help button home button Am J Pathol ASIP WHAT IS IT?
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McAllister, R. D.
Right arrow Articles by Teuscher, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McAllister, R. D.
Right arrow Articles by Teuscher, C.
(American Journal of Pathology. 2003;163:1735-1741.)
© 2003 American Society for Investigative Pathology


Short Communication

Susceptibility to Anthrax Lethal Toxin Is Controlled by Three Linked Quantitative Trait Loci

Ryan D. McAllister*, Yogendra Singh{dagger}, Wendy D. du Bois{ddagger}, Michael Potter{ddagger}, Thomas Boehm§, Nathan D. Meeker, Parley D. Fillmore||, Lisa M. Anderson**, Matthew E. Poynter** and Cory Teuscher**

From Department of Microbiology,* University of Illinois, Urbana, Illinois; the Institute of Genomics and Integrative Biology,{dagger} Delhi, India; National Cancer Institute,{ddagger} National Institutes of Health, Bethesda, Maryland; Department of Developmental Immunology,§ Max Planck Institute of Immunobiology, Freiburg, Germany; Department of Pediatrics, Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania; Department of Veterinary Pathobiology,|| University of Illinois at Urbana-Champaign, Urbana, Illinois; and Department of Medicine,** University of Vermont, Burlington, Vermont


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Anthrax lethal toxin (LT) is the principal virulence factor associated with lethal pathologies following infection with Bacillus anthracis. Macrophages are the primary effector cells mediating lethality since macrophage-depleted mice are resistant to LT challenge. Recently, Ltxs1, the gene controlling differential susceptibility of murine macrophages to cytolysis following in vitro exposure to LT, was identified as Kif1c. To directly assess the in vivo role of Kif1c alleles in mortality, we studied a panel of interval-specific recombinant congenic lines carrying various segments of central chromosome 11 derived from LT-resistant DBA/2 mice on the LT-susceptible BALB/c background. The results of this study reveal that mortality is controlled by three linked quantitative trait loci (QTL): Ltxs1/Kif1c (42–43 cM), Ltxs2 (35–37 cM), and Ltxs3 (45–47 cM). The Ltxs3 interval encompasses Nos2, which is an attractive candidate gene for Ltxs3. In this regard, we demonstrate that selective, pharmacologically based inhibition of Nos2 activity in vivo partially overrides genetic resistance to LT and that Nos2 expression as determined by reverse transcription-polymerase chain reaction differs significantly between DBA/2 and BALB/c macrophages. Additionally, to recapitulate dominant resistance to mortality as seen in (BALB/c x DBA/2) F1 hybrids, DBA/2 alleles are required at all three QTL.


The gram-positive bacterium Bacillus anthracis is the causative agent of anthrax. It infects humans and animal livestock alike, producing illness and death in those infected. While the relatively benign cutaneous anthrax is the most common form of the disease, B. anthracis also causes inhalational anthrax, and even gastrointestinal anthrax, both of which generally result in death of the host. The in vivo lethal effects of infection with B. anthracis are due, in part, to an exotoxin composed of three separate proteins called protective antigen (PA), edema factor (EF), and lethal factor (LF). Both LF and EF combine with PA to form distinct variants of the A-B model of bacterial exotoxins: lethal toxin (LT) and edema toxin (ET), respectively.1 On its own, PA is nontoxic, and current research suggests PA binds a specific cell-surface receptor and translocates both EF and LF to the cytosol of host cells.2 EF is an adenylate cyclase that acts to increase intracellular levels of cAMP.3 LF, the principle virulence factor, is a zinc metalloprotease,4 which, when translocated to the cytoplasm, is capable of cleaving mitogen-activated protein kinase kinases.5-7 Systemic B. anthracis infection leads to lethal pathologies that can be mimicked in animal models by the delivery of anthrax LT, which is produced at high levels during infection.8 However, the mechanisms leading to LT induced mortality are poorly defined.

Inbred strains of mice vary in their susceptibility to LT.8-11 Watters and Dietrich12 took advantage of the genetically controlled differential susceptibility of murine macrophages to cytolysis in vitro to map Ltxs1 on murine chromosome 11. Recently, Ltxs1 was identified as Kif1c.13 In C57BL/6J and C3H/HeJ mice the Kif1c alleles are distinguished by a single amino acid substitution (L578->P578), whereas in BALB/cJax and DBA/2J mice the amino acid differences are L578->P578, S1027->P1027, and S1066->Y1066. To assess the role of the BALB/c and DBA/2 Kif1c alleles in mortality we studied a panel of interval-specific, recombinant-congenic (ISRC) lines carrying various segments of central mouse chromosome 11 derived from LT-resistant DBA/2 mice on the LT-susceptible BALB/c background. The results indicate that mortality is controlled by three linked quantitative trait loci (QTL) on chromosome 11: Ltxs1/Kif1c, Ltxs2, and Ltxs3. Additionally, we found that (BALB/c x DBA/2) F1 hybrid (CD2) mice are resistant, demonstrating that resistance is dominant over susceptibility. Individually, DBA/2 alleles at each QTL have a limited protective effect. The presence of resistance alleles at all three QTL is required for complete protection.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Animals

BALB/cAnNCr and DBA/2NCr mice were purchased from the National Cancer Institute (Frederick, MD), whereas BALB/cByJ, BALB/cJax, DBA/2J, and (BALB/cByJ x DBA/2J) F1 hybrid (CD2) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). ISRC F1 hybrids were generated at the University of Vermont. ISRC lines were generated using (BALB/cAnPt x DBA/2NCr) x BALB/cAnPt backcross mice. Third generation backcross mice carrying the DBA/2 Evi2 allele were identified and subsequent progeny selected using D11Mit67 for six backcross generations to BALB/cAnPt mice. The C.D2.Evi2 mice were intercrossed and additional recombinants identified using informative chromosome 11 markers. The recombinant mice were analyzed for background contamination and C.D2 ISRC mice carrying BALB/c alleles at all marker loci were backcrossed an additional two generations. As a control for BALB/c substrain variability the C.D2 ISRC lines were also backcrossed to BALB/cByJ and BALB/cAnNCr mice before fixing.

Microsatellite Genotyping

Genomic DNA was isolated from 2 to 3 mm of mouse tail tissue14 and genotyping performed by PCR using polymorphic microsatellite markers distinguishing BALB/c and DBA/2 mice.15,16 Microsatellite primers were either purchased from Research Genetics, Inc. (Huntsville, AL) or synthesized according to primer sequences obtained from MGI (www.informatics.jax.org). Microsatellite size variants were resolved by electrophoresis on either agarose gels visualized by ethidium bromide or on large format denaturing polyacrylamide gels visualized by autoradiography on Kodak film.

Kif1c Genotyping

DNA samples from BALB/c and DBA/2 mice were prepared from tissues on hand as described above. Oligonucleotide primers flanking the C->T transition at nucleotide 1733 leading to the P578->LP578 amino acid polymorphism distinguishing the DBA/2 and BALB/c Kif1c alleles were designed.13 Kif1c allele specific oligonucleotide forward primer: 5'-GTCTAACCACAGTACAGCGTT-3' and reverse 5'-CCTGCTTCCTCTGGTGAG-3'. The 489-bp fragment when cleaved with NlaIV results in a 406-bp BALB/c fragment and a 358-bp DBA/2 fragment. PCR and cleavage products were detected and resolved by electrophoresis in agarose gels and visualized by staining with ethidium bromide.

LT Challenge

Mice received standard mouse chow and water ad libitum. All mice were maintained in a conventional vivarium. Cohorts of 6- to 12-week-old male and female mice received intravenous injections of LT (µg PA:µg LF) as previously described8 using recombinant PA and LF purified in the laboratory of Y.S.17 or purchased from List Biological Laboratories, Inc. (Campbell, CA). No significant difference in in vivo bioactivity was detected between the two toxin sources.

Selective Inhibition of Nos2 Activity in Vivo

N-[3-(Aminomethyl)benzyl]acetamidine, dihydrochloride (1400W) was purchased from Calbiochem (San Diego, CA). Mice were injected with 14 mg/kg 1400W in saline 2X daily at 12-hour intervals by i.p. injection starting 2 days before the i.v. injection of 125:25 LT and daily thereafter. Control mice received saline.

Real-Time PCR Analysis of Nos2 Expression

Real-time quantitative RT-PCR was performed using the Taqman system.18 PCRs were performed using the Taqman Universal PCR Master Mix and the ABI PRISM 7700 Sequence Detection System. The probes and primer set sequences were as previously described.19 Nos2: 5'-TGACGGCAAACATGACTTCAG-3' (forward), 5'-GCCATCGGGCATCTGGTA-3' (reverse), 5'-FAM-(AATTCACAGCTCATCCGGTACGCTGG)-BHQ-1–3' (probe). Hprt: 5'-TTTGCCGCGAGCCG-3' (forward), 5'-TAACCTGGTTCATCATCGCTAATC-3' (reverse), 5'-FAM-(CGACCCGCAGTCCCAGCGTC)-BHQ-1–3' (probe). Total RNA was extracted from BALB/cByJ and DBA/2J peritoneal macrophages cultured for 24 hours in the presence of 100 ng/ml Escherichia coli 0111:B4 LPS (Sigma Chemical Company, St. Louis, MO) + 25 U/ml mouse IFN{gamma} (Biosource, Camarillo, CA). RNA was isolated, DNase-treated, and 1.0 µg of total RNA used as a template to synthesize first-strand cDNA using random primers. Nos2 levels were analyzed using the standard curve method. A non-RT control was also prepared for each sample and no genomic DNA was detected. As a positive control for Nos2 expression, cDNA was prepared from Nos2-positive cell lines. Varying amounts of the positive control cDNA were used in the PCR reaction to determine the linear range of the PCR reactions. 1.0 µl of the sample cDNA was used in the PCR reaction and the comparative threshold cycle (CT) value obtained used to calculate the amount of sample cDNA required to reach the linear range established by the standard. Nos2 levels were normalized to Hrpt and the data are presented as "Fold Induction" following stimulation with LPS + IFN{gamma} normalized to the levels observed in DBA/2.

Statistical Analyses

The binomial test was used to test for significant differences in mortality between the C.D2 ISRC lines or the BALB/c and DBA/2 lines and the CD2 F1 hybrids. analysis of variance with LSD comparisons was used to test for significant differences among post hoc groupings. The mortality rates were first transformed using the arcsine transformation (2 x arcsine {surd}p). Student’s t-test was used to assess the significance of the differences in Nos2 mRNA expression between DBA/2 and BALB/c macrophages.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Since BALB/c sublines are known to differ in susceptibility to a number of immunopathologic phenotypes including infectious agents,20-24 the initial studies were carried out using BALB/cByJ, BALB/cAnNCr, and BALB/cJax mice to assess potential substrain differences in susceptibility to LT. Cohorts of male and female mice were challenged with 50:10, 100:20, 125:25, and 150:30 (µg PA:µg LF) LT by intravenous injection. No significant sex or substrain differences in mortality were observed at any of the doses studied. Therefore, the data were pooled to generate the dose response curves presented in Figure 1A . The 50:10 dose of LT failed to elicit any mortality. In contrast, BALB/c mice challenged with 100:20, 125:25, and 150:30 LT exhibited increasing mortality rates, with the 125:25 and 150:30 doses both eliciting 100% mortality by day 9 postinjection. Because the 125:25 dose of LT was the minimal effective dose that elicited 100% mortality in susceptible BALB/c mice, this dose was used to assess the in vivo susceptibility status of male and female DBA/2J, DBA/2NCr, and CD2 F1 hybrid mice. At this dose, DBA/2 mice were essentially resistant to LT challenge with no significant sex or substrain difference being observed. Importantly, CD2 F1 hybrid mice also exhibited resistance, indicating that resistance to LT is dominant (Figure 1B) .



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. A: Anthrax LT dose-response curves for BALB/c mice. All mice received intravenous injections of LT on day 0. The data are expressed as % mortality (number of animals dead on a given day/number of animals studied x 100) and are the cumulative combined results obtained with male and female BALB/cByJ, BALB/cAnN and BALB/cJax mice. B: Mortality in BALB/c, DBA/2, and CD2 F1 hybrid mice following the intravenous injection of 125:25 LT (125 µg PA:25 µg LF) on day 0. The data are expressed as % mortality (number of animals dead on a given day/number of animals studied x 100) and are the cumulative combined results for male and female mice by strain and/or substrain.

 
Susceptibility of the C.D2 ISRC lines to LT was also assessed by the intravenous injection of 125:25 LT (Figure 2) . All lines (CT 3.2, P = 0.0001; all others, P < 0.0001) except CT 3 (P = 0.77) exhibited significantly greater mortality compared to DBA/2 and CD2 F1 hybrid mice. In contrast, all lines (P < 0.0001) except CT 8.5 (P = 1.0) were significantly more resistant to LT compared to BALB/c mice. The remaining eight C.D2 ISRC lines clustered into three groups, resulting in five quantitatively distinct phenotypes based on mortality rates (P < 0.0001).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Mortality in C.D2 ISRC lines following the intravenous injection of 125:25 LT on day 0. The data are expressed as % mortality and are the cumulative combined results for both male and female mice for each ISRC line.

 
A comparison of the alleles at each of the marker loci carried by the C.D2 ISRC lines is presented in Table 1 . First, the DBA/2 Ltxs1/Kif1c allele does not fully protect mice from LT challenge. This is reflected by the fact that lines CT 8, CT 8.2, and CT 8.3 exhibit significantly greater mortality (50.0%, 52.6%, and 52.6%, respectively) than do either DBA/2 (5.0%) or CD2 F1 hybrid mice (4.5%). However, the data show that DBA/2 alleles at marker loci between D11Mit318 and D11Mit165 result in mortality similar to that of DBA/2 (5.0%) and CD2 F1 hybrids (4.5%), ie, line CT 3 mice (5.3%).


View this table:
[in this window]
[in a new window]
 
Table 1. Genotypes of ISRC Lines Indicate that Mortality is Controlled by Three QTL

 
The most parsimonious interpretation of these results is that aside from Ltxs1/Kif1c there are at least two additional QTL within the interval between D11Mit318 and D11Mit165 controlling mortality. The first novel QTL is proximal of Ltxs1/Kif1c within the interval between D11Mit88 (34.5 cM) and D11Mit4 (37.0 cM). We have designated this QTL as Ltxs2. The genetic effect at Ltxs2 is manifest in lines CT 8.4, CT 8.6, and CT 3.1 which exhibit 78.9%, 76.2%, and 76.5% mortality compared to 100% mortality in BALB/c and CT 8.5 mice.

The second novel QTL, Ltxs3, is distal of Ltxs1/Kif1c within the interval between D11Bhm149 (44.7 cM) and D11Bhm169 (46.5 cM). The location of Ltxs3 is manifest by the fact that line CT 3.2 exhibits significantly reduced mortality compared to lines CT 8, CT 8.2, and CT 8.3 (22.6% vs. 50.0%, 52.6%, and 52.6%, respectively). Ltxs3 is also present in line CT 3. The data suggest that Ltxs1 and Ltxs3 interact in controlling responsiveness. This also is the case for Ltxs2 because line CT 8.1, which possesses DBA/2 alleles at both Ltxs1/Kif1c and Ltxs2, exhibits 28.0% mortality compared to 50.0%, 52.6%, and 52.6% in lines CT 8, CT 8.2, and CT 8.3, respectively. Given this interpretation, the data indicate that Ltxs2 resides within the interval defined by the recombination break-point in lines CT 8 and CT 8.1 between D11Mit88 (34.5 cM) and D11Mit4 (37.0 cM).

The Ltxs3 interval encompasses inducible nitric oxide synthase (Nos2), which is an attractive candidate gene for Ltxs3. LF inhibits NO production by macrophages6 and Nos2 knockout mice die sooner than wild-type mice when challenged with anthrax spores.25 To assess the candidacy of Nos2 for Ltxs3 we examined the effects of N-[3-(Aminomethyl)benzyl]acetamidine, dihydrochloride (1400W) on susceptibility to LT. 1400W is a selective, irreversible Nos2 inhibitor which is effective in vivo.26 Inhibition of Nos2 activity was capable of partially overriding genetically controlled resistance in both DBA/2 and CD2 F1 hybrid mice (Figure 3) . Additionally, DBA/2 macrophage produced significantly greater levels of Nos2 mRNA following stimulation with LPS and IFN{gamma} (Figure 4) . Taken together these data strongly support Nos2 as a candidate for Ltxs3.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Selective, pharmacologically based inhibition of Nos2 activity partially overrides genetic resistance to LT in vivo. The data are expressed as % mortality and are the combined results for both male and female mice.

 


View larger version (5K):
[in this window]
[in a new window]
 
Figure 4. Nos2 expression differs between DBA/2 and BALB/c peritoneal macrophages. Resident peritoneal macrophages were isolated by lavage from DBA/2 and BALB/c mice and Nos2 expression levels assessed by Taqman PCR using cDNA generated by reverse transcription of mRNA isolated from equal numbers of cells stimulated for 24 hours with 100 ng/ml LPS and 25 U/ml mouse IFN{gamma}. Nos2 levels are normalized with respect to DBA/2 levels. Data are presented as the normalized means ± SD (P value <0.05).

 
To test the hypothesis that dominant interactive effects contribute to mortality we crossed several of the congenic lines and assessed the F1 progeny for susceptibility and resistance (Figure 5) . First, we crossed lines CT 8.1 and CT 3.2. Both parental strains exhibited 25% mortality whereas the (CT 8.1 x CT 3.2) F1 hybrids were resistant. Since both Ltxs2 and Ltxs3 are heterozygous, this indicates that DBA/2 alleles at these two QTL are dominant. Dominance at Ltxs3 is also supported by the data obtained with the (CT 8.2 x CT 3.2) F1 hybrids. Finally, crossing line CT 8.6 with line CT 3.2 resulted in F1 hybrids that are heterozygous at all three QTL. These mice were completely resistant to LT challenge, as were the CD2 F1 hybrids in this particular experiment. Taken together these data suggest that the three QTL controlling mortality interact in a dominant fashion.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Mortality studies in C.D2 ISRC F1 hybrid mice indicate that protection requires resistance alleles at Ltxs1, Ltxs2, and Ltxs3 for complete protection from LT. Solid bars represent DBA/2 alleles, open bars represent BALB/c alleles and gray bars represent heterozygous regions. The mortality values are the cumulative totals observed at day 9 following the intravenous injection of 125:25 LT.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Although Ltxs1/Kif1c was identified as the gene controlling LT-induced macrophage cytolysis in vitro, insufficient data existed to conclude whether or not Ltxs1/Kif1c plays a role in lethal pathologies in vivo.13 Fortuitously, we were in a position to directly test this. We had previously established a panel of C.D2 ISRC lines covering the central portion of chromosome 11 as the first step in the positional cloning of Orch3, a gene controlling dominant resistance to autoimmune orchitis.16 Since BALB/c and DBA/2 mice exhibit differential susceptibility to both macrophage cytolysis in vitro and lethality following infection,8,9 and BALB/c and DBA/2 Ltxs1/Kif1c alleles are segregating among our lines, we undertook an experiment to assess the role of Ltxs1/Kif1c in the genetic control of mortality.

DBA/2 mice were reported to be susceptible to lethality following infection8 while their macrophages are resistant to cytolysis.11 In contrast, BALB/c mice were resistant to lethality following infection8 but their macrophages are susceptible to cytolysis.9,11 The susceptibility status of both strains following direct intravenous challenge with LT was unknown. In generating the C.D2 ISRC lines several different BALB/c sublines were intentionally used to control for subline differences in susceptibility to autoimmune orchitis.23 Therefore, it was important to exclude potential substrain differences as a confounding factor in these studies. Similarly, DBA/2 substrain differences in susceptibility to infection with Leishmania major have been reported.27 Our substrain survey clearly indicated that all BALB/c sublines were equally susceptible to mortality clearly establishing that BALB/c mice are susceptible to LT-challenge and that DBA/2 are resistant. Additionally, we showed that CD2 F1 hybrid mice are also resistant, indicating that resistance is dominant over susceptibility. These results are consistent with the previously reported inverse relationships between mortality elicited by infection and LT challenge.8

The congenic mapping results confirm the role of the BALB/c and DBA/2 Ltxs1/Kif1c alleles in controlling mortality. However, the results of this study reveal that two additional QTL linked to Ltxs1/Kif1c control mortality: Ltxs2 (34.5–37.0 cM) and Ltxs3 (44.71–46.43 cM). Individually, DBA/2 alleles at each QTL contribute some protective effect. The presence of resistance alleles at all three QTL is, however, required for complete protection.

One QTL and one candidate gene within the Ltxs2 interval is Ity3, controlling susceptibility to Salmonella typhimurium infection, and MglI, macrophage galactose N-acetyl-galactosamine specific lectin 1 mediating macrophage binding to galactose and N-acetyl-galactosamine residues on tumor and bacterial cells and bacterial products (www.informatics.jax.org). The interval encompassing Ltxs3 encodes Nos2. LF inhibits NO production by macrophages6 and Nos2 knockout mice die sooner than wild-type mice when challenged with anthrax spores.25 Our results demonstrating that in vivo inhibition of Nos2 activity partially overrides genetic resistance to LT and that Nos2 mRNA levels are higher in DBA/2 macrophages compared to BALB/c macrophages supports the hypothesis that either a structural or expression-level polymorphism in Nos2 could underlie Ltxs3.28 Additionally, Tnfaip1 (tumor necrosis factor, {alpha}-induced protein 1) at 45.1 cM is also of interest given that TNF{alpha} treatment of LT-resistant macrophages converts them to LT-susceptible macrophages.29 Tnfaip1 is specifically and transiently expressed by endothelial cells following exposure to TNF{alpha}.

Clearly, the identification of the genes underlying Ltxs2 and Ltxs3, and their detailed characterization at the biochemical and molecular level, will provide significant additional insight into the mechanisms whereby LT elicits lethal anthrax pathologies. Importantly, since resistance is dominant at all three QTL, BAC and single gene transgenic mapping strategies can in theory be used to identify the respective genes and verify that Kif1c is the only gene within the DBA/2 Ltxs1 interval controlling mortality and macrophage cytolysis.


    Acknowledgements
 
We thank Pradeep K. Gupta and Harish Chandra for purifying the PA and LF generated in the laboratory of Y. S.


    Footnotes
 
Address reprint requests to Dr. Cory Teuscher, C317 Given Medical Building, University of Vermont, Burlington, VT 05405. E-mail: C.Teuscher{at}uvm.edu

This work was supported by National Institutes of Health grant AI45105 (to C. T.) and the Leibniz Program (Bo1128/6-1; to T. B.).

Accepted for publication July 9, 2003.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Leppla SH: Anthrax toxin. Moss J Iglewski B Vaughan M Tu AT eds. Bacterial Toxins and Virulence Factors in Disease. 1995:pp 543-572 Dekker New York
  2. Bradley KA, Mogridge J, Mourez M, Collier RJ, Young JA: Identification of the cellular receptor for anthrax toxin. Nature 2001, 414:225-229[Medline]
  3. Leppla SH: Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations in eukaryotic cells. Proc Natl Acad Sci USA 1982, 79:3162-3166[Abstract/Free Full Text]
  4. Klimpel KR, Arora N, Leppla SH: Anthrax toxin lethal factor contains a zinc metalloprotease consensus sequence which is required for lethal toxin activity. Mol Microbiol 194, 13:1093-1100
  5. Duesbery NS, Webb CP, Leppla SH, Gordon VM, Klimpel KR, Copeland TD, Ahn NG, Oskarsson MK, Fukasawa K, Paul KD, Vande Woude GF: Proteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor. Science 1998, 280:734-737[Abstract/Free Full Text]
  6. Pellizzari R, Guidi-Rontani C, Vitale G, Mock M, Montecucco C: Anthrax lethal factor cleaves MKK3 in macrophages and inhibits the LPS/IFNg-induced release of NO and TNF{alpha}. FEBS Lett 1999, 462:199-204[Medline]
  7. Vitale G, Bernardi L, Napolitani G, Mock M, Montecucco C: Susceptibility of mitogen-activated protein kinase kinase family members to proteolysis by anthrax lethal factor. Biochem J 2000, 352:739-745
  8. Welkos S, Keener T, Gibbs P: Differences in susceptibility of inbred mice to Bacillus anthracis. Infect Immun 1986, 51:795-800[Abstract/Free Full Text]
  9. Singh Y, Leppla SH, Bhatnagar R, Friedlander AM: Internalization and processing of Bacillus anthracis lethal toxin by toxin-sensitive and resistant cells. J Biol Chem 1989, 264:11099-11102[Abstract/Free Full Text]
  10. Friedlander AM, Bhatnagar R, Leppla SH, Johnson L, Singh Y: Characterization of macrophage sensitivity and resistance to anthrax lethal toxin. Infect Immun 1993, 61:245-252[Abstract/Free Full Text]
  11. Roberts JE, Watters JW, Ballard JD, Dietrich WF: Ltxs1, a mouse locus that influences the susceptibility of macrophages to cytolysis caused by intoxication with Bacillus anthracis lethal factor, maps to chromosome 11. Mol Microbiol 1998, 29:581-591[Medline]
  12. Watters JW, Dietrich WF: Genetic, physical and transcript map of the Ltxs1 region of mouse chromosome 11. Genomics 2001, 73:223-231[Medline]
  13. Watters JW, Dewar K, Lehoczky J, Boyartchuk V, Dietrich WF: Kif1c, a kinesin-like motor protein, mediates mouse macrophage resistance to anthrax lethal factor. Current Biol 2001, 11:1503-1511[Medline]
  14. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML: Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 2000, 29:52-54[Medline]
  15. Sudweeks JD, Todd JA, Blankenhorn EP, Wardell BB, Woodward SR, Meeker ND, Estes SS, Teuscher C: Locus controlling Bordetella pertussis-induced histamine sensitization (Bphs), an autoimmune disease-susceptibility gene, maps distal to T-cell receptor ß-chain gene on mouse chromosome 6. Proc Natl Acad Sci USA 1993, 90:3700-3704[Abstract/Free Full Text]
  16. Meeker ND, Hickey WF, Korngold R, Hansen WK, Sudweeks JD, Wardell BB, Griffith JS, Teuscher C: Multiple loci govern the bone marrow-derived immunoregulatory mechanism controlling dominant resistance to autoimmune orchitis. Proc Natl Acad Sci USA 1995, 92:5684-5688[Abstract/Free Full Text]
  17. Singh Y, Khanna H, Chopra AP, Mehra V: A dominant negative mutant of Bacillus anthracis protective antigen inhibits anthrax toxin action in vivo. J Biol Chem 2001, 276:22090-22094[Abstract/Free Full Text]
  18. Bustin SA: Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 2002, 29:23-39[Abstract]
  19. Fagan KA, Morrissey B, Fouty BW, Sato K, Harral JW, Morris KG, Jr, Hoedt-Miller M, Vidmar S, McMurtry IF, Rodman DM: Upregulation of nitric oxide synthase in mice with severe hypoxia-induced pulmonary hypertension. Respir Res 2001, 2:306-313[Medline]
  20. Potter M, Wax JS: Genetics of susceptibility to pristane-induced plasmacytomas in BALB/cAn: reduced susceptibility in BALB/cJ with a brief description of pristane-induced arthritis. J Immunol 1981, 127:1591-1595[Abstract]
  21. Skamene E: Susceptibility of BALB/c sublines to infection with Listeria monocytogenes. Curr Top Microbiol Immunol 1985, 122:128-133[Medline]
  22. Babu PG, Huber S, Sriram S, Craighead JE: Genetic control of multisystem autoimmune disease in encephalomyletitis virus infected BALB/cCum and BALB/cByJ mice. Curr Top Microbiol Immunol 1985, 122:154-161[Medline]
  23. Teuscher C, Blankenhorn EP, Hickey WF: Differential susceptibility to actively induced experimental allergic encephalomyelitis and experimental allergic orchitis among BALB/c substrains. Cell Immunol 1987, 110:294-304[Medline]
  24. Nicholson SM, Peterson JD, Miller SD, Wang K, Dal Canto MC, Melvold RW: BALB/c substrain differences in susceptibility to Theiler’s murine encephalomyelitis virus-induced demyelinating disease. J Neuroimmunol 1994, 52:19-24[Medline]
  25. Kalns J, Scruggs J, Millenbaugh N, Vivekananda J, Shealy D, Eggers J, Kiel J: TNF receptor 1, IL-1 receptor, and iNOS genetic knockout mice are not protected from anthrax infection. Biochem Biophys Res Commun 2002, 292:41-44[Medline]
  26. Garvey EP, Oplinger JA, Furfine ES, Kiff RJ, Laszlo F, Whittle BJR, Knowles RG: 1400W is a slow, tight binding, and highly selective inhibitor of inducible nitric-oxide synthase in vitro and in vivo. J Biol Chem 1997, :4959-4963
  27. Mock BA, Fortier AH, Potter M, Blackwell J, Nacy CA: Genetic control of systemic Leishmania major infection: identification of subline differences for susceptibility to disease. Curr Top Microbiol Immunol 1985, 122:115-121[Medline]
  28. Ables GP, Hamashima N, Watanabe T: Analysis of genetic factors associated with nitric oxide production in mice. Biochem Genet 2001, 39:379-394[Medline]
  29. Kim SO, Jing Q, Hoebe K, Beutler B, Duesbery NS, Han J: Sensitizing anthrax lethal toxin-resistant macrophages to lethal toxin-induced killing by tumor necrosis factor-{alpha}. J Biol Chem 2003, 278:7413-7421[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S.-D. Ha, D. Ng, J. Lamothe, M. A. Valvano, J. Han, and S. O. Kim
Mitochondrial Proteins Bnip3 and Bnip3L Are Involved in Anthrax Lethal Toxin-induced Macrophage Cell Death
J. Biol. Chem., September 7, 2007; 282(36): 26275 - 26283.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. M. Firoved, M. Moayeri, J. F. Wiggins, Y. Shen, W.-J. Tang, and S. H. Leppla
Anthrax Edema Toxin Sensitizes DBA/2J Mice to Lethal Toxin
Infect. Immun., May 1, 2007; 75(5): 2120 - 2125.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
F. Habib, A. D. Johnson, R. Bundschuh, and D. Janies
Large scale genotype phenotype correlation analysis based on phylogenetic trees
Bioinformatics, April 1, 2007; 23(7): 785 - 788.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. Moayeri, J. F. Wiggins, R. E. Lindeman, and S. H. Leppla
Cisplatin inhibition of anthrax lethal toxin.
Antimicrob. Agents Chemother., August 1, 2006; 50(8): 2658 - 2665.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Moayeri, K. E. Wickliffe, J. F. Wiggins, and S. H. Leppla
Oxidized ATP Protection against Anthrax Lethal Toxin
Infect. Immun., July 1, 2006; 74(7): 3707 - 3714.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Moayeri, J. I. Webster, J. F. Wiggins, S. H. Leppla, and E. M. Sternberg
Endocrine Perturbation Increases Susceptibility of Mice to Anthrax Lethal Toxin
Infect. Immun., July 1, 2005; 73(7): 4238 - 4244.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Moayeri, N. W. Martinez, J. Wiggins, H. A. Young, and S. H. Leppla
Mouse Susceptibility to Anthrax Lethal Toxin Is Influenced by Genetic Factors in Addition to Those Controlling Macrophage Sensitivity
Infect. Immun., August 1, 2004; 72(8): 4439 - 4447.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McAllister, R. D.
Right arrow Articles by Teuscher, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McAllister, R. D.
Right arrow Articles by Teuscher, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS