help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heidet, L.
Right arrow Articles by Gubler, M.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heidet, L.
Right arrow Articles by Gubler, M.-C.
(American Journal of Pathology. 2003;163:1633-1644.)
© 2003 American Society for Investigative Pathology

A Human-Mouse Chimera of the {alpha}3{alpha}4{alpha}5(IV) Collagen Protomer Rescues the Renal Phenotype in Col4a3-/- Alport Mice

Laurence Heidet*, Dorin-Bogdan Borza{dagger}, Mélanie Jouin*, Mireille Sich*, Marie-Geneviève Mattei{ddagger}, Yoshikazu Sado§, Billy G. Hudson{dagger}, Nicholas Hastie, Corinne Antignac*|| and Marie-Claire Gubler*

From INSERM U574,* Hôpital Necker-Enfants Malades, Université René Descartes, Paris, France; Faculté de Médecine,{ddagger} INSERM U491, Marseille, France; the Service de Génétique,|| Hôpital Necker-Enfants Malades, Paris, France; the Division of Nephrology,{dagger} Vanderbilt University Medical Center, Nashville, Tennessee; the Division of Immunology,§ Shigei Medical Research Institute, Okayama, Japan; and the Medical Research Council Human Genetics Unit, Western General Hospital, Edinburgh, Scotland


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Collagen IV is a major structural component of basement membranes. In the glomerular basement membrane (GBM) of the kidney, the {alpha}3, {alpha}4, and {alpha}5(IV) collagen chains form a distinct network that is essential for the long-term stability of the glomerular filtration barrier, and is absent in most patients affected with Alport syndrome, a progressive inherited nephropathy associated with mutation in COL4A3, COL4A4, or COL4A5 genes. To investigate, in vivo, the regulation of the expression, assembly, and function of the {alpha}3{alpha}4{alpha}5(IV) protomer, we have generated a yeast artificial chromosome transgenic line of mice carrying the human COL4A3-COL4A4 locus. Transgenic mice expressed the human {alpha}3 and {alpha}4(IV) chains in a tissue-specific manner. In the kidney, when expressed onto a Col4a3-/- background, the human {alpha}3(IV) chain restored the expression of and co-assembled with the mouse {alpha}4 and {alpha}5(IV) chains specifically at sites where the human {alpha}3(IV) was expressed, demonstrating that the expression of all three chains is required for network assembly. The co-assembly of the human and mouse chains into a hybrid network in the GBM restores a functional GBM and rescues the Alport phenotype, providing further evidence that defective assembly of the {alpha}3-{alpha}4-{alpha}5(IV) protomer, caused by mutations in any of the three chains, is the pathogenic mechanism responsible for the disease. This line of mice, humanized for the {alpha}3(IV) collagen chain, will also provide a valuable model for studying the pathogenesis of Goodpasture syndrome, an autoimmune disease caused by antibodies against this chain.

The glomerular basement membrane (GBM), a specialized form of extracellular matrix that is positioned between layers of endothelial cells and epithelial visceral cells, is a key component of the glomerular filtration barrier in the kidney. The GBM is composed of type IV collagen networks that interact with cells through integrins and serve as a scaffold for binding other macromolecular constituents, including laminin, proteoglycan, and nidogen. Type IV collagen of normal human GBM exists as two distinct networks, composed of ({alpha}1)2{alpha}2(IV) and {alpha}3{alpha}4{alpha}5(IV) triple-protomers, respectively.1,2 The protomers are composed of three chains, each consisting of a 7S domain at the N-terminus, a long triple-helical domain and a noncollagenous (NC1) domain at the C-terminus. The protomers self-assemble into network by joining at the NC1 domains, forming dimers, and at the 7S domains, forming tetramers.3,4 The ({alpha}1)2{alpha}2(IV) network is a component of all basement membranes (BMs), whereas the {alpha}3.{alpha}4.{alpha}5(IV) network, extensively cross-linked by disulfide bonds,5 has a restricted distribution in human tissues, occurring in the kidney [GBM and some tubular basement membranes (TBMs)], lung, testis, cochlea, and eye.6,7

Type IV collagens are directly involved in the pathogenesis of two human diseases: Goodpasture and Alport syndromes. Goodpasture syndrome is an autoimmune disease caused by autoantibodies against cryptic epitopes of the {alpha}3(IV) NC1 domain,8,9 which bind to the glomerular and alveolar BMs, causing rapidly progressing glomerulonephritis associated with pulmonary hemorrhage. Alport syndrome, an inherited nephropathy characterized by irregular thinning, thickening, and splitting of the GBM and progressive renal failure, is associated with mutations in any of the COL4A3, COL4A4, and COL4A5 genes encoding the {alpha}3, {alpha}4 and {alpha}5(IV) chains. In the majority of Alport patients, the GBM shows the loss of the {alpha}3.{alpha}4.{alpha}5(IV) network and the persistence of the {alpha}1.{alpha}2(IV) network.10 The abnormal composition of networks predisposes the GBM to events, such as proteolysis, that cause progressive deterioration and loss of function.11

Whereas mRNA expression of COL4A3, COL4A4, and COL4A5 genes appears to be coordinated in dogs affected with Alport syndrome,12 such a transcriptional regulation was not found in humans affected with Alport syndrome13,14 or in mouse models for Alport syndrome.15,16 Furthermore, the three {alpha}3, {alpha}4, and {alpha}5 chains of native GBM co-exist within a triple-helical protomer,2 and the NC1 domains of all three chains are required for the in vitro assembly of a hexamer complex, representative of the native network.1 Together, these findings suggest that a mutation in one chain can prevent its association with the other two chains, thus disrupting the assembly of {alpha}3.{alpha}4.{alpha}5 triple-helical protomers and network.

To explore, in vivo, the mechanisms regulating the expression, assembly, and function of the {alpha}3.{alpha}4.{alpha}5(IV) protomer, we generated a yeast artificial chromosome (YAC) transgenic line of mice carrying the human COL4A3-COL4A4 wild-type genes, either on a wild-type or on a Col4a3-/- background. Transgenic mice were characterized with respect to renal pathology, type IV collagen genes transcription, and {alpha}(IV) chains expression and network assembly. The results showed that the YAC rescues the Alport phenotype by assembly of a hybrid type IV collagen network containing human {alpha}3 and {alpha}4(IV) and mouse {alpha}4 and {alpha}5(IV) chains in the GBM, and provide new insights in understanding the pathogenesis of Alport syndrome, type IV collagen gene regulation, and {alpha}3·{alpha}4·{alpha}5(IV) network assembly.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
YAC Characterization and Manipulations

The YAC clone 870_B6, containing the human COL4A3 and COL4A4 genes located pairwise in a head to head manner, was previously isolated17 from the human CEPH library.18 Growth of yeast strain AB1380 containing YAC, agarose blocks containing yeast DNA, conventional Southern blotting and pulsed-field gel electrophoresis, isolation of YAC ends, mapping of YAC sequence-tagged sites and sequence analysis were performed as previously described.19 A 1041-bp fragment, located 42 kb downstream of COL4A4 exon 48, was subcloned into a yeast truncation vector,20 and used for truncating the YAC 870_B6 downstream of the 3' end of COL4A4, using a homologous recombination strategy in yeast as in Barton and colleagues.21 The targeting event in yeast was confirmed by pulsed-field gel electrophoresis, Southern blotting, and polymerase chain reaction (PCR) using COL4A3 and COL4A4 cDNA probes/exon primers.17,22

Generation of Transgenic Mice and Genotyping

Purification of the YAC DNA and microinjection were performed as in Schedl and colleagues.23 DNA was injected at a concentration of 5 ng/µl into fertilized mouse oocytes isolated from F1 crosses of CBA/C57BL6 mice. Transgenic mice were identified by PCR using primers for COL4A4 exon 4817 and by Southern blot using COL4A3 and COL4A4 cDNA overlapping probes. Mice carrying one (heterozygous) or two (homozygous) transgenic alleles were differentiated by real-time PCR, using 100 ng of genomic DNA, PCR primers 5'GTGTGTGTCTGAGCCCTAAT3' and 5'TGGTGAATTTCGCATTCT3' (which amplify human COL4A4 exon 48), and the Roche (Basel, Switzerland) LightCycler-fast start DNA Master SYBR green I kit (according to the manufacturer’s instructions). Primers 5'GGGTTTCCTCTTCTCCTT3' and 5'CTAGGGCAGTTAGTAAATGG3', amplifying mouse Wt1 exon 10, were used as standards. Col4a3 +/- mice16 were purchased from the Jackson Laboratory (Bar Harbor, ME), and genotyping of the mouse Col4a3 disrupted allele was performed by Southern blot analysis of NcoI-digested genomic DNA, as in Cosgrove and colleagues.16 All procedures using animals were conducted in accordance with national guidelines and institutional policies.

Fluorescence in Situ Hybridization Analysis

Metaphase spreads were prepared from heterozygous transgenic mice. Concanavalin A-stimulated lymphocytes were cultured at 37°C for 72 hours, with 5-bromodeoxyuridine added for the final 6 hours of culture (60 mg/ml of medium). The PAC clone 310_24 E (RPCI 1 library), covering COL4A4 exons 43 to 48 and 50 kb downstream, was biotinylated by random priming with biotin 14-dCTP (Bioprime DNA labeling system; Invitrogen Carlsbad, CA). Hybridization to chromosome spreads and interphase nuclei was performed with standard protocols.24 The hybridized probe was detected by means of fluorescence isothiocyanate-conjugated avidin. Chromosomes were counterstained and R-banded with propidium iodide diluted in anti-fade solution pH 11.0.25

Urine and Blood Analyses

Samples of blood and urine were collected from deeply anesthetized mice before sacrifice. Total urinary protein was assayed with 1 µl of urine boiled in Laemmli sample buffer, electrophoretically separated on 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, using bovine serum albumin as a standard; protein was visualized with Coomassie blue. Hematuria was estimated using Multistix strips (Bayer Corporation). Serum creatinine and blood urea nitrogen were measured by the Jaffe method and by UV kinetic test respectively, using commercial kits.

RNA Analysis, Reverse Transcriptase-PCR, and Real-Time PCR Analysis

Mouse kidneys were snap-frozen in liquid nitrogen. A human mature kidney not used for transplantation was also used for the study. Total RNA was extracted using the Rneasy kit (Qiagen, Hilden, Germany). First-strand cDNAs were generated using Superscript II (Invitrogen). Relative expression levels of type IV collagen genes were determined by real-time reverse transcriptase-PCR using the Roche LightCycler-fast start DNA Master SYBR green I kit, and different sets of primers. 1) Primers 5'-TGTGTACACAGTGCCCTTAT-3' and 5'-GCCTTTAGGTCCTGGTAAT-3' amplify human COL4A3 cDNA but not mouse Col4a3; 2) primers 5'-CCCTGTGGGCCAAGAGGTAA-3' and 5'-CATTGGCATCAGAGCTGGTG-3' match both mouse Col4a3 and human COL4A3 sequences and were shown to allow 100% PCR efficiency in both species; and 3) primers 5'-CACAGTCAGACGGACCAGGAG-3' and 5'-GCTGACATAGGGGCGGATCG-3' amplify human COL4A4 cDNA but not mouse Col4a4. Individual samples were standardized by measuring the amount of mouse Gapdh RNA (primers 5'-ATTCAACGGCACAGTCAAGG-3' and 5'-TGGATGCAGGGATGATGTTC-3') or human GAPDH RNA (primers 5'-ATTCCATGGCACCGTCAAGGC-3' and 5'-TAGAGGCAGGGATGATGTTC-3'). Each sample was tested twice in each run, and the derived normalized values were the average of three runs.

Histology and Immunohistochemistry

Specimens used for histology were fixed in Dubosq-Brazil or formalin and dehydrated before embedding. Specimens used for immunofluorescence were snap-frozen in liquid nitrogen using CRYO-M-BED (Bright, Huntington, UK). Immunofluorescence labeling was performed as in Heidet and colleagues,14 except for Goodpasture antibodies, which required longer incubation (15 hours) with the cryostat sections under native conditions. For antibodies recognizing cryptic epitopes (as indicated in Table 1 ), the sections were pretreated with 6 mol/L of urea in 0.1 mol/L of glycine buffer, pH 3.5, for 10 minutes, then rinsed with distilled water. A Mouse to Mouse (M.O.M.) (Vector Laboratory, Burlingame, CA) immunodetection kit was used for localization of mouse primary antibodies. Tissue sections incubated with the appropriate preimmune serum or directly with the secondary antibodies served as control. Labeling was examined with a Leitz Orthoplan microscope equipped for light, fluorescence and phase contrast microscopy (Leica Microscopic Systems, Heezbrugg, Switzerland).


View this table:
[in this window]
[in a new window]
  		Table 1. Properties of Anti-Collagen IV mAbs Used in This Study

 
Antibodies

Affinity-purified antibodies recognizing human and mouse [({alpha}1)2{alpha}2] collagen IV protomers, raised against pepsin-digested human placenta type IV collagen, were obtained from Novotec (Lyon, France). Anti-type IV collagen monoclonal antibodies (mAbs) used in this work are described in Table 1 . Several new mAbs were characterized for this study; their chain and species specificity was determined by comparing their pattern of reactivity in enzyme-linked immunosorbent assay, immunoblotting, and/or immunofluorescence staining to that of mAbs with known specificity. In particular, the availability of species-specific mAbs was critical for this work: mAbs RH34 and RH45 specifically recognized human {alpha}3(IV) and {alpha}4(IV) chains, respectively, whereas mAb a11 recognized the murine {alpha}4(IV). Human Goodpasture autoantibodies were affinity-purified from patient sera30 and used at concentration of ~2 µg/ml. Antibodies directed against laminin chains {alpha}1, ß1, and {gamma}1, perlecan, and entactin were from Chemicon (Temecula, CA). Antibodies against fibronectin and agrin were from Novotec and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Antibodies directed against the {alpha}2 and the {alpha}5 chains of laminin were kind gifts from P. Yurchenko (Department of Pathology and Laboratory Medicine, Robert Wood Johnson Medical School, Piscataway, NJ) and J. Miner (Department of Medicine, Washington University School of Medicine, St. Louis, MO), respectively.

Electron Microscopy

Kidneys from 2-month-old mice were fixed in 2.5% glutaraldehyde/0.2 mol/L cacodylate buffer/phosphate-buffered saline (pH 7.4) for 24 hours at 4°C, postfixed in 2% osmium tetraoxide for 1 hour at room temperature, and processed for electron microscopy as described.31

Analysis of Type IV Collagen from BMs by Immunoprecipitation and Immunoblotting

Basement membranes were prepared from homogenized mouse tissues, using the detergent extraction method, as described.32 The insoluble component, containing type IV collagen networks, was twice digested with bacterial collagenase, for 24 hours at 37°C, using 200 µg/g of wet tissue. The identity of NC1 domains present in the solubilized fraction was determined by immunoblotting with chain-specific mAbs (as indicated in Table 1 ), after separation by SDS-PAGE in 6 to 22% polyacrylamide gradient gels and transfer onto Immobilon-P membranes (Millipore, Bedford, MA). Association of NC1 domains into NC1 hexamers was determined by analyzing the composition of fractions separated by affinity chromatography on immobilized anti-NC1 mAbs or by immunoprecipitation, as described.1,2,32


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Generation of a Transgenic Mouse Line Carrying the Human COL4A3 and COL4A4 Genes, onto a Wild-Type (TG/Col4a3+/+) or a Col4a3-Null Background (TG/Col4a3-/-)

The YAC 870_B6 was characterized by PCR, Southern blot, and pulsed-field gel electrophoresis restriction mapping, using COL4A3-COL4A4 cDNA and YAC end probes. The clone was shown to be 850 kb in length, to contain all of the COL4A3-COL4A4 exons and all human-specific EcoRI and PstI fragments. Pulsed-field gel electrophoresis analysis mapped the 3'-end of COL4A3 110 kb from the right (noncentromeric) arm of the YAC. This was subsequently confirmed by localization of the YAC end sequences in the human chromosome 2 working draft sequence (NT_005403). To facilitate DNA manipulation, the YAC 870_B6 was truncated 42 kb downstream of COL4A4 exon 48, by homologous recombination in yeast. The resulting clone was ~450 kb in length, contained both COL4A3 and COL4A4 genes, 42 kb downstream of COL4A4 and 110 kb downstream of COL4A3.

Injection of gel-purified YAC DNA into fertilized mouse oocytes yielded one transgenic mouse carrying human {alpha}3(IV) and {alpha}4(IV) collagen genes. To investigate the integrity of the integrated construct, EcoRI- and PstI-digested DNA from transgenic offspring was analyzed by Southern blot. Hybridization with overlapping human probes covering both COL4A3 and COL4A4 cDNAs showed the presence of all human restriction fragments (not shown). A total of 20 metaphase cells were analyzed by fluorescence in situ hybridization and in each of them, 100% of the cells showed a similar fluorescent signal on the subdistal part of a chromosome 16. No other significant hybridization signals were noted, indicating that the YAC had integrated into one site in the mouse genome. As multiple copies of a transgene usually integrate as a tandem array, individual copies of the YAC should be separated by 450 kb of DNA, a distance distinguishable by fluorescence in situ hybridization analysis on interphase chromatin. A single signal was detected, highly suggesting that a single copy of the transgene was present in this line of mice.

Transgenic mice were intercrossed, and mice carrying one (TG+/-) or two (TG+/+) copies of the transgenic allele were distinguished by real-time PCR. To generate mice carrying the human transgene on a Col4a3-/- background, TG+/- mice were crossed with Col4a3 +/- mice. Offspring heterozygous for both the transgene and the Col4a3 disrupted allele (TG+/-Col4a3+/-) were subsequently intercrossed.

Expression of Human COL4A3 and COL4A4 Transcripts in Transgenic Mouse Kidneys

Real-time PCR showed a level of transcription of human COL4A3 and COL4A4 in TG+/-Col4a3+/+ mouse kidney (n = 3) that was 9.5% (range, 7.3 to 12.1%) and 10.2% (range, 8.6 to 11.3%), respectively, of the level of transcription of the genes observed in human kidney. In TG+/+Col4a3+/+ (n = 2) mice, the level of transcription rose to 17.5% (range, 16.4 to 18.5%) for COL4A3 and 19.7% (range, 18.7 to 20.8%) for COL4A4. Using primers amplifying equally human and mouse cDNAs, the overall expression of {alpha}3(IV) transcripts in TG+/+Col4a3+/+ mice was found to be 124% (range, 111 to 137%) of that of wild-type (Col4a3+/+) mouse kidney. The human genes were expressed at comparable levels onto a Col4a3-null background: TG+/-Col4a3-/- mice (n = 2) expressed COL4A3 at 9.5% (range, 8.2 to 10.8%) and COL4A4 at 13.1% (range, 12.1 to 14.1%) of the levels found in the human kidney, whereas the respective levels in TG+/+Col4a3-/- mice (n = 6) rose to 21% (range, 16 to 25.7%) and 22.9% (range, 21 to 28.6%). By comparison to the expression of Col4a3 in wild-type (Col4a3+/+) mice, expression of COL4A3 in transgenic mice was 11.5% (range, 11 to 12%) in TG+/-Col4a3-/- mice and 18.2% (range, 16.1 to 20.4%) in TG+/+Col4a3-/- mice.

Rescue of the Renal Function and Morphology in Col4a3-/- Mice by the Human COL4A3-COL4A4 Transgene

Clinical Phenotype

Animals carrying the transgene onto a wild-type background (TG/Col4a3+/+) were fertile and displayed normal survival. They showed no hematuria/proteinuria with a follow-up of 6 months, and their renal function was normal by comparison with nontransgenic littermates (not shown). In contrast, the transgene had a dramatic effect on the Col4a3-/- mice, which display an Alport-like phenotype. As previously described,16 Col4a3-/- mice lacking the transgene (n = 16) presented with microhematuria as early as 10 days of age, while proteinuria appeared approximately at 30 days of life and persisted until end-stage renal disease. They began to lose weight at ~2 months of age, became lethargic, and died at 65.6 ± 2.2 days with severe renal failure; blood urea nitrogen and creatinine levels were 109.5 ± 26.7 mmol/L and 120.6 ± 24.5 µmol/L, respectively. By contrast, both TG+/-Col4a3-/- and TG+/+Col4a3-/- mice were clinically undistinguishable from wild-type mice or mice hemizygous for Col4a3. Urine analysis from 2-month-old TG+/-Col4a3-/- mice showed no hematuria or proteinuria (Figure 1) . Their renal function was tested at 30 days (n = 7), 60 days (n = 2), 90 days (n = 2), 150 days (n = 5), and 180 days (n = 3). Blood urea nitrogen and creatinine levels were comparable to those of wild-type mice (8.7 ± 0.9 mmol/L and 29 ± 3.1 µmol/L, respectively).



View larger version (78K):
[in this window]
[in a new window]
  		Figure 1. SDS-PAGE analysis of proteinuria. Lanes 1 to 4: Bovine serum albumin: 0.5, 1, 5, and 10 µg; lane 5: 8-week-old Col4a3-/- mouse; lane 6: 8-week-old Col4a3+/+ (wild-type control) littermate; lane 7: 8-week-old TG/Col4a3-/- littermate. Heavy albuminuria was observed in Col4a3-/- mice, but not in TG/Col4a3-/-.

 
Renal Morphology

Animals carrying the transgene onto a wild-type background display normal kidney histology (not shown). As previously reported,16 kidneys of Col4a3-/- mice at the time of death showed severe abnormalities affecting both glomeruli and tubulointerstitium (Figure 2a) . Histology of the kidney of TG+/-Col4a3-/- and TG+/+Col4a3-/- littermates (n = 4) resembled that of wild-type mice, (Figure 2b) . By electron microscopy, compared with wild-type mice (Figure 2c) , extensive alteration of the GBM typical of Alport syndrome was observed in Col4a3-/- mice (Figure 2d) . Effacement of epithelial foot processes and formation of microvilli were commonly associated. Irregular thickening of the proximal and distal tubular basement membrane (TBM) and interstitial fibrosis were also seen. In contrast, most GBM in TG+/-Col4a3-/- littermate had a normal thickness and structure (Figure 2e) , except for focal thickening and splitting of rare GBM segments. Podocyte foot processes were preserved and TBMs were normal.



View larger version (193K):
[in this window]
[in a new window]
  		Figure 2. Comparative histology of Col4a3-/- (a) and TG/Col4a3-/- littermate (b) mice at 8 weeks of age. Severe lesions, including glomerular sclerosis, glomerular crescents, tubular dilatations, and interstitial fibrosis were evident in the Col4a3-/- mouse kidneys, whereas the renal morphology was preserved in the TG/Col4a3-/- mice (trichrome light green stain). c to e: Electron microscopy of 8-week-old mice: Col4a3+/+ mouse (c); Col4a3-/- mouse (d); and TG/Col4a3-/- littermate (e). In the Col4a3+/+ mouse, the GBM was globally regular, except for some very focal thickening (arrow). Foot processes were normal. In the Col4a3-/- mouse, an irregular thickening of the GBM with focal loss of foot processes was observed. In the TG/Col4a3-/- mouse, the normal structure of the GBM and the foot processes were preserved, albeit very focal thickening of the GBM was observed (arrow). Original magnifications: x200 (a); x400 (b); x4350 (c); x4800 (d); x4500 (e).

 
Expression of Collagen IV Chains and Networks in the Renal Basement Membranes of Transgenic Mice

Immunofluorescence Analysis of Collagen IV Chains

Expression of murine and human collagen IV chains in the kidney BMs of transgenic mice was evaluated by indirect immunofluorescence using chain- and species-specific mAbs. Using antibodies that recognize both human and mouse type IV collagen chains, TG/Col4a3+/+ mouse kidneys display the same pattern as previously described in control mouse kidneys:16,33 the {alpha}3, {alpha}4, and {alpha}5(IV) collagen chains were found consistently co-expressed in the GBM, as well as in the proximal and distal tubules BMs, and {alpha}5(IV) was also present in the Bowman capsule BM. Using monoclonal antibodies that recognize the human but not the murine {alpha}3 and {alpha}4(IV) chains (RH34 and RH45, respectively), a faint staining was observed in the GBM and focally in segments of distal TBM, at the vascular pole of the glomerulus, reminiscent of the human pattern of expression of these chains (Figure 3) .7



View larger version (52K):
[in this window]
[in a new window]
  		Figure 3. Immunohistological analysis of human Col4a3+/+ mouse (middle) and TG/Col4a3+/+ mouse (right) kidneys using antibodies recognizing human (Hu) {alpha}3 and {alpha}4(IV) chains. Antibodies strongly stained the human GBM and distal tubule BM, but did not label wild-type Col4a3+/+ control mouse BMs. A discrete GBM and focal TBM labeling was observed in TG/Col4a3+/+ mice.

 
In TG/Col4a3-/- mice, the GBM staining for the human chains was more intense than in TG/Col4a3+/+ mice, albeit less intense than in the human GBM. Again, the {alpha}3 and {alpha}4(IV) chains were expressed in a human-like pattern (Figure 4) . Interestingly, the mouse {alpha}4 and {alpha}5(IV) chains (recognized by mAbs a11 and H53, respectively), absent [except focally in the Bowman capsule for {alpha}5(IV) chain] in the kidneys of Col4a3-/- mice, were re-expressed along with the human {alpha}3(IV) and {alpha}4(IV) in the GBM and small segments of the TBM in TG/Col4a3-/- mice. The GBM of the TG/Col4a3-/- mice was also clearly labeled with mAb 26-20, an antibody to native {alpha}3/{alpha}4/{alpha}5(IV) NC1 containing hexamers, demonstrating a co-assembly of the human and mouse chains in hexamers. In contrast to the strong GBM expression of the {alpha}1 and {alpha}2(IV) chains in Alport mice, a normal glomerular distribution of these chains was observed in TG/Col4a3+/+ (not shown) and TG/Col4a3-/- mice (Figure 4) .



View larger version (95K):
[in this window]
[in a new window]
  		Figure 4. Immunohistological analysis of Col4a3+/+ mouse (left), Col4a3-/- mouse (middle), and TG/Col4a3-/- mouse (right) kidneys using antibodies recognizing human (Hu) and mouse (Ms) {alpha}1.{alpha}2(IV), human and mouse {alpha}3(IV), human and mouse {alpha}4(IV), human {alpha}3(IV), human {alpha}4(IV), mouse {alpha}4(IV), mouse {alpha}5(IV), and human and mouse {alpha}3/{alpha}4/{alpha}5(IV) containing native hexamers. The human {alpha}3-{alpha}4(IV) were expressed in the TG/Col4a3-/- mouse GBM, but not in TBM. The mouse {alpha}4(IV) and {alpha}5(IV) chains were expressed in GBM and TBM in Col4a3+/+ mice, but were absent in all renal BM [except focally in the Bowman capsule for {alpha}5(IV)] in Col4a3-/- mice, and were expressed, along with human {alpha}3 and {alpha}4(IV), in the GBM in TG/Col4a3-/- mice.

 
Immunoblotting Analysis of Collagen IV Chains

Expression of the collagen IV chains in the murine kidneys was further analyzed by determining the composition of NC1 hexamers solubilized from mouse kidney BMs by collagenase digestion. NC1 hexamers were resolved into their constituent monomers and dimers by SDS-PAGE, then immunoblotted with mAbs specific for {alpha}1-{alpha}5(IV) chains (Figure 5) . The results paralleled those found by immunofluorescence staining. The {alpha}1-{alpha}5(IV) chains were expressed in the renal BMs of wild-type control, TG/Col4a3+/+ and TG/Col4a3-/- mice, but the {alpha}3(IV) and {alpha}4(IV) chains were absent in the Col4a3-/- mice. Using human-specific mAbs RH34 and RH45, the presence of human {alpha}3(IV) and {alpha}4(IV) chains was clearly detected only in transgenic mice, more strongly in TG/Col4a3-/- mice, and weaker but clearly discernable in TG/Col4a3+/+ mice. For comparison, digests of renal BMs from control mice did not react with either RH34 or RH45, whereas a human GBM digest reacted strongly. Importantly, all NC1 domains were present predominantly in cross-linked form (as NC1 dimers), indicating that the human {alpha}3(IV) and {alpha}4(IV) collagen chains, like all other chains, assemble into cross-linked networks in the renal BMs in vivo. For all chains, including the human transgenes, the relative proportion of NC1 monomers to NC1 dimers was lower in mouse renal BMs than in human GBM, suggesting more efficient cross-linking of collagen IV protomers into networks in the murine BMs.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 5. Western blot analysis of collagen IV chain expression in the kidneys of Col4a3+/+ and Col4a3-/- mice, in the presence or absence of the human transgene (TG). Collagenase-solubilized NC1 hexamers from murine renal BMs were resolved by SDS-PAGE into component NC1 monomers (M) and dimers (D), transferred to PVDF membranes, and immunoblotted with chain-specific mAbs recognizing both human and murine NC1 domains ({alpha}1 to {alpha}5), as well as with mAbs specific for human {alpha}3 and {alpha}4(IV) NC1 domains (Hu {alpha}3, Hu {alpha}4). Human GBM hexamers were used as positive control.

 
Immunoaffinity Fractionation Analysis of Collagen IV Networks

Separation of the NC1 hexamers using chain-specific mAbs provided further information about the network organization of murine {alpha}(IV) collagen chains in wild-type (Col4a3+/+) and in TG+/+/Col4a3-/- mice. Using renal BMs from wild-type mice, mAb 26-20, recognizing native hexamers containing {alpha}3/{alpha}4/{alpha}5, bound hexamers composed of {alpha}1-{alpha}5(IV) NC1 domains (Figure 6) . This indicates that the murine {alpha}3 and {alpha}4(IV) chains exist not only in association with {alpha}5(IV) chain, but also with the {alpha}1 and {alpha}2(IV) chains. Hexamers not bound to mAb 26-20 were composed of {alpha}1, {alpha}2, and {alpha}5(IV) NC1 domains, likely representing a mixture of {alpha}1{alpha}2(IV) hexamers and {alpha}5-containing hexamers. Co-assembly of murine {alpha}1-{alpha}5(IV) chains was also demonstrated using mAb 15-47 (to {alpha}1-containing hexamers), which bound all {alpha}1 and {alpha}2(IV) NC1 domains along with a large proportion of {alpha}3-{alpha}5(IV) NC1 domains. A small amount of hexamers was not bound to mAb 15-47 and contained only the {alpha}3, {alpha}4, and {alpha}5(IV) NC1 domains, indicating the existence of {alpha}3.{alpha}4.{alpha}5(IV) hexamers. These results, together with the localization by immunofluorescence staining, indicate that murine {alpha}3-{alpha}5(IV) chains are co-deposited into both the GBM and the TBMs of wild-type mouse kidneys and occur both in an {alpha}3.{alpha}4.{alpha}5(IV) network (likely similar to that recently described in the human GBM), as well as in a distinct {alpha}1-{alpha}5(IV) network. The {alpha}1-{alpha}5(IV) network must be composed of dissimilar protomers, most likely of {alpha}3{alpha}4{alpha}5(IV) protomers interacting with ({alpha}1)2{alpha}2(IV) protomers via their respective NC1 domains. The relative distributions of the murine {alpha}3.{alpha}4.{alpha}5(IV) and {alpha}1-{alpha}5(IV) networks between the GBM and TBMs could not be ascertained from the present study because total renal BM were used for the biochemical analysis.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 6. Affinity fractionation of murine NC1 hexamers from Col4a3+/+ mice (top) and TG/Col4a3-/- mice (bottom), using mAb 26-20 [which bound hexamers containing {alpha}3/{alpha}4/{alpha}5(IV) NC1 domains] and mAb 15-47 [which bound hexamers containing {alpha}1(IV) NC1 domain]. The composition of the NC1 hexamer fractions bound or not bound to the immobilized mAbs was analyzed by Western blot with chain-specific mAbs recognizing both human and murine NC1 domains ({alpha}1 to {alpha}5), as well as with mAbs specific for human {alpha}3 and {alpha}4(IV) NC1 domains (Hu {alpha}3, Hu {alpha}4).

 
Analysis of the kidney BMs from the TG+/+/Col4a3-/- mice with mAb 26-20 and mAb 15-47 yielded similar results (Figure 6) . Both mAbs bound the human {alpha}3 and {alpha}4(IV) NC1 domains along with murine {alpha}1, {alpha}2, and {alpha}5(IV) NC1 domains, indicating that human {alpha}3 and {alpha}4(IV) chains co-assemble with the murine chains into a hybrid {alpha}1-{alpha}5(IV) collagen network. Co-assembly of the {alpha}3, {alpha}4, and {alpha}5(IV) chains into the same protomers and networks was further confirmed by co-precipitation of {alpha}3-{alpha}5 NC1 domains by other chain-specific mAbs: Mab3 to {alpha}3(IV), RH42 to {alpha}4(IV), mAb b14 to {alpha}5(IV), and mAb a11 to mouse {alpha}4(IV) (data not shown). Based on the findings of immunofluorescence staining, the hybrid {alpha}1-{alpha}5(IV) network occurs in the kidneys of TG/Col4a3-/- mice in the GBM and focally in distal TBMs.

Expression of Other Extracellular Matrix Proteins in the Kidney of TG/Col4a3-/- Mice

The expression of laminin chains, heparan sulfate proteoglycan, nidogen, and fibronectin was studied in Col4a3-/-, TG+/-Col4a3-/-, and wild-type mice, at 2 months of age (Figure 7) . None of the changes in the distribution of noncollagenous extracellular matrix proteins observed in Col4a3-/- mice were detected in TG+/-Col4a3-/- animals. In short, fibronectin; laminin {alpha}2, ß1, and {gamma}1 chains; and perlecan, which normally have a restricted mesangial distribution in the glomerulus, were strongly expressed in the GBM in Col4a3-/- mice, as previously reported.16,34,35 In contrast, in the TG+/-Col4a3-/- animals, normal mesangial expression of these antigens was observed. No significant changes in the distribution of proteins normally expressed in the GBM (laminin {alpha}5 chain, entactin, and agrin) were detected in either Col4a3-/- or TG+/-Col4a3-/- mice, compared to controls.



View larger version (110K):
[in this window]
[in a new window]
  		Figure 7. Immunohistological analysis of kidneys from Col4a3+/+ mice (left), Col4a3-/- mice (middle), and TG/Col4a3-/- mice (right) using antibodies recognizing mouse {alpha}2 ({alpha}2LN), ß1 (ß1LN), and {gamma}1 ({gamma}1 LN) laminin chains, perlecan, and fibronectin (FN). These proteins are mainly expressed in the mesangium of control Col4a3+/+ mice, but strongly stained in the GBM of Col4a3-/- mice. In TG/Col4a3-/- mice, the expression is comparable to control Col4a3+/+ mice.

 
Expression of Collagen IV Chains and Networks in Extra-Renal BMs

To determine whether regulatory elements in the human transgene can control their tissue-specific expression in mice, we compared transgenic mice and wild-type controls with regard to the collagen IV chain composition of extra-renal BMs. Consistent with previous immunohistochemical localization studies36,37 in control wild-type mice, the {alpha}3(IV) and {alpha}4(IV) chains were expressed in lung BMs (along with {alpha}5(IV) chain), but not in the bladder BMs. The same expression pattern was found in TG/col4a3-/- mice; further analysis of their lung BMs with human-specific mAbs confirmed the presence of human {alpha}3 and {alpha}4(IV) chains (Figure 8) . Together with the findings in renal BMs, these results indicate that expression of the COL4A3-COL4A4 transgene is tissue-restricted and occurs only in BMs that normally express the {alpha}3(IV) and {alpha}4(IV) collagen chains.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 8. Western blot analysis of collagen IV chain expression in the extrarenal BMs of Col4a3+/+ and TG/Col4a3-/- mice. Collagenase-solubilized NC1 hexamers from murine lung and bladder BMs were resolved by SDS-PAGE into component NC1 monomers (M) and dimers (D), transferred to PVDF membranes, and were immunoblotted with chain-specific mAbs recognizing both human and murine NC1 domains ({alpha}1 to {alpha}5), as well as mAbs specific for human {alpha}3 and {alpha}4(IV) NC1 domains (Hu {alpha}3, Hu {alpha}4).

 
Human Goodpasture Autoantibodies Bind to the GBM of Col4a3-/- Transgenic Mice

Because the human {alpha}3(IV) collagen chain is the Goodpasture (GP) autoantigen,38 the TG/Col4a3-/- mouse may be uniquely suited to study in vivo the interaction between human GP autoantibodies and the GP autoantigen. To explore the feasibility of these studies, we compared the binding of GP autoantibodies to human, Col4a3+/+, Col4a3-/-, and Tg/Col4a3-/- mouse GBM by indirect immunofluorescence (Figure 9 , top). Under native conditions, GP antibodies stained human GBM and TG/Col4a3-/- mouse GBM, but not the wild-type nor the Col4a3-/- mouse GBM. Surprisingly, only podocytes were labeled in wild-type mice, suggesting that the GP epitopes are completely inaccessible to autoantibodies in the native murine GBM and TBM networks. Indeed, GP antibodies produced the expected GBM and TBM pattern of {alpha}3(IV) expression after the wild-type mouse kidney sections were treated with acid urea to expose the cryptic epitopes. Furthermore, by enzyme-linked immunosorbent assay (Figure 9 , bottom), native NC1 hexamers from human GBM and mouse kidneys exhibited ~34% and ~6.5% of the GP immunoreactivity of the respective dissociated hexamers. This indicates that GP epitopes are sequestered more tightly in mouse than in human native NC1 hexamers, and only human hexamers are capable of reacting with GP antibodies under native conditions. Because GP antibodies stain the GBM of the TG/Col4a3-/- mice under native conditions, the hybrid human-mouse {alpha}3.{alpha}4.{alpha}5(IV) network is more similar to its human than to its wild-type counterpart with regard to the accessibility of GP epitopes.



View larger version (53K):
[in this window]
[in a new window]
  		Figure 9. Top: Indirect immunofluorescence staining with Goodpasture autoantibodies of native (A–E) and acid urea-treated (F) kidney sections. The sections were from Col4a3-/- mouse (A), human (B), TG/Col4a3-/- mouse (C), and Col4a3+/+ mouse (D–F). Under native conditions, antibodies bound in a linear manner to human and TG/Col4a3-/- mouse GBM but not to Col4a3+/+ mouse GBM. In Col4a3+/+ mice, only podocytes were clearly labeled under native conditions, whereas GBM and TBM were stained after acid urea treatment. Bottom: The reactivities with Goodpasture antibodies of native (solid bars) and dissociated (open bars) NC1 hexamers from human GBM and mouse kidneys were compared by enzyme-linked immunosorbent assay. Under native conditions, the Goodpasture epitopes were much less accessible in the murine than in the human NC1 hexamers, consistent with the results of immunofluorescence staining.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
The GBM is an essential component of the glomerular capillary wall, which is responsible for plasma ultrafiltration during primary urine formation. The mature GBM mainly contains an {alpha}3.{alpha}4.{alpha}5(IV) collagen network that is required for the long-term maintenance of the glomerular filtration function11 but which is absent in the majority of the patients affected with Alport syndrome.10 Several lines of evidence suggest that the absence of the whole {alpha}3.{alpha}4.{alpha}5(IV) network in most Alport patients, even though only one chain is mutated, is because of a posttranslational co-regulation of the expression of these three chains, which either prevents the assembly of the {alpha}3.{alpha}4.{alpha}5 protomers, or produces defective protomers that are degraded or unable to assemble into supramolecular network.1,2,14-16

Alport syndrome progresses slowly but inexorably toward end-stage renal failure, requiring dialysis or transplantation. Any therapeutic approach aimed at correcting the underlying defect in Alport patients by restoring the mutated chain is highly desirable. The feasibility of gene therapy in Alport syndrome in the future is suggested by recent data showing expression of a recombinant {alpha}5(IV) within the GBM chain after in vivo kidney perfusion in a pig model.39 However, neither in vitro nor in vivo studies have so far addressed the question of whether the re-expression of the mutated chain in its wild-type form will correct the defect in the assembly of collagen IV protomers and networks in the GBM. In addition, very little is known regarding the level of type IV collagen that is required for making a functional BM.

In the present study, we generated a transgenic line of mice carrying the human COL4A3-COL4A4 genomic locus. We used YAC because 1) type IV collagen genes are large;17,22 2) these genes are alternatively spliced;40,41 and 3) the transcriptional regulation of these genes is complex and implies regulatory elements located in introns.42,43 We used the human genes to distinguish between the transgenic and natively expressed chains by using species-specific antibodies. The expression of transgenic type IV collagen was studied both onto a wild-type and a Col4a3-/- mouse background. The level of transcription of the human genes in mice carrying two copies of the transgene on either background was found to be ~20% of the level of transcription observed in the human kidney or in the wild-type (Col4a3+/+) mouse kidney. This low level of expression might be because of differences between COL4A3-COL4A4 and Col4a3-Col4a4 loci, and mouse-specific regulatory factors may act less efficiently on the human transgene. Alternatively, cis-elements required for full expression of the genes might not be included in our 450-kb YAC. Finally, although YAC transgenesis is thought to overcome, in part, position effects related to the integration site, we cannot rule out the hypothesis of a low level of expression caused by a positional effect. The study of the overall level of transcription {alpha}3(IV) in transgenic mice onto a wild-type and a Col4a3-null background suggests that the level of transcription of Col4a3 gene does not modify the level of transcription of the transgene, and vice versa. In this model, up-regulation of the glomerular expression of the {alpha}3 and {alpha}4(IV) does not seem to be deleterious.

In the transgenic mice, the human {alpha}3 and {alpha}4(IV) chains were found to be expressed in lung and kidney but not in bladder BMs, suggesting that the genomic sequences included in our construct are able to direct the correct tissue-specific expression of the genes. Moreover, the human {alpha}3 and {alpha}4(IV) chains were expressed only in the GBM and distal TBM of transgenic mice. This distribution, similar to the expression pattern in human kidneys, contrasts with that observed in wild-type mice, in which {alpha}3 and {alpha}4(IV) are present in all TBMs as well as in the GBM.33 These results indicate that the differences between the human and the rodent pattern of expression of type IV collagen chains in the kidney are probably transcriptional and because of cis-regulatory elements carried by the transgene, rather than to factors acting in trans that could have been differentially expressed in the two species.

Whereas the mouse {alpha}4(IV) and {alpha}5(IV) chains were consistently absent in the GBM and TBM of Col4a3-/- mice, they were re-expressed in TG/Col4a3-/- mice, along with the human {alpha}3 and {alpha}4(IV) chains, specifically in the GBM. We show that the human chains co-assembled with the mouse {alpha}4 and {alpha}5(IV) chains, into a hybrid collagen IV network in the mouse GBM. Thus, correction of {alpha}3(IV) expression by the human transgene rescues the expression of the mouse {alpha}4(IV) and {alpha}5(IV), specifically at sites where the human {alpha}3(IV) was expressed, emphasizing the need of all three chains for making an appropriate network and a functional GBM. A similar correction of the glomerular type IV collagen networks may be expected, ultimately, from gene therapy.

Despite a relatively low level of expression, the assembly of human {alpha}3 and {alpha}4(IV) chains in an hybrid collagen network in the GBM was able to rescue the Alport phenotype in Col4a3-/- mice. Furthermore, despite the absence of {alpha}3.{alpha}4.{alpha}5(IV) collagen, the ultrastructural aspect of the proximal TBM in TG/Col4a3-/- mice was normal, suggesting that the TBM expression of the {alpha}3.{alpha}4.{alpha}5(IV) network in mouse is not critical and that severe tubular changes observed in Col4a3-/- mice are not directly linked to the TBM defect, but could be the consequence of persistent proteinuria. This observation is of importance because severe tubulointerstitial lesions also develop in Alport syndrome patients lacking the {alpha}3{alpha}4{alpha}5(IV) chains in the distal tubules. Glomerular gene delivery correcting the GBM collagen IV network could prevent the progressive tubulointerstitial damage in Alport syndrome kidneys.

In Col4a3-/- mice, deposition within the GBM of BM-associated proteins that are normally expressed in the mesangial matrix might play a role in the progression of the disease.16,35 It was shown recently that mRNAs encoding these extracellular proteins were significantly elevated in the podocytes, suggesting that a change in gene expression in these cells results in elevated synthesis and deposition of extracellular matrix in the GBM of Col4a3-/- mice.44 In the TG/Col4a3-/- mice that we report here, the pattern of expression of {alpha}2 and ß1 laminin, heparan sulfate proteoglycans, and fibronectin was normal. Altogether, these data suggest that even a relatively low level of expression of the missing {alpha}3(IV) collagen chain is sufficient for restoring the structural and functional integrity of the GBM and for proper phenotypic differentiation of podocyte cells abutting the GBM. Whether such a low expression will be sufficient for long-term stability of the GBM remains to be determined by a longer follow-up. Indeed, despite the absence of renal symptoms, the normal appearance of the GBM by light microscopy, the normal distribution of other matrix proteins and the normal architecture of the podocyte foot processes, ultrastructural GBM lesions were focally observed in TG/Col4a3-/- mice. It is likely that the focal defects are because of the relatively low levels of {alpha}3.{alpha}4.{alpha}5(IV) expression, and may suggest a risk for late progression of the renal disease. Indeed, the character of the lesions is reminiscent of that seen in some individuals carrying heterozygous COL4A3 or COL4A4 mutations. Those patients mostly present with benign hematuria and thin GBM, but can also develop nephropathies of variable severity with focal splitting of the GBM.22

Finally, the mouse model we report here may provide an ideal model for studying the pathogenesis of Goodpasture (GP) syndrome, an autoimmune disease caused by antibodies against the {alpha}3(IV) collagen chain. The two major GP epitopes, mapped to two regions of the human {alpha}3(IV) NC1 domain,45 are conformational and normally sequestered within the {alpha}3(IV)-containing hexamers of the native GBM,30 but how pathogenic antibodies gain access to these cryptic epitopes is not known. Binding of human GP antibodies to the native GBM of TG/Col4a3-/- (but not wild-type) mice suggests that the quaternary organization of the GP epitopes in the hybrid human-mouse GBM network resembles that found in the human GBM network, and that transgenic mice may be susceptible to passive transfer of anti-GBM nephritis by human GP antibodies. The line of mice we report here may lead, along with transgenic lines humanized for MHC molecules and/or human immunoglobulins,46,47 to the development of new mouse models that very closely resemble the human GP disease at the molecular level. This may provide new means to decipher early pathogenic events implicated in the human GP syndrome, and to test specific therapies.


   Acknowledgements
 
We thank Brendan Doe for the management of the animal facility; Parvin Todd and Selene Colon for technical assistance; and P. Yurchenko and J. Miner for the generous gifts of laminin {alpha}2 and {alpha}5 antibodies, respectively.


   Footnotes
 
Address reprint requests to Dr. Laurence Heidet, INSERM U574, Tour Lavoisier 6ème étage, Hôpital Necker-Enfants Malades, 75743 Paris Cedex 15, France. E-mail: heidet{at}necker.fr

Supported by the Association pour l’Utilisation du Rein Artificiel, the Association pour la Recherche sur le Cancer, the European Commission (grant ERB4001GT965833 to L. H.), the National Institutes of Health (grants R37 DK18381 to B. G. H. and P01 DK65123 to D. B. B.), and the 2003 Carl Gottschalk Research Scholar Award from the American Society of Nephrology (to D. B. B.).

Accepted for publication July 3, 2003.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Boutaud A, Borza DB, Bondar O, Gunwar S, Netzer KO, Singh N, Ninomiya Y, Sado Y, Noelken ME, Hudson BG: Type IV collagen of the glomerular basement membrane. Evidence that the chain specificity of network assembly is encoded by the noncollagenous NC1 domains. J Biol Chem 2000, 275:30716-30724[Abstract/Free Full Text]
  2. Borza DB, Bondar O, Todd P, Sundaramoorthy M, Sado Y, Ninomiya Y, Hudson BG: Quaternary organization of the Goodpasture autoantigen, the alpha 3(IV) collagen chain: sequestration of two cryptic autoepitopes by intra-protomer interactions with the alpha 4 and alpha 5 NC1 domains. J Biol Chem 2002, 277:40075-40083[Abstract/Free Full Text]
  3. Timpl R, Wiedemann H, van Delden V, Furthmayr H, Kuhn KA: Network model for the organization of type IV collagen molecules in basement membranes. Eur J Biochem 1981, 120:203-211[Medline]
  4. Yurchenco PD, Furthmayr H: Self-assembly of basement membrane collagen. Biochemistry 1984, 23:1839-1850[Medline]
  5. Gunwar S, Ballester F, Noelken ME, Sado Y, Ninomiya Y, Hudson BG: Glomerular basement membrane. Identification of a novel disulfide-cross-linked network of alpha3, alpha4, and alpha5 chains of type IV collagen and its implications for the pathogenesis of Alport syndrome. J Biol Chem 1998, 273:8767-8775[Abstract/Free Full Text]
  6. Kleppel MM, Santi PA, Cameron JD, Wieslander J, Michael AF: Human tissue distribution of novel basement membrane collagen. Am J Pathol 1989, 134:813-825[Abstract]
  7. Butkowski RJ, Wieslander J, Kleppel M, Michael AF, Fish AJ: Basement membrane collagen in the kidney: regional localization of novel chains related to collagen IV. Kidney Int 1989, 35:1195-1202[Medline]
  8. Hellmark T, Segelmark M, Wieslander J: Anti-GBM antibodies in Goodpasture syndrome; anatomy of an epitope. Nephrol Dial Transplant 1997, 12:646-648[Free Full Text]
  9. Borza DB, Hudson BG: Molecular characterization of the target antigens of anti-GBM antibody disease. Springer Semin Immunopathol 2003, 4:345-361
  10. Gubler MC, Antignac C, Deschênes G, Knebelmann B, Hors-Cayla MC, Grunfeld JP, Broyer M, Habib R: Genetic, clinical, and morphologic heterogeneity in Alport’s syndrome. Adv Nephrol 1993, 22:15-35
  11. Kalluri R, Shield CF, Todd P, Hudson BG, Neilson EG: Isoform switching of type IV collagen is developmentally arrested in X-linked Alport syndrome leading to increased susceptibility of renal basement membranes to endoproteolysis. J Clin Invest 1997, 99:2470-2478[Medline]
  12. Thorner PS, Zheng K, Kalluri R, Jacobs R, Hudson BG: Coordinate gene expression of the alpha3, alpha4, and alpha5 chains of collagen type IV. Evidence from a canine model of X-linked nephritis with a COL4A5 gene mutation. J Biol Chem 1996, 271:13821-13828[Abstract/Free Full Text]
  13. Nakanishi K, Yoskikawa N, Iijima K, Nakamura H: Expression of type IV collagen alpha 3 and alpha 4 chain mRNA in X-linked Alport syndrome. J Am Soc Nephrol 1996, 7:938-945[Abstract]
  14. Heidet L, Cai Y, Guicharnaud L, Antignac C, Gubler MC: Glomerular expression of type IV collagen chains in normal and X-linked Alport syndrome kidneys. Am J Pathol 2000, 156:1901-1910[Abstract/Free Full Text]
  15. Miner JH, Lewis RM, Sanes JR: Molecular and functional defects in kidney of mice lacking collagen {alpha}3(IV): implications for Alport syndrome. J Cell Biol 1996, 135:1403-1413[Abstract/Free Full Text]
  16. Cosgrove D, Meehan DT, Grunkemeyer JA, Kornak JM, Sayers R, Hunter WJ, Samuelson GC: Collagen COL4A3 knock out: a mouse model for autosomal Alport syndrome. Genes Dev 1996, 10:2981-2992[Abstract/Free Full Text]
  17. Boye E, Mollet G, Forestier L, Cohen-Solal L, Heidet L, Cochat P, Grünfeld JP, Palcoux JB, Gubler MC, Antignac C: Determination of the genomic structure of the COL4A4 gene and of novel mutations causing autosomal recessive Alport syndrome. Am J Hum Genet 1998, 63:1329-1340[Medline]
  18. Cohen D, Chumakov I, Weissenbach J: A first-generation physical map of the human genome. Nature 1993, 366:698-701[Medline]
  19. Heidet L, Cohen Solal L, Boye E, Thorner P, Kemper M, David A, Larget Piet L, Zhou J, Flinter F, Xu Z, Gubler MC, Antignac C: Novel COL4A5-COL4A6 deletion in diffuse leiomyomatosis-Alport syndrome (DL-AS) locus define the DL critical region. Cytogenet Cell Genet 1997, 78:240-246[Medline]
  20. Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, Hastie ND: Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 1996, 86:71-82[Medline]
  21. Barton MC, Hoekstra MF, Emerson BM: Site-directed, recombination-mediated mutagenesis of a complex gene locus. Nucleic Acids Res 1990, 18:7349-7355[Abstract/Free Full Text]
  22. Heidet L, Arrondel C, Forestier L, Cohen Solal L, Mollet G, Guttierrez B, Stavrou C, Gubler MC, Antignac C: Structure of the human type IV collagen gene COL4A3 and mutations in autosomal Alport syndrome. J Am Soc Nephrol 2001, 12:97-106[Abstract/Free Full Text]
  23. Schedl A, Larin Z, Montoliu L, Thies E, Kelsey G, Lehrach H, Schutz G: A method for the generation of YAC transgenic mice by pronuclear microinjection. Nucleic Acids Res 1993, 21:4783-4787[Abstract/Free Full Text]
  24. Matsuda Y, Harada YN, Natsuume-Sakai S, Lee K, Shiomi T, Chapman VM: Location of the mouse complement factor H gene (cfh) by FISH analysis and replication R-banding. Cytogenet Cell Genet 1992, 61:282-285[Medline]
  25. Lemieux N, Dutrillaux B, Viegas-Péquignot E: A simple method for simultaneous R- or G-banding and fluorescence in situ hybridization of small single-copy genes. Cytogenet Cell Genet 1992, 59:311-312[Medline]
  26. Sado Y, Kagawa M, Kishiro Y, Sugihara K, Naito I, Seyer JM, Sugimoto M, Oohashi T, Ninomiya Y: Establishment by the rat lymph node method of epitope-defined monoclonal antibodies recognizing the six different alpha chains of human type IV collagen. Histochem Cell Biol 1995, 104:267-275[Medline]
  27. Wieslander J: The Goodpasture antigen. Contrib Nephrol 1990, 80:56-67[Medline]
  28. Kagawa M, Kishiro Y, Naito I, Nemoto T, Nakanishi H, Ninomiya Y, Sado Y: Epitope-defined monoclonal antibodies against type-IV collagen for diagnosis of Alport’s syndrome. Nephrol Dial Transplant 1997, 12:1238-1241[Abstract/Free Full Text]
  29. Kleppel MM, Fan WW, Cheong HI, Kashtan CE, Michael AF: Immunochemical studies of the Alport antigen. Kidney Int 1992, 41:1629-1637[Medline]
  30. Borza DB, Netzer KO, Leinonen A, Todd P, Cervera J, Saus J, Hudson BG: The Goodpasture autoantigen. Identification of multiple cryptic epitopes on the NC1 domain of the alpha3(IV) collagen chain. J Biol Chem 2000, 275:6030-6037[Abstract/Free Full Text]
  31. Cherqui S, Sevin C, Hamard G, Kalatzis V, Sich M, Pequignot MO, Gogat K, Abitbol M, Broyer M, Gubler MCG, Antignac C: Intra-lysosomal cystine accumulation in mice lacking cystinosin, the protein defective in cystinosis. Mol Cell Biol 2002, 22:7622-7632[Abstract/Free Full Text]
  32. Borza DB, Bondar O, Ninomiya Y, Sado Y, Naito I, Todd P, Hudson BG: The NC1 domain of collagen IV encodes a novel network composed of the alpha 1, alpha 2, alpha 5, and alpha 6 chains in smooth muscle basement membranes. J Biol Chem 2001, 276:28532-28540[Abstract/Free Full Text]
  33. Miner JH, Sanes J: Collagen IV {alpha}3, {alpha}4 and {alpha}5 chains in rodent basal laminae: sequence, distribution, association with laminins and developmental switches. J Cell Biol 1994, 127:879-891[Abstract/Free Full Text]
  34. Cosgrove D, Rodgers K, Meehan D, Miller C, Bovard K, Gilroy A, Gardner H, Kotelianski V, Gotwals P, Amatucci A, Kalluri R: Integrin alpha1 beta1 and transforming growth factor-beta1 play distinct roles in Alport glomerular pathogenesis and serve as dual targets for metabolic therapy. Am J Pathol 2000, 157:1649-1659[Abstract/Free Full Text]
  35. Kashtan CE, Kim Y, Lees GE, Thorner PS, Virtanen I, Miner JH: Abnormal glomerular basement membrane laminins in murine, canine, and human Alport syndrome: aberrant laminin alpha2 deposition is species independent. J Am Soc Nephrol 2001, 12:252-260[Abstract/Free Full Text]
  36. Seki T, Naito I, Oohashi T, Sado Y, Ninomiya Y: Differential expression of type IV collagen isoforms, alpha5(IV) and alpha6(IV) chains, in basement membranes surrounding smooth muscle cells. Histochem Cell Biol 1998, 110:359-366[Medline]
  37. Saito K, Naito I, Seki T, Oohashi T, Kimura E, Momota R, Kishiro Y, Sado Y, Yoshioka H, Ninomiya Y: Differential expression of mouse alpha5(IV) and alpha6(IV) collagen genes in epithelial basement membranes. J Biochem 2000, 128:427-434[Abstract/Free Full Text]
  38. Saus J, Wieslander J, Langeveld JP, Quinones S, Hudson BG: Identification of the Goodpasture antigen as the alpha 3(IV) chain of collagen IV. J Biol Chem 1988, 263:13374-13380[Abstract/Free Full Text]
  39. Heikkila P, Tibell A, Morita T, Chen Y, Wu G, Sado Y, Ninomiya Y, Petterson E, Tryggvason K: Adenovirus-mediated transfer of type IV collagen {alpha}5 chain c-DNA into swine kidney in vivo: deposition of the protein into the glomerular basement membrane. Gene Therapy 2001, 8:882-890[Medline]
  40. Bernal D, Quinones S, Saus J: The human mRNA encoding the Goodpasture antigen is alternatively spliced. J Biol Chem 1993, 268:12090-12094[Abstract/Free Full Text]
  41. Feng L, Xia Y, Wilson CB: Alternative splicing of the NC1 domain of the human alpha 3(IV) collagen gene. Differential expression of mRNA transcripts that predict three protein variants with distinct carboxyl regions. J Biol Chem 1994, 269:2342-2348[Abstract/Free Full Text]
  42. Heikkila P, Soininen R, Tryggvason K: Directional regulatory activity of cis-acting elements in the bi-directional alpha 1(IV) and alpha 2(IV) collagen gene promoter. J Biol Chem 1993, 268:24677-24682[Abstract/Free Full Text]
  43. Haniel A, Welge-Lussen U, Kuhn K, Poschl E: Identification and characterization of a novel transcriptional silencer in the human collagen type IV gene COL4A2. J Biol Chem 1995, 270:11209-11215[Abstract/Free Full Text]
  44. Sayers R, Kalluri R, Rodgers KD, Shield CF, Meehan DT, Cosgrove D: Role for transforming growth factor-beta1 in Alport renal disease progression. Kidney Int 1999, 56:1662-1673[Medline]
  45. Netzer KO, Leinonen A, Boutaud A, Borza DB, Todd P, Gunwar S, Langeveld JP, Hudson BG: The Goodpasture autoantigen. Mapping the major conformational epitope(s) of alpha3(IV) collagen to residues 17–31 and 127–141 of the NC1 domain. J Biol Chem 1999, 274:11267-11274[Abstract/Free Full Text]
  46. Cosgrove D, Gray D, Dierich A, Kaufman J, Lemeur M, Benoist C, Mathis D: Mice lacking MHC class II molecules. Cell 1991, 66:1051-1066[Medline]
  47. Meyers KE, Allen J, Gehret J, Jacobovits A, Gallo M, Neilson EG, Hopfer H, Kalluri R, Madaio MP: Human antiglomerular basement membrane autoantibody disease in XenoMouse II. Kidney Int 2002, 61:1666-1673[Medline]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
R. M. Baleato, P. L. Guthrie, M.-C. Gubler, L. K. Ashman, and S. Roselli
Deletion of Cd151 Results in a Strain-Dependent Glomerular Disease Due to Severe Alterations of the Glomerular Basement Membrane
Am. J. Pathol., October 1, 2008; 173(4): 927 - 937.
[Abstract] [Full Text] [PDF]