the infarct region of the cortex, occasionally adjacent to blood vessels (v) (C). At 7 days post-MCAO, VEGF staining (arrows in D and E) in the ipsilateral cortex is prominent in glia-like cells and evident near vessels (v) in the penumbra (pen), but less intensely in the central ischemic zone (i), and largely absent in the non-ischemic (ni) region (E is a high-power view of the dashed field in D).

 
Since VEGF and other angiogenic factors increase the expression of survivin in vitro in cultured endothelial cells via activation/phosphorylation of Akt,6,7,44 we also characterized the expression pattern of phosphorylated Akt (pAkt) in the brains in response to MCAO. Consistent with previous reports,45 our studies revealed constitutive expression of phospho-Akt throughout the brain (not shown), most prominent in neurons, with a dramatic decrease in apparent expression within the infarct region by 6 hours post-MCAO. No specific staining of vascular endothelium for phospho-Akt was evident at any time during the 1 week following occlusion, suggesting that alternative mechanisms of up-regulation of endothelial cell survivin might be active.

Vascular Response after MCAO as a Function of Survivin Expression

In view of our findings that survivin expression by cerebrovascular endothelium is up-regulated in response to stroke, we predicted that vascularity and infarct size may be dependent on underlying levels of survivin. Total inactivation of the survivin gene in mice results in early embryonic lethality.30,36 Survivin+/- mice appear phenotypically normal, yet under specific stresses, they exhibit enhanced sensitivity to proapoptotic stimuli.36 To determine whether the response to cerebral hypoxia/ischemia would be altered by lower levels of survivin, we induced MCAO in adult and survivin+/- mice and their sibling control wild-type survivin+/+ mice. At corresponding times post-MCAO, infarct volumes in survivin+/- mice at 24 hours and 3 days were not significantly different from those of survivin+/+ mice (Table 1) , suggesting that decreasing survivin expression by ~50% does not significantly alter infarct size in this permanent cerebral artery occlusion model. Since vessel formation in the ischemic region likely has an impact on recovery, we also quantified the density of vessels in the infarct region of the survivin+/+ and survivin+/- mice at 3 days post-MCAO, before any evidence of volume retraction, and when endothelial proliferation is reportedly maximal in similar models in mice and rats.2,13 The density of TM-positive staining vessels within the penumbra and central infarct region (excluding the leptomeningeal area) was significantly diminished in the brains of survivin+/- mice (508 ± 25 versus 404 ± 19 vessels/mm2 in survivin+/+ and survivin+/- mice, respectively (P = 0.003, n = 4 mice)). At 7 days post-MCAO, the vessel density was still greater in the strokes of the survivin+/+ mice (391 ± 26 vessels/mm2) as compared to those in survivin+/- mice (299 ± 24 vessels/mm2), although the difference was no longer statistically significant (P = 0.068, n = 4 mice). The findings could not be attributed to differences in the numbers of vessels in the brain before MCAO; vessel densities in the corresponding regions of the cerebral cortex of untreated survivin+/+ mice (296 ± 21 vessels/mm2) and survivin+/- mice (315 ± 32 vessels/mm2) were not significantly different (P > 0.1, n = 4). These data are consistent with the notion that angiogenesis in response to cerebrovascular occlusion is partly dependent on survivin expression.


View this table:
[in this window]
[in a new window]
  		Table 1. Infarct Volume Post-MCAO

 
Oxygen-Dependent Regulation of Survivin Expression

Since hypoxia is a major angiogenic stimulus, we directly evaluated whether hypoxia contributed to the enhanced expression of survivin in the cerebrovasculature post-MCAO, by exposing wild-type survivin+/+ mice to ambient oxygen tensions of 5.5% for 20 hours. Survivin mRNA levels in the brains of mice exposed to hypoxia (n = 5) were 1.8 ± 0.4-fold higher than that seen in brains of mice under normoxic conditions (n = 8) (P < 0.05). The augmented expression of survivin was associated with an 8.6 ± 1.0-fold increase in VEGF mRNA levels in the brains of hypoxia-exposed mice, suggesting that VEGF could mediate the enhanced expression of survivin. Similar significant twofold and fivefold increases in survivin and VEGF mRNA levels, respectively, were obtained with BALB/c mice. To further explore the mechanism of hypoxia-induced up-regulation of survivin in vitro, we evaluated the expression of survivin by HUVECs following 20 hours of hypoxia. Under these conditions, survivin expression by endothelial cells reportedly increases in response to angiopoietin-1, bFGF, VEGF, and Plgf.6,7,33,44 In our studies, hypoxia resulted in a 2.1 ± 1.4-fold increase (P < 0.05, n = 3) in survivin mRNA levels (relative to normoxia), while VEGF and HIF1{alpha} mRNA accumulation was also enhanced (1.3 ± 0.2-fold and 1.5 ± 0.2-fold, respectively), but not to a level of significance (P > 0.05, n = 3). The data suggest that while VEGF likely plays a role in up-regulating survivin, there may be alternative VEGF-independent pathways by which hypoxia may induce survivin expression.

The regulation of survivin in response to hypoxia was therefore further studied by exposing undifferentiated VEGF-/- and VEGF+/+ ES cells to hypoxia (2%) or normoxia for 20 hours (Figure 5A) . Since inactivation of the VEGF gene results in embryonic lethality in mice,46 the ES cell model provides mechanistic insights that otherwise are not available in vivo.47 After 20 hours of exposure to hypoxia, survivin mRNA levels in VEGF+/+ ES cells were increased ~1.7-fold (P < 0.05). Expression of survivin protein was, however, not significantly affected, although monomeric forms appeared to diminish in intensity (Figure 5B) . Under these conditions, VEGF mRNA levels increased by ~2-fold, concurrent with a significant 1.7-fold increase in accumulation of HIF1{alpha} mRNA (P < 0.05), and no change in HIF2{alpha} mRNA. The lack of more prominent changes in VEGF and HIF likely reflects the relatively mild degree of hypoxia used in these ES cell experiments as compared with other studies.47,48 As expected, VEGF mRNA was undetectable in the VEGF-/- ES cells under all conditions. In the absence of VEGF, and associated with a significant increase in HIF1{alpha} mRNA levels, hypoxia enhanced survivin mRNA accumulation. Survivin protein expression was also increased, and appeared to more prominently affect accumulation of the dimeric form (Figure 5B) . While the data show that survivin may be up-regulated by hypoxia in the absence of VEGF, we could not exclude, from these experiments, a more direct role for HIF1{alpha} in regulating survivin expression. We therefore examined the expression of survivin using HIF1{alpha}-/- and HIF1{alpha}+/+ ES cells under normoxic and hypoxic conditions. In HIF1{alpha}-/- ES cells, HIF1{alpha} mRNA was undetectable, while VEGF mRNA was only minimally expressed (Figure 6) . The hypoxia-induced non-significant increase in VEGF mRNA may be attributable to stabilization of the mRNA, as opposed to a transcriptional effect of HIF1{alpha}.49 Survivin mRNA accumulation was significantly increased in the HIF1{alpha}-/- ES cells after hypoxia (P < 0.05), supporting the conclusion that survivin expression may, under specific conditions, be augmented in the absence of both VEGF and HIF1{alpha}. The enhanced expression of survivin in the absence of HIF1{alpha} suggests that HIF1{alpha} may actually down-regulate survivin. Since HIF1{alpha} can stabilize and/or up-regulate p53 during hypoxia,50 and p53 may suppress survivin,51 we considered whether HIF1{alpha} was acting on survivin via p53. However, the accumulation of p53 mRNA by the VEGF+/+ and VEGF-/- ES cells (Figure 5A) was not affected under these experimental conditions, suggesting that p53 was not playing a critical role in regulating survivin expression in these cells. Since Plgf may also induce expression of survivin in endothelial cells,33 we considered the possibility that hypoxia-induced up-regulation of survivin in the HIF1{alpha}-/- ES cells might be mediated by Plgf. However, this hypothesis was also excluded, as Plgf mRNA levels did not change in the ES cells in response to the hypoxia (Figure 6) .



View larger version (37K):
[in this window]
[in a new window]
  		Figure 5. Oxygen-dependent gene expression in VEGF-/- ES cells. A: VEGF+/+ and VEGF-/- ES cells were exposed to normoxia or hypoxia, and mRNA levels were quantified. Results reflect the mean ± SEM of experiments performed a minimum of three times. Asterisk indicates a significant increase (P < 0.05) relative to normoxia. B: After exposure of VEGF+/+ (+/+) and VEGF-/ - (-/-) ES cells to normoxia (20%) or hypoxia (2%), cells were washed with PBS and lysates were prepared. Western immunoblotting after SDS-PAGE on a 15% gel was performed with anti-survivin antibodies. Molecular weight markers are on the right. Survivin monomers, detected at ~16 kd appear to diminish after hypoxia, while dimers, recognized at ~32 kd, increased after hypoxia most prominently in VEGF-/- ES cells. Equivalent loading was confirmed by immunoblotting stripped filters for actin (not shown).

 


View larger version (36K):
[in this window]
[in a new window]
  		Figure 6. Oxygen-dependent gene expression in HIF1{alpha}-/- ES cells. HIF1{alpha}+/+ and HIF1{alpha}-/- ES cells were exposed to normoxia or hypoxia as indicated in the legend, and mRNA levels were quantified. Results reflect the mean ± SEM of experiments performed a minimum of three times. Asterisk indicates a significant increase (P < 0.05) relative to normoxia.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Although few factors have been identified that enhance the expression of the IAP, survivin, these are predominantly and notably involved in angiogenesis. For example, treatment of cultured endothelial cells with angiopoietin-1, bFGF, or VEGF augments survivin expression several-fold6,7 via activation of Akt and/or PI3 kinase pathways. Survivin expression by cultured human arteriolar endothelial cells is also enhanced in response to hypoxic preconditioning via PI3-kinase/Akt/NF-{kappa}B signaling, which in turn facilitates tubular morphogenesis.52 Up-regulation of survivin may also confer protection to endothelial cells from stresses, including chemotherapy.53 Despite these apparent links with angiogenesis, in vivo support for a direct role of survivin in vascular endothelial function, growth, and proliferation has been lacking. We therefore used a mouse model of permanent focal cerebral ischemia to evaluate the role of survivin in vivo, and report the following: 1) survivin expression is augmented by cerebral capillary endothelial cells of vessels in the peri-infarct and infarct regions, and in the overlying pia mater following cerebrovascular occlusion, 2) the extent of vascularization in the first few days after cerebrovascular occlusion is dependent in part on survivin expression, and 3) survivin expression may be up-regulated in response to hypoxia by mechanisms not necessarily requiring VEGF, HIF1{alpha}, or Plgf.

After cerebral ischemia due to vascular occlusion, the resultant diminished oxygen and nutrient delivery to the tissues leads to compensatory responses to protect the brain. One of the crucial mechanisms to enhance oxygenation is through new vessel formation. This may occur via sprouting of endothelial cells from pre-existing vessels, ie, angiogenesis (reviewed in54 ), or may also involve vasculogenesis, whereby circulating endothelial progenitor cells from the bone marrow contribute to the newly forming vasculature in the ischemic region.55 In rodent models of permanent MCAO, newly formed vessels are generally seen within 1 to 3 days in the peri-infarct region where cells are hypoxic.2 Of the many factors involved in this response, VEGF is by far the best characterized. In most studies, VEGF mRNA is first detectable in the brain 3 to 6 hours after MCAO, mainly in glia-like cells and macrophages11 in the penumbra. More sensitive detection methods suggest even a more immediate VEGF response.56 VEGF protein expression peaks by ~2 days, when it is also found in the vicinity of capillaries within the core of the infarct15 and in the hippocampus.11 Only after 2 to 3 days are VEGF and its receptors up-regulated within the ischemic zone, in the pia and leptomeninges,10 as vessels seem to "invade" the infarcted region, and vascular endothelial cells proliferate. Administration of VEGF in small animal stroke models has met with variable results, depending on the dose, time, and duration of administration.16 Shortly after an ischemic event, the capillary leakage induced by VEGF may be deleterious, whereas the angiogenic effect of VEGF may be beneficial for long-term recovery.16 That survivin and VEGF have overlapping temporal patterns of expression of their respective proteins, albeit by different cells, and that VEGF induces survivin expression in vitro, suggests that they may cooperate in tissue recovery efforts after hypoxic/ischemic injury. This is consistent with the current concept that VEGF does not act alone in enhancing the formation of competent new vessels after ischemia but rather functions in concert with finely tuned expression of an array of other angiogenic and anti-angiogenic regulators.

The roles and patterns of expression of other angiogenic molecules that notably also regulate survivin in vitro, have similarly been evaluated postischemia in rodent stroke models. For example, the expression of angiopoietin-1, an angiogenic factor that provides vessel stability, maintains vascular integrity, and induces sprouting, is variably reported to be acutely down-regulated in rodent brains post-MCAO,13,15 at a time when VEGF is initially increasing. It is interesting to note that constitutive angiopoietin-1 expression in the adult brain is postulated to provide baseline protection against stresses that would disrupt the integrity of the BBB. It is possible that low levels of survivin, not detectable by immunostaining, play a role in this function. Angiopoietin-2, antagonistic to the vascular stabilizing influence of angiopoietin-1, starts to increase by 6 to 8 hours post-MCAO in endothelial cells within the infarct, peri-infarct, and hippocampus, persisting for up to 7 days. In concert with VEGF, angiopoietin-2 likely promotes vascular leakage early after the initial insult,15 allowing extravasation of macrophages from the circulation through the disrupted BBB, for subsequent "clean-up" of necrotic debris.57 By 2 to 3 days post-MCAO, angiopoietin-1 is up-regulated, while BBB leakage is decreasing, and coincident with peak expression of both VEGF and survivin. The increased VEGF at this time does not induce leakage, likely due in part to the increasing presence of angiopoietin-1, which stabilizes the vessels. We speculate that survivin may enhance this stability. Endothelial cell proliferation is first noted at 24 hours and is preceded by a brief period of endothelial cell apoptosis (at ~12 hours) that appears to correlate with a decrease in VEGF/Ang2 ratio, and expression of Ang2 in those endothelial cells.13 Our finding that survivin expression is only apparent in the microvasculature of the infarct after ~2 days may reflect suppression of survivin’s response by Ang-2, a hypothesis that has not yet been tested. However, this may prove to be clinically relevant, as interventions to increase survivin expression early after an hypoxic/ischemic cerebrovascular event might provide protection. Thus, it is critical to develop a thorough understanding of the molecular mechanisms that regulate survivin expression under these conditions.

While the preceding discussion implies that in the complex setting of cerebrovascular hypoxia/ischemia survivin is regulated in vivo by angiogenic factors, our studies indicate that alternative mechanisms may also be functional. There are numerous hypoxia-responsive genes, many of which are up-regulated following binding of HIF-1{alpha} to hypoxia-responsive elements (reviewed in58 ). These include, for example, VEGF, VEGFR-1, HIF1{alpha}, and bFGF.59 However, other pathways have been identified that are independent of HIF1{alpha}, including NF{kappa}B, early growth response factor-1, and metal transcription factors. Notably, HIF1{alpha} has no role in increasing transcription of the gene encoding the inhibitor of apoptosis protein IAP-2 after hypoxia. A cis-acting cAMP response element-binding protein (CREB) site within the enhancer region of the IAP-2 gene appears to be critical for what is predominantly a transcriptional response.60 Similarly, the induction of Plgf by hypoxia is dependent in part on a metal response element-binding transcription factor.61 We have not yet established which pathways are active in vivo in up-regulating survivin, or whether the response is mainly transcriptional or due to changes in mRNA stability. Indeed, it is likely that coordinate activation of one or more factors may be required for maximal expression of survivin under stress conditions. Overall, there is considerable evidence to support the existence of alternative hypoxia-responsive regulatory mechanisms that might be amenable to therapeutic intervention, both in vascular hypoxia/ischemia and in tumor growth.

Surprising is our observation that the hypoxia-associated increase in survivin mRNA levels was more prominent in VEGF-/- and HIF1{alpha}-/- ES cells, as compared with the response in VEGF+/+ and HIF1{alpha}+/+ ES cells, respectively. These findings, confirmed in several ES cell clones under the same conditions, suggest that VEGF and/or HIF1{alpha} suppress the response of survivin to hypoxia either directly or indirectly. Under hypoxic conditions, HIF1{alpha}, in fact, modulates gene activity that may not only interfere with apoptosis, but under specific conditions, may also promote cell death.62 The molecular mechanisms that provide HIF1{alpha} with pro-apoptotic properties are not yet fully delineated. Nonetheless, several responsible biochemical pathways have been identified. Most striking was the observation that HIF1{alpha} stabilized p53 in tumors and promoted an apoptotic response.63 This, however, does not appear to be the means by which survivin was up-regulated in our ES cells. HIF1{alpha} has also been shown to induce endothelial cell cycle arrest and hypoxia-associated apoptosis by interfering with Bcl-2 expression,64 and by up-regulating Nip3, a proapoptotic member of the Bcl-2 family.65,66 Further studies in other mammalian cell systems will be necessary to identify those factors that regulate survivin expression under hypoxic conditions.

Interestingly, in response to hypoxia, we found that the monomeric forms of survivin from ES cells decreased, while at least in the VEGF-/- ES cells, expression of survivin dimers was enhanced. These findings are not entirely unique, since survivin dimers were similarly recognized in immunoblots of cultured human coronary vascular endothelial cells after exposure to hypoxia/reoxygenation.52 The crystal structure of survivin67-69 predicts that it forms dimers, which was postulated to have functional importance in either apoptosis and/or the cell cycle. Biochemical studies have confirmed that in the dimer conformation, survivin is effective at interfering with the activity of caspase-3 and caspase-7.70 That changes in conformation might be a means of regulating functional expression of survivin, particularly as it pertains to angiogenesis in the setting of hypoxia, will be a topic for future investigations.

The early embryonic lethality of survivin-/- embryos has confounded loss-of-function studies to more clearly define the role of survivin in vascular endothelial cell development and function, angiogenesis, and neurogenesis. Conditional, cell-specific inactivation studies in mice will provide the means to more directly answer these questions. These are in progress. Nonetheless, using a well-established mouse model representing stroke in humans, and complemented by in vitro studies, we have established that survivin is up-regulated in the microvasculature of the brain in response to cerebrovascular ischemia, and that the extent of vascularization within the infarct region is dependent in part on survivin. Identification of the mechanisms involved in regulation of the functional expression of survivin is crucial for the development of novel therapeutic approaches to treat and/or prevent not only stroke, but all illnesses in which the outcome is dependent on vascular endothelial cell survival and death.


   Acknowledgements
 
We thank Peter Carmeliet, Lieve Moons, and Mieke Dewerchin for helpful discussions, core personnel at the Center for Transgene Technology and Gene Therapy for technical support, and Gregor Theilmeier and Monica Autiero for critically reading the manuscript.


   Footnotes
 
Address reprint requests to Dr. Edward M. Conway, Center for Transgene Technology and Gene Therapy, Gasthuisberg O&N, 9th floor, Herestraat 49, B-3000 Leuven, Belgium. E-mail: ed.conway{at}med.kuleuven.ac.be

Supported in part by the FWO, Flanders (grant number G.0382.02).

Accepted for publication May 15, 2003.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Krupinski J, Kaluza J, Kumar P, Kumar S, Wang JM: Role of angiogenesis in patients with cerebral ischemic stroke. Stroke 1994, 25:1794-1798[Abstract]
  2. Marti HJ, Bernaudin M, Bellail A, Schoch H, Euler M, Petit E, Risau W: Hypoxia-induced vascular endothelial growth factor expression precedes neovascularization after cerebral ischemia. Am J Pathol 2000, 156:965-976[Abstract/Free Full Text]
  3. Plate KH: Mechanisms of angiogenesis in the brain. J Neuropathol Exp Neurol 1999, 58:313-320[Medline]
  4. Beck H, Acker T, Puschel AW, Fujisawa H, Carmeliet P, Plate KH: Cell type-specific expression of neuropilins in an MCA-occlusion model in mice suggests a potential role in post-ischemic brain remodeling. J Neuropathol Exp Neurol 2002, 61:339-350[Medline]
  5. Carmeliet P, Storkebaum E: Vascular and neuronal effects of VEGF in the nervous system: implications for neurological disorders. Semin Cell Dev Biol 2002, 13:39-53[Medline]
  6. Tran J, Rak J, Sheehan C, Saibil SD, LaCasse E, Korneluk RG, Kerbel RS: Marked induction of the IAP family antiapoptotic proteins survivin and XIAP by VEGF in vascular endothelial cells. Biochem Biophys Res Commun 1999, 264:781-788[Medline]
  7. O’Connor DS, Schechner JS, Adida C, Mesri M, Rothermel AL, Li F, Nath AK, Pober JS, Altieri DC: Control of apoptosis during angiogenesis by survivin expression in endothelial cells. Am J Pathol 2000, 156:393-398[Abstract/Free Full Text]
  8. Zhu WH, MacIntyre A, Nicosia RF: Regulation of angiogenesis by vascular endothelial growth factor and angiopoietin-1 in the rat aorta model: distinct temporal patterns of intracellular signaling correlate with induction of angiogenic sprouting. Am J Pathol 2002, 161:823-830[Abstract/Free Full Text]
  9. Croll SD, Wiegand SJ: Vascular growth factors in cerebral ischemia. Mol Neurobiol 2001, 23:121-135[Medline]
  10. Lennmyr F, Ata KA, Funa K, Olsson Y, Terent A: Expression of vascular endothelial growth factor (VEGF) and its receptors (Flt-1 and Flk-1) following permanent and transient occlusion of the middle cerebral artery in the rat. J Neuropathol Exp Neurol 1998, 57:874-882[Medline]
  11. Plate K, Beck H, Danner S, Allegrini P, Wiessner C: Cell type specific upregulation of vascular endothelial growth factor in an MCA-occlusion model of cerebral infarct. J Neuropath Exper Neurol 1999, 58:654-666[Medline]
  12. Lin TN, Wang CK, Cheung WM, Hsu CY: Induction of angiopoietin and Tie receptor mRNA expression after cerebral ischemia-reperfusion. J Cereb Blood Flow Metab 2000, 20:387-395[Medline]
  13. Beck H, Acker T, Wiessner C, Allegrini PR, Plate KH: Expression of angiopoietin-1, angiopoietin-2, and tie receptors after middle cerebral artery occlusion in the rat. Am J Pathol 2000, 157:1473-1483[Abstract/Free Full Text]
  14. Lin TN, Kim GM, Chen JJ, Cheung WM, He YY, Hsu CY: Differential regulation of thrombospondin-1 and thrombospondin-2 after focal cerebral ischemia/reperfusion. Stroke 2003, 34:177-186[Abstract/Free Full Text]
  15. Zhang Z, Chopp M: Vascular endothelial growth factor and angiopoietins in focal cerebral ischemia. Trends Cardiovasc Med 2002, 12:62-66[Medline]
  16. Zhang ZG, Zhang L, Jiang Q, Zhang R, Davies K, Powers C, Bruggen N, Chopp M: VEGF enhances angiogenesis and promotes blood-brain barrier leakage in the ischemic brain. J Clin Invest 2000, 106:829-838[Medline]
  17. Harrigan MR, Ennis SR, Sullivan SE, Keep RF: Effects of intraventricular infusion of vascular endothelial growth factor on cerebral blood flow, edema, and infarct volume. Acta Neurochir (Wien) 2003, 145:49-53
  18. Zhang R, Wang L, Zhang L, Chen J, Zhu Z, Zhang Z, Chopp M: Nitric oxide enhances angiogenesis via the synthesis of vascular endothelial growth factor and cGMP after stroke in the rat. Circ Res 2003, 92:308-313[Abstract/Free Full Text]
  19. Hayashi T, Abe K, Itoyama Y: Reduction of ischemic damage by application of vascular endothelial growth factor in rat brain after transient ischemia. J Cereb Blood Flow Metab 1998, 18:887-895[Medline]
  20. Zhang ZG, Zhang L, Croll SD, Chopp M: Angiopoietin-1 reduces cerebral blood vessel leakage and ischemic lesion volume after focal cerebral embolic ischemia in mice. Neuroscience 2002, 113:683-687[Medline]
  21. Mason R, Leeds P, Jacob R, Hough C, Zhang K, Mason P, Chuang D: Inhibition of excessive neuronal apoptosis by the calcium antagonist amlodipine and antioxidants in cerebellar granule cells. J Neurochem 1999, 72:1448-1456[Medline]
  22. Hara H, Fink K, Endres M, Friedlander R, Gagliardini V, Yuan J, Moskowitz M: Attenuation of transient focal cerebral ischemic injury in transgenic mice expressing a mutant ICE inhibitory protein. J Cereb Blood Flow Metab 1997, 17:370-375[Medline]
  23. Endres M, Namura S, Shimizu-Sasamata M, Waeber C, Zhang L, Gomez-Isla T, Hyman B, Moskowitz M: Attenuation of delayed neuronal death after mild focal ischemia in mice by inhibition of the caspase family. J Cerebral Blood Flow Metab 1998, 18:238-247[Medline]
  24. Xu D, Bureau Y, McIntyre D, Nicholson D, Liston P, Zhu Y, Fong W, Crocker S, Korneluk R, Robertson G: Attenuation of ischemia-induced cellular and behavioral deficits by X chromosome-linked inhibitor of apoptosis protein overexpression in the rat hippocampus. J Neuroscience 1999, 19:5026-5033[Abstract/Free Full Text]
  25. Tamm I, Wang Y, Sausville E, Scudiero DA, Vigna N, Oltersdorf T, Reed JC: IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs. Cancer Res 1998, 58:5315-5320[Abstract/Free Full Text]
  26. Ambrosini G, Adida C, Altieri D: A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma Nat Med 1997, 3:917-921[Medline]
  27. Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC, Altieri DC: Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 1998, 396:580-584[Medline]
  28. Skoufias DA, Mollinari C, Lacroix FB, Margolis RL: Human survivin is a kinetochore-associated passenger protein. J Cell Biol 2000, 151:1575-1582[Abstract/Free Full Text]
  29. Li F, Ackermann EJ, Bennett CF, Rothermel AL, Plescia J, Tognin S, Villa A, Marchisio PC, Altieri DC: Pleiotropic cell-division defects and apoptosis induced by interference with survivin function. Nat Cell Biol 1999, 1:461-466[Medline]
  30. Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL, Choo KH: Survivin and the inner centromere protein INCENP show similar cell-cycle localization and gene knockout phenotype. Curr Biol 2000, 10:1319-1328[Medline]
  31. Harfouche R, Hassessian HM, Guo Y, Faivre V, Srikant CB, Yancopoulos GD, Hussain SN: Mechanisms which mediate the antiapoptotic effects of angiopoietin-1 on endothelial cells. Microvasc Res 2002, 64:135-147[Medline]
  32. Mesri M, Morales-Ruiz M, Ackermann EJ, Bennett CF, Pober JS, Sessa WC, Altieri DC: Suppression of vascular endothelial growth factor-mediated endothelial cell protection by survivin targeting. Am J Pathol 2001, 158:1757-1765[Abstract/Free Full Text]
  33. Adini A, Kornaga T, Firoozbakht F, Benjamin LE: Placental growth factor is a survival factor for tumor endothelial cells and macrophages. Cancer Res 2002, 62:2749-2752[Abstract/Free Full Text]
  34. Adida C, Crotty P, McGrath J, Berrebi D, Diebold J, Altieri D: Developmentally regulated expression of the novel cancer anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol 1998, 152:43-49[Abstract]
  35. Sasaki T, Lopes MB, Hankins GR, Helm GA: Expression of survivin, an inhibitor of apoptosis protein, in tumors of the nervous system. Acta Neuropathol (Berl) 2002, 104:105-109[Medline]
  36. Conway EM, Pollefeyt S, Steiner-Mosonyi M, Luo W, DeVriese A, Lupu F, Bono F, Leducq N, Dol F, Schaeffer P, Collen D, Herbert J-M: Deficiency of survivin in transgenic mice exacerbates Fas-induced apoptosis via mitochondrial pathways. Gastroenterology 2002, 123:619-631[Medline]
  37. Nagai N, De Mol M, Lijnen H, Carmeliet P, Collen D: Role of plasminogen system components in focal cerebral ischemic infarction. Circulation 1999, 99:2440-2444[Abstract/Free Full Text]
  38. Conway EM, Pollefeyt S, Cornelissen J, DeBaere I, Steiner-Mosonyi M, Ong K, Baens M, Collen D, Schuh AC: Three differentially expressed survivin cDNA variants encode proteins with distinct antiapoptotic functions. Blood 2000, 95:1435-1442[Abstract/Free Full Text]
  39. Golden PL, Pardridge WM: Brain microvascular P-glycoprotein and a revised model of multidrug resistance in brain. Cell Mol Neurobiol 2000, 20:165-181[Medline]
  40. Lin T, He Y, Wu G, Khan M, Hsu C: Effect of brain edema on infarct volume in a focal cerebral ischemia model in rats. Stroke 1993, 24:117-121[Abstract/Free Full Text]
  41. Conway E, Nowakowski B, Steiner-Mosonyi M: Human neutrophils synthesize thrombomodulin that does not promote thrombin-dependent protein C activation. Blood 1992, 80:1254-1263[Abstract/Free Full Text]
  42. Jung F, Haendeler J, Hoffmann J, Reissner A, Dernbach E, Zeiher AM, Dimmeler S: Hypoxic induction of the hypoxia-inducible factor is mediated via the adaptor protein Shc in endothelial cells. Circ Res 2002, 91:38-45[Abstract/Free Full Text]
  43. Christensen RA, Fujikawa K, Madore R, Oettgen P, Varticovski L: NERF2, a member of the Ets family of transcription factors, is increased in response to hypoxia and angiopoietin-1: a potential mechanism for Tie2 regulation during hypoxia. J Cell Biochem 2002, 85:505-515[Medline]
  44. Papapetropoulos A, Fulton D, Mahboubi K, Kalb RG, O’Connor DS, Li F, Altieri DC, Sessa WC: Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem 2000, 275:9102-9105[Abstract/Free Full Text]
  45. Noshita N, Lewen A, Sugawara T, Chan PH: Evidence of phosphorylation of Akt and neuronal survival after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab 2001, 21:1442-1450[Medline]
  46. Carmeliet P, Verreira V, Breier G, Pollefeyt S, Kieckens L, M G, Fahrig M, Vandenhoeck A, Harpal K, Eberhardt C, Declercq C, Pawling J, Moons L, Collen D, Risau W, Nagy A: Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 1996, 380:435-439[Medline]
  47. Brusselmans K, Bono F, Maxwell P, Dor Y, Dewerchin M, Collen D, Herbert JM, Carmeliet P: Hypoxia-inducible factor-2{alpha} (HIF-2{alpha}) is involved in the apoptotic response to hypoglycemia but not to hypoxia. J Biol Chem 2001, 276:39192-39196[Abstract/Free Full Text]
  48. Carmeliet P, Dor Y, Herbert JM, Fukumura D, Brusselmans K, Dewerchin M, Neeman M, Bono F, Abramovitch R, Maxwell P, Koch CJ, Ratcliffe P, Moons L, Jain RK, Collen D, Keshert E, Keshet E: Role of HIF-1{alpha} in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis [published erratum appears in Nature 1998 Oct 1;395(6701):525].Nature 1998, 394:485-490[Medline]
  49. Goldberg-Cohen I, Furneauxb H, Levy AP: A 40-bp RNA element that mediates stabilization of vascular endothelial growth factor mRNA by HuR. J Biol Chem 2002, 277:13635-13640[Abstract/Free Full Text]
  50. Suzuki H, Tomida A, Tsuruo T: Dephosphorylated hypoxia-inducible factor 1alpha as a mediator of p53-dependent apoptosis during hypoxia. Oncogene 2001, 20:5779-5788[Medline]
  51. Hoffman WH, Biade S, Zilfou JT, Chen J, Murphy M: Transcriptional repression of the anti-apoptotic survivin gene by wild-type p53. J Biol Chem 2002, 277:3247-3257[Abstract/Free Full Text]
  52. Zhu L, Fukuda S, Cordis G, Das DK, Maulik N: Anti-apoptotic protein survivin plays a significant role in tubular morphogenesis of human coronary arteriolar endothelial cells by hypoxic preconditioning. FEBS Lett 2001, 508:369-374[Medline]
  53. Tran J, Master Z, Yu JL, Rak J, Dumont DJ, Kerbel RS: A role for survivin in chemoresistance of endothelial cells mediated by VEGF. Proc Natl Acad Sci USA 2002, 99:4349-4354[Abstract/Free Full Text]
  54. Conway EM, Collen D, Carmeliet P: Molecular mechanisms of blood vessel growth. Cardiovasc Res 2001, 49:507-521[Free Full Text]
  55. Zhang ZG, Zhang L, Jiang Q, Chopp M: Bone-marrow-derived endothelial progenitor cells participate in cerebral neovascularization after focal cerebral ischemia in the adult mouse. Circ Res 2002, 90:284-288[Abstract/Free Full Text]
  56. Hayashi T, Noshita N, Sugawara T, Chan PH: Temporal profile of angiogenesis and expression of related genes in the brain after ischemia. J Cereb Blood Flow Metab 2003, 23:166-180[Medline]
  57. Manoonkitiwongsa PS, Jackson-Friedman C, McMillan PJ, Schultz RL, Lyden PD: Angiogenesis after stroke is correlated with increased numbers of macrophages: the clean-up hypothesis. J Cereb Blood Flow Metab 2001, 21:1223-1231[Medline]
  58. D’Angio CT, Finkelstein JN: Oxygen regulation of gene expression: a study in opposites. Mol Genet Metab 2000, 71:371-380[Medline]
  59. Liu Y, Cox SR, Morita T, Kourembanas S: Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells: identification of a 5' enhancer. Circ Res 1995, 77:638-643[Abstract/Free Full Text]
  60. Dong Z, Nishiyama J, Yi X, Venkatachalam MA, Denton M, Gu S, Li S, Qiang M: Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia. Biochem J 2002, 364:413-421[Medline]
  61. Green CJ, Lichtlen P, Huynh NT, Yanovsky M, Laderoute KR, Schaffner W, Murphy BJ: Placenta growth factor gene expression is induced by hypoxia in fibroblasts: a central role for metal transcription factor-1. Cancer Res 2001, 61:2696-2703[Abstract/Free Full Text]
  62. Kietzmann T, Knabe W, Schmidt-Kastner R: Hypoxia and hypoxia-inducible factor modulated gene expression in brain: involvement in neuroprotection and cell death. Eur Arch Psychiatry Clin Neurosci 2001, 251:170-178[Medline]
  63. An WG, Kanekal M, Simon MC, Maltepe E, Blagosklonny MV, Neckers LM: Stabilization of wild-type p53 by hypoxia-inducible factor 1 {alpha}. Nature 1998, 392:405-408[Medline]
  64. Iida T, Mine S, Fujimoto H, Suzuki K, Minami Y, Tanaka Y: Hypoxia-inducible factor-1{alpha} induces cell cycle arrest of endothelial cells. Genes Cells 2002, 7:143-149[Abstract]
  65. Bruick RK: Expression of the gene encoding the proapoptotic Nip3 protein is induced by hypoxia. Proc Natl Acad Sci USA 2000, 97:9082-9087[Abstract/Free Full Text]
  66. Guo K, Searfoss G, Krolikowski D, Pagnoni M, Franks C, Clark K, Yu KT, Jaye M, Ivashchenko Y: Hypoxia induces the expression of the pro-apoptotic gene BNIP3. Cell Death Differ 2001, 8:367-376[Medline]
  67. Chantalat L, Skoufias DA, Kleman JP, Jung B, Dideberg O, Margolis RL: Crystal structure of human survivin reveals a bow-tie-shaped dimer with two unusual {alpha}-helical extensions. Mol Cell 2000, 6:183-189[Medline]
  68. Muchmore SW, Chen J, Jakob C, Zakula D, Matayoshi ED, Wu W, Zhang H, Li F, Ng SC, Altieri DC: Crystal structure and mutagenic analysis of the inhibitor-of-apoptosis protein survivin. Mol Cell 2000, 6:173-182[Medline]
  69. Verdecia MA, Huang H, Dutil E, Kaiser DA, Hunter T, Noel JP: Structure of the human anti-apoptotic protein survivin reveals a dimeric arrangement. Nat Struct Biol 2000, 7:602-608[Medline]
  70. Shin S, Sung BJ, Cho YS, Kim HJ, Ha NC, Hwang JI, Chung CW, Jung YK, Oh BH: An anti-apoptotic protein human survivin is a direct inhibitor of caspase-3 and -7. Biochemistry 2001, 40:1117-1123[Medline]



This article has been cited by other articles:


Home page
 FASEB J.Home page
N. Kindt, A. Menzebach, M. Van de Wouwer, I. Betz, A. De Vriese, and E. M. Conway
Protective role of the inhibitor of apoptosis protein, survivin, in toxin-induced acute renal failure
FASEB J, February 1, 2008; 22(2): 510 - 521.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
P. Lechler, X. Wu, W. Bernhardt, V. Campean, S. Gastiger, T. Hackenbeck, B. Klanke, A. Weidemann, C. Warnecke, K. Amann, et al.
The Tumor Gene Survivin Is Highly Expressed in Adult Renal Tubular Cells: Implications for a Pathophysiological Role in the Kidney
Am. J. Pathol., November 1, 2007; 171(5): 1483 - 1498.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
Y. Zhang, T. S. Park, and J. M. Gidday
Hypoxic preconditioning protects human brain endothelium from ischemic apoptosis by Akt-dependent survivin activation
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2573 - H2581.
[Abstract] [Full Text] [PDF]

Home page