| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Activator Induces Renal CYP2C23 Activity and Protects from Angiotensin II-Induced Renal Injury










From HELIOS Klinikum-Berlin,* Franz Volhard Clinic, and Medical Faculty of the Charité, Humboldt University of Berlin, Berlin; the Max Delbrück Center for Molecular Medicine,
Berlin-Buch; the Department of Medicine-Nephrology,
Hannover Medical School, Hannover; and FILT GmbH,
Berlin-Buch, Germany
| Abstract |
|---|
|
|
|---|
B activation. We tested the hypothesis that the peroxisome proliferator-activated receptor-
-activator fenofibrate (Feno) induces CYP isoforms, AA hydroxylation, and epoxygenation activity, and protects against inflammatory organ damage. Double-transgenic rats (dTGRs) overexpressing human renin and angiotensinogen genes were treated with Feno. Feno normalized blood pressure, albuminuria, reduced nuclear factor-
B activity, and renal leukocyte infiltration. Renal epoxygenase activity was lower in dTGRs compared to nontransgenic rats. Feno strongly induced renal CYP2C23 protein and AA-epoxygenase activity under pathological and nonpathological conditions. In both cases, CYP2C23 was themajor isoform responsible for 11,12-EET formation. Moreover, we describe a novel CYP2C23-dependent pathway leading to hydroxy-EETs (HEETs), which may serve as endogenous peroxisome proliferator-activated receptor-
activators. The capacity to produce HEETs via CYP2C23-dependent epoxygenation of 20-HETE and CYP4A-dependent hydroxylation of EETs was reduced in dTGR kidneys and induced by Feno. These results demonstrate that Feno protects against angiotensin II-induced renal damage and acts as inducer of CYP2C23-mediated epoxygenase activities. We propose that CYP-dependent EET/HEET production may serve as an anti-inflammatory control mechanism.
B).
Peroxisome proliferator-activated receptor (PPAR)-
activators, such as clofibrate and fenofibrate (Feno) lower triglycerides, but also influence CYP-dependent AA metabolism. Fibrates induce CYP4A gene expression via a PPAR-
response element in the promoter region.14
Fibrates reduce blood pressure in salt-sensitive Dahl rats,15,16
in stroke-prone spontaneously hypertensive rats,16
and in DOCA salt-hypertensive mice.17
Roman and colleagues4,15
suggested that enhanced tubular CYP4A expression and 20-HETE formation are involved in this process. PPAR-
activators also prevent the activation of inflammatory response genes by inhibiting NF-
B and activator protein-1 signaling.18
We have studied double-transgenic rats (dTGRs) harboring the human genes for renin and angiotensinogen. dTGRs develop hypertension and profound renal damage.19-22
NF-
B and activator protein-1 activation and associated consequences are important features of this model.19,20,22
We recently showed that dTGRs exhibit significantly decreased renal AA epoxygenase activities and that the expression of the predominant EET-generating CYP-isoform, CYP2C23, is progressively lost in renal cortical tubules.23
Therefore, decreased EET production might be involved in mediating hypertension and inflammatory end-organ damage. We examined whether or not the PPAR-
activator Feno is able to restore the CYP-dependent renal AA metabolism, reduce inflammatory responses, and protect against angiotensin (Ang) II-induced renal damage.
| Materials and Methods |
|---|
|
|
|---|
Rats overexpressing the human renin and angiotensinogen genes [dTGR(hREN L10*hAOGEN L1623)]; abbreviated in the following as (dTGRs) have been described in detail earlier.19-23 dTGRs were purchased from RCC Ltd. (Füllinsdorf, Switzerland). Experiments were conducted in age-matched 4-week-old male untreated dTGRs (n = 20), Feno-treated dTGRs (n = 11; 30 mg/kg/day in the diet from weeks 4 to 7), and nontransgenic Sprague-Dawley rats (SD) (n = 7; Tierzucht Schönwalde, Germany) after due approval (permit no. G 408/97). To investigate the effect of Feno on the expression of CYP isoforms and their activities under nonpathological conditions, we treated in an additional protocol SD with the same dose of Feno and normal chow (n = 6 each). Systolic blood pressure was measured by tail-cuff under light ether anesthesia. Urine samples were collected throughout 24 hours. Urinary albumin was measured by enzyme-linked immunosorbent assay (CellTrend, Luckenwalde, Germany). All rats were killed at age 7 weeks.
TaqMan Polymerase Chain Reaction (PCR)
Real-time quantitative reverse transcriptase (RT)-PCR was performed using the TaqMan system (PE Biosystems) as described earlier in detail.22 Each sample was in triplicate. For quantification, the target sequence (n = 6 each group) was normalized in relation to the ß-actin product. The sequences were: ß-actin-F: TCCTGGCCTCACTGTCCAC; ß-actin-R: GGGCCGGACTCATCGTACT;ß-actin-P: 6-FAM-TTCCAGCAGATGTGGATCAGCAAGCATAMRA; human angiotensinogen-F: TGAAGAAACTGTCTCCCCGG; human angiotensinogen-R: TCATAAGATCCTTGCAGCACCA; human angiotensinogen-P: 6-FAM-CCATCCACCTGACCATGCCCCA-TAMRA; human renin-F: CGAGAAAGCCTGAAGGAACG; human renin-R: TCATGGGTTGGCTCCACTC; human renin-P: 6-FAM-TGGACATGGCCAGGCTTGGTCC-TAMRA; CYP2C23-F: ACCGAGACAACCAGCACCA; CYP2C23-R: TGGCTTGCACCTCTGGATACT; CYP2C23-P: 6-FAM-CCTGAGATTCGGGCTCCTGCTGCTCCTTAT-TAMRA.
Immunohistochemistry
Ice-cold acetone-fixed cryosections (6 µm) were stained by immunofluorescence and alkaline phosphatase anti-alkaline phosphatase technique as described earlier.19,20,23 The sections were incubated with the following monoclonal antibodies: anti-CD4 (PharMingen, Heidelberg, Germany), anti-ED-1, anti-CD8 (all Serotec, Germany), anti-CD86, anti-Ox62, and anti-Ox6 MHC II (all BD Pharmigen, Germany), and polyclonal antibodies: anti-CYP2C23,7 anti-CYP4A1 (Daiichi Pure Chemicals, Tokyo, Japan), and anti-fibronectin (Paesel, Frankfurt, Germany), and anti-collagen IV (Southern Biotechnology, Birmingham, AL). Cy3 and fluorescein-isothiocyanate secondary antibodies (Dianova, Hamburg, Germany) were used for co-localization stainings. Semiquantitative scoring of infiltrated cells and matrix expression was performed as described earlier.20 Fifteen different cortical areas of each kidney (n = 5 in all groups) were analyzed. For quantification of perivascular macrophage infiltration, all selected view fields included a small vessel in their analysis. Quantification of CD4+ T cells, MHC II+ cells, and CD86+ cells was performed periglomerular, whereas CD8+ cells were quantified interstitially. The samples were examined without knowledge of the rats identity. Two independent observers who were unaware of the treatments assessed collagen IV and fibronectin expression. The data are expressed in arbitrary units (0 to 5) based on the staining intensity.
Electrophoretic Mobility Shift Assay
Tissue preparation for electrophoretic mobility shift assay was performed as described earlier.19
Nuclear extracts (5 µg protein) from whole kidneys were incubated in binding reaction medium with 0.5 ng of 32P-dATP end-labeled oligonucleotide, containing the NF-
B-binding site from the MHC enhancer (H2K, 5'-gatcCAGGGCTGGGGATTCCCCATCTCCACAGG). Unlabeled H2K oligonucleotides (50 ng) were used in competition assays. Antibodies for supershift analysis (p50 and p65) were obtained from Santa Cruz, Germany.
Renal Microsomal AA Metabolism
Microsomes were prepared from freshly dissected kidneys and AA hydroxylase and epoxygenase activities were determined as described previously.23 Briefly, renal microsomes (80 µg of protein in a total volume of 0.1 ml) were incubated in 50 mmol/L Tris/HCl buffer, pH 7.5, with 10 nmol [1-14C] AA (0.55 x 106 dpm; final concentration, 100 µmol/L) in the presence of NADPH (0.5 mmol/L) for 20 minutes at 37°C. In immunoinhibition experiments, microsomes were preincubated for 30 minutes at 37°C with 100 µg/ml of rabbit IgG (125 µg IgG/mg microsomal protein) before substrate and NADPH were added. Anti-CYP2C23 IgG7 concentrations were varied between 0 and 100 µg/ml whereas the total amount of IgG was kept constant by appropriate additions of control rabbit IgG. AA hydroxylase activities were determined as the sum of 19- and 20-HETE and AA epoxygenase activities as the sum of EETs and corresponding dihydroxyeicosatrienoic acids (DHETs) produced per minute and mg of microsomal protein. To analyze the formation of secondary AA metabolites, renal microsomes were incubated under the standard reaction conditions described above using AA (56 mCi/mmol) and primary metabolites (19-HEET, 20-HETE, EETs, and DHETs) in a final concentration of 20 µmol/L.
Western Blot Analysis
Microsomal protein (15 µg per lane) was separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting was performed as we have described previously.23 Primary antibodies used were goat antisera against rat CYP4A1 (reacts with all CYP4A isoforms) and rat CYP2C11 (both Daiichi Pure Chemicals Co.), and a rabbit IgG against rat CYP2C23.7
Oxidation of Primary Metabolites by Recombinant CYP Enzymes
The cDNAs for CYP2C23 and Cyp4a12 were generated by RT-PCR from rat and mouse kidney RNA samples as to be described in detail elsewhere. Recombinant baculoviruses were produced using the Bac-to-Bac System of Gibco-BRL. The recombinant baculovirus for CYP4A1 was kindly provided by Dr. M. L. Schwartzman, New York Medical College, Valhalla, NY. Co-expression of individual CYP isoforms with human NADPH-CYP reductase (CPR) was achieved by co-infection of Spodoptera frugiperda (Sf9) cells with the respective recombinant baculoviruses as described previously.24 Sf9 microsomes containing the recombinant CYP/CPR-systems (10 pmol of CYP2C23 or CYP4A1) were preincubated for 5 minutes at 37°C with different [1-14C]-labeled substrates (2 nmol) in 100 mmol/L of potassium phosphate buffer, pH 7.2 (total volume, 0.1 ml). Reactions were started by addition of NADPH (final concentration, 0.5 mmol/L) and performed at 37°C for 20 minutes.
Preparation of Metabolites
Radiolabeled 20-HETE was produced by hydroxylation of [1-14C]-AA (56 mCi/mmol; Amersham Pharmacia-Biotech) with recombinant Cyp4a12. The reactions were performed in 100 mmol/L of potassium phosphate buffer, pH 7.2, for 20 minutes at 37°C and contained per ml 20 nmol of AA (56 mCi/mmol), 50 pmol of recombinant Cyp4a12 and NADPH (0.5 mmol/L). After extraction with ethyl acetate, the total hydroxylation product was collected from RP-HPLC and further resolved into 19- and 20-HETE by normal phase (NP)-HPLC as described.17 Radiolabeled EETs and hydroxy-EETs (HEETs) were synthesized by chemical oxidation of [1-14C]-AA (56 mCi/mmol) and 20-HETE (supplemented with trace amounts of [1-14C] 20-HETE; Cayman Chemical), respectively, with m-chloroperoxybenzoic acid.25,26 14,15-EET was directly isolated from RP-HPLC. The further EET regioisomers were resolved by NP-HPLC on Nucleosil 100-5 (250 x 4 mm; Macherey-Nagel, Düren, Germany) using hexane:2-propanol:acetic acid (99.5:0.4:0.1, v/v/v) at a flow rate of 1.5 ml/min (11,12-EET, Rt = 12.5 minutes; 8,9-EET, Rt = 16.5 minutes; 5,6-EET, Rt = 24 minutes). HEET regioisomers were resolved by NP-HPLC using a linear gradient from hexane:2-propanol:acetic acid (99.4:0.5:0.1,v/v/v) to hexane:2-propanol:acetic acid (96.4:3.5:0.1, v/v/v) for 60 minutes at a flow rate of 1 ml/min.
LC-MS Analysis
The HPLC equipment consisted of Agilent HP 1100 series with binary pump, autosampler with thermostat, photodiode array detector, and atmospheric pressure ionization mass spectrometry detector. The analysis was done on an analytical column Zorbax Eclipse XDB-C8, 4.6 x 150 mm [time] 5 µm. Five µl of ethanolic solution of the HEETs was injected. The gradient elution was started with a mobile phase 30:70 (v/v) mixture of acetonitrile/ammonium acetate buffer (0.01 mol/L, pH = 8.5) and a flow rate of 0.4 ml/minute. Acetonitrile was increased throughout 15 minutes to 90% and held for 10 minutes. The drying gas flow was 11 l/minute and drying gas temperature 350°C. Capillary voltage was 3000 V and fragmentor voltage was 60 V. The detection was made in negative mode between m/z = 200 to 400.
Statistical Analysis
Data are presented as means ± SEM. Statistically significant differences in mean values were tested by analysis of variance, repeated measures when appropriate, and the Scheffé test. Mortality was examined with a Kaplan-Meier analysis. A value of P < 0.05 was considered statistically significant. The data were analyzed using Statview statistical software.
| Results |
|---|
|
|
|---|
In untreated male dTGRs, 10 of 20 rats died before sacrifice, whereas Feno treatment reduced mortality to zero (P < 0.001). No nontransgenic SD rat died before the end of the study. Blood pressure progressively increased in untreated dTGRs and exceeded that of SD control rats more than 100 mm Hg at week 7 (213 ± 3 mm Hg versus 107 ± 3 mm Hg; P < 0.001). Feno-treated dTGRs remained normotensive and had blood pressure values of 120 ± 3 mm Hg at week 7 not different from SD control rats (Figure 1A)
. Urinary albumin excretion was markedly higher in dTGRs than in SD rats: 29.3 ± 3.1 mg/day versus 0.19 ± 0.04 mg/day (P < 0.001). Feno-treated dTGRs did not develop significant albuminuria (0.7 ± 0.26 mg/day; Figure 1B
). Plasma triglyceride levels from untreated dTGRs and SD were not different (140 ± 17 mg/dl versus 151 ± 17 mg/dl; P = 0.89). Feno-treated dTGRs showed significantly decreased levels (73 ± 3 mg/dl; Figure 1C
). Feno had dramatic effects on matrix protein deposition. Collagen IV (Figure 2A)
and fibronectin (data not shown) staining in Feno-treated dTGRs were reduced almost to the levels observed in SD rats. Untreated dTGRs, on the other hand, showed prominent staining for these matrix proteins (grade 1+ for Feno-treated dTGRs versus 5+ for vehicle-treated dTGRs versus 1+ for SD rats, respectively). To analyze whether or not Feno action on end-organ protection was because of down-regulation of one of the transgenes, we performed TaqMan RT-PCR for human renin and angiotensinogen. Renal renin and liver angiotensinogen expression was statistically not different between dTGRs and Feno-treated dTGRs; no signal was observed in nontransgenic SD (for renin: 51 ± 23 versus 43 ± 12 versus 0.05 ± 0.03; for angiotensinogen: 29 ± 3 versus 25 ± 5 versus 0.004 ± 0.002 arbitrary units, respectively).
|
|
B Activity
Feno abolished inflammatory response, as well as infiltration of immune cells in the kidney. Monocytes/macrophages (ED-1+) infiltrated predominantly around the damaged vessels, whereas T-helper cells (CD4+) showed perivascular and interstitial and cytotoxic T cells (CD8+) interstitial, periglomerular, and glomerular locations (not shown). Semiquantification of ED-1+, CD4+, and CD8+ T-cell infiltration showed a significant reduction of these cells in the kidney after chronic Feno treatment (P < 0.001; Figure 2B
). In addition, Feno also reduced dendritic cell, MHC II+ cell, and CD86+ cell infiltration toward nontransgenic levels (P < 0.001; Figure 2B
). These data suggest that immunocompetent cell activation was markedly suppressed by fibrate treatment.
We next studied transcription factor activation in renal tissue with electrophoretic mobility shift assay. Four vehicle-treated dTGRs (Figure 3)
showed markedly increased NF-
B DNA binding activity, whereas four Feno-treated dTGRs showed activity that was little different from SD controls. Antibodies directed against the p50 and p65 subunits of NF-
B resulted in supershifts. Thus, Feno treatment reduced NF-
B activation in dTGRs. We also analyzed the effect of Feno on NF-
B DNA binding and NF-
B-dependent promoter activity in tubular epithelial NRK-52E cells. Two hours of Feno preincubation not only reduced tumor necrosis factor-
-induced NF-
B DNA-binding activity significantly, but also reduced NF-
B-dependent promoter activity more than 80% (data not shown).
|
Renal microsomes of dTGRs showed a significantly reduced AA epoxygenase activity (Figure 4A)
. The production of EETs was decreased to 61% and reached only 130 ± 21 pmol/minute/mg compared to 214 ± 15 pmol/minute/mg in SD controls (P < 0.05; Figure 4A
). Feno treatment strongly induced the AA-epoxygenase activity to 249 ± 19 pmol/minute/mg. This value was nearly twofold higher than in untreated dTGRs (P < 0.01) and exceeded that of SD controls. In contrast, Feno did not increase hydroxylase activity (Figure 4B)
. We were next interested in the CYP isoforms that were responsible for EET formation in dTGRs and Feno-treated renal microsomes. An antibody directed against CYP2C23 dose-dependently decreased the AA epoxygenase activities more than 90% in both groups (Figure 4C)
. In contrast, AA-hydroxylase activities were not inhibited.
|
The CYP2C23 content of dTGR renal microsomes was moderately diminished compared to SD. Feno treatment significantly increased CYP2C23 in dTGRs (P < 0.001), corresponding to 167 ± 13% of the SD control (P < 0.001) (Figure 4D)
. TaqMan RT-PCR analysis showed that renal CYP2C23 mRNA levels were not changed (0.9 ± 0.1 arbitrary units for Feno-treated dTGRs versus 1.1 ± 0.2 for untreated dTGRs versus 1.0 ± 0.1 for SD rats, respectively) suggesting a posttranscriptional regulation. CYP2C11 protein levels were dramatically decreased in dTGR renal microsomes to 15 ± 2% of SD control values (P < 0.001) and were only weakly induced by Feno treatment (Figure 4D)
. CYP4A protein was almost identical in renal microsomes of untreated dTGRs and SD control rats. Feno treatment resulted in a strong induction of CYP4A proteins to
180% compared to samples from untreated dTGRs (P < 0.001; Figure 4D
).
We performed immunohistochemical analysis to further localize renal CYP2C23 expression. Untreated dTGRs showed reduced renal CYP2C23 expression. Feno treatment of dTGRs resulted in abundant CYP2C23 expression in cortical tubules (Figure 5A)
, collecting ducts, and outer medullary tubules (data not shown) indistinguishable from SD kidneys. CYP4A proteins were expressed in all outer medullary tubules, some cortical tubules and in most tubules along the medullary rays. CYP4A staining was more pronounced in Feno-treated dTGRs compared with untreated dTGRs and SD (Figure 5B)
. In addition, dTGR kidney showed less CYP4A immunoreaction in areas with tubular damage. We next stained both CYP isoforms in the same section of a nontransgenic rat and found that CYP4A (red) and CYP2C23 (green) were co-localized in certain cortical tubules (Figure 5C)
, tubules along medullary rays, and outer medullary tubules (data not shown).
|
To elucidate the effects of fibrates under physiological conditions, we treated nontransgenic SD rats with Feno. Chronic Feno treatment did not affect systolic blood pressure (108 ± 3 mm Hg versus 113 ± 3 mm Hg, P = 0.29) or albuminuria (0.12 ± 0.02 mg/day versus 0.11 ± 0.01 mg/day; P = 0.71; SD+Feno versus SD.). Feno reduced plasma triglycerides (72 ± 3 mg/dl versus 142 ± 19 mg/dl; P < 0.05; SD+Feno versus SD.). Feno treatment had a profound influence on CYP-dependent AA metabolism in SD rats. Epoxygenase activity was significantly induced and reached 530 ± 25 pmol/minute/mg compared to 190 ± 11 pmol/minute/mg in SD controls (Figure 6A)
. In contrast, hydroxylase activity showed only a nonsignificant tendency to increased values after Feno treatment (237 ± 12 pmol/minute/mg versus 204 ± 17 pmol/minute/mg; Figure 6B
). Neutralizing CYP2C23 antibodies clearly inhibited the formation of epoxygenase products both in untreated and Feno-treated SD rats (Figure 6C)
. Western blotting revealed significantly increased microsomal CYP2C23, CYP2C11, and CYP4A protein levels after Feno treatment (161 ± 13%, 150 ± 17%, and 256 ± 46% of SD controls, respectively; Figure 6E
).
|
All AA epoxygenase and hydroxylase assays described above were performed at an AA concentration of 100 µmol/L to favor the formation of primary products (19-/20-HETE and EETs/DHETs). To analyze the generation of secondary metabolites, we used a lower AA concentration (20 µmol/L). Two additional product peaks with retention times of
9.0 and 4.5 minutes were clearly detectable under these conditions (Figure 7A)
. Taking the sum of these two product peaks, secondary metabolite generation was approximately fivefold less in renal microsomes from dTGRs compared to SD rats (Figure 7B)
. Feno treatment induced secondary metabolite generation sixfold in dTGRs and 3.5-fold in SD rats (Figure 7B)
. The 9-minute products co-migrated with chemically epoxidized 20-HETE (hydroxy-EETs; HEETs) and those at 4.5 minutes with hydrolyzed HEETs (hydroxy-DHETs; HDHETs).
|
-hydroxylation of 8,9-, 11,12- and 14,15-EET with recombinant CYP4A1 showed retention times of 44.9 minutes (20-hydroxy-8,9-EET; 20,8,9-HEET), 44.0 minutes (20,11,12-HEET), and 53.7 minutes (20,14,15-HEET) in NP-HPLC (nomenclature as described in Cowart and colleagues26
). Epoxygenation of 20-HETE by recombinant CYP2C23 resulted in a major product co-migrating with 20,8,9-HEET (
80% of total product) and a minor product co-migrating with 20,14,15-HEET (Figure 7E)| Discussion |
|---|
|
|
|---|
activator Feno on CYP-dependent AA-metabolism and on Ang II-induced renal damage. Feno protected dTGRs from hypertension and inflammatory end-organ damage. Because untreated dTGRs and SD rats showed similar plasma triglyceride levels, we believe that the reno-protective effect was triglyceride-independent. We provide the first data that PPAR-
activation induced renal CYP2C23-dependent AA-epoxygenase activity under pathological and nonpathological conditions. CYP2C23 activity not only determined the formation of anti-inflammatory EETs, but also the metabolism of 20-HETE to HEETs providing a novel route for the generation of these recently discovered endogenous PPAR-
activators.26 Renal damage in dTGRs is a result of uncontrolled inflammation triggered by high local Ang II concentrations.19-21 We showed previously that end-organ damage and hypertension are primarily independent processes in dTGRs. Blood pressure reduction withinhibitors not affecting Ang II generation did not reverse end-organ damage.21 In contrast, anti-inflammatory and immunosuppressive treatment protected against renal damage in dTGRs despite elevated blood pressure levels.19,20 A similar organ-protective effect in dTGRs was only achieved by specific inhibition of RAS with ACE inhibitors and AT1-receptor antagonists. The beneficial effects of Feno obviously did not result from reduced Ang II levels because the expression of the transgenes for human renin and angiotensinogen on Feno-treatment was unchanged.
The present finding that Feno abolished the activation of NF-
B in dTGRs suggests that PPAR-
activation represses renal inflammation already at a very early stage. The prevention of leukocyte infiltration and activation of immunocompetent cells, as well as reduction in albuminuria, is probably a consequence of proinflammatory transcription factor inhibition. Direct anti-inflammatory mechanisms of PPAR-
activation were recently identified by in vitro studies. The mechanisms involve protein-protein interactions between PPAR-
and the p65 and c-Jun subunits of NF-
B and activator protein-1, respectively, and an induction of the inhibitory protein I
B
that retains NF-
B in a cytoplasmic inactive complex.27,28
Our finding that renal CYP-dependent EET and HEET generation are down-regulated in dTGRs and strongly induced on Feno-treatment points to additional mechanisms that may have contributed to the strong anti-inflammatory effect of the PPAR-
activator. EETs are able to inhibit cytokine-induced activation of the I
B kinase complex, a key step in the pathway leading to NF-
B activation.13
Our immunoinhibition experiments revealed that CYP2C23 represented the predominant renal AA epoxygenase in dTGRs and SD rats, as well as in the corresponding Feno-treated groups. CYP2C23 has a regioselectivity in favor of producing 11,12-EET,7
the most potent anti-inflammatory regioisomer.13
Cowart and colleagues26
showed that HEETs function as high-affinity endogenous PPAR-
activators. Our data indicate that the capacity to produce HEETs is very low in dTGRs compared to SD rats and is strongly induced in both Feno-treated dTGRs and Feno-treated SD rats. The ability of CYP4A enzymes to hydroxylate EETs to HEETs has been already reported.26
We found a novel pathway, in which HEETs are efficiently produced by CYP2C23-dependent epoxygenation of 20-HETE. HEET generation via both pathways required an interaction of CYP4A and CYP2C enzymes (Figure 8)
. Therefore, alterations in their activities alter the AA metabolites formation. Pathophysiological CYP2C down-regulation, as found in our dTGRs model, may lead to: 1) reduced EET levels, 2) even more pronounced decrease in HEET production, and 3) presumably also to accumulation of 20-HETE levels because of a lower rate of CYP2C-catalyzed 20-HETE epoxygenation. CYP2C23 produced predominantly 20,8,9-HEET, which was also the main HEET regioisomer formed in renal microsomal AA metabolism. This result suggests that CYP2C23-dependent 20-HETE epoxygenation is a major route of HEET production. According to our immunohistochemical analysis, CYP4A and CYP2C23 are co-localized in most medullary and certain cortical tubules and may thus indeed co-operate to produce HEETs. In this context, Feno appears as a substitute for the decreased endogenous HEET levels in dTGRs and to trigger a positive feedback involving enhanced CYP-dependent formation of the endogenous PPAR-
activators.
|
response element.30
Further excluding a direct transcriptional regulation, we found that the renal CYP2C23 mRNA levels were not different between dTGRs and SD rats and were not influenced by Feno treatment. Interestingly, high-salt intake of rats also induced CYP2C23 at a posttranscriptional level.7 The fact that Feno not only protected against renal damage, but also against the development of Ang II-induced hypertension may be because of elevated EET generation. The anti-hypertensive effect of EETs is generally attributed to their ability to increase renal blood flow and to promote salt excretion.1,2,4,5,31 EETs act as endothelium-derived hyperpolarizing factors in a number of vascular beds including renal arterioles.10-12,31 In addition, proinflammatory mediators decrease endothelial CYP2C expression and endothelium-derived hyperpolarizing factor formation.32 In preglomerular arterioles, vasoconstriction in response to Ang II is enhanced when Ang II-stimulated EET generation is abolished.31,33 Thus, decreased EET levels in dTGRs potentiate Ang II-induced vasoconstriction and salt reabsorption. We speculate that Feno enhanced EET generation and thereby counterregulated vasoconstriction and salt reabsorption. Supporting this view, soluble epoxide hydrolase inhibition, which also increases renal EET levels, reduced hypertension in Ang II-infused rats.34 The effect of Feno on AA-hydroxylase activities was less pronounced, although we found a significant induction of CYP4A protein levels. Thus, increased tubular 20-HETE production, that was held responsible for the anti-hypertensive effect of fibrates in Dahl salt-sensitive rats and in spontaneously hypertensive rats, appears to play a minor role in our model.3,15,16
We believe that fibrate-mediated blood pressure reduction is a common action in rodents. PPAR-
activation reduced blood pressure not only in our transgenic model, but also in Dahl salt-sensitive rats,15,16
spontaneously hypertensive rats rats,16
and Ang II-infused SD rats.35
Fibrates showed anti-inflammatory properties in humans;36
however, the effect on blood pressure is less clear. Some studies demonstrated a blood pressure-lowering effect with Feno,37
gemfibrozil,38
and bezafibrate,39
while others did not.38
PPAR-
activation by fibric acids improves insulin sensibility, and decreases thrombosis and vascular inflammation. PPAR-
activators decrease the risk of coronary heart disease in patients with normal low-density lipoprotein cholesterol and low high-density lipoprotein-cholesterol,40
they slow the progression of premature coronary atherosclerosis,41
particularly in patients with type 2 diabetes.42
Taken together, prevention of end-organ damage in dTGRs by Feno provided in vivo evidence for a protective effect through PPAR-
activation. In addition to the inhibitory effect of PPAR-
agonists on NF-
B signaling, increased generation of anti-inflammatory EETs may have contributed to Feno actions. Moreover, induction of CYP2C23 activity not only increased EETs, but also the endogenous PPAR-
activator HEET. We propose that increased EET/HEET levels are important factors protecting against Ang II-induced hypertension and organ damage. Stimulation of CYP-dependent AA-epoxygenation as demonstrated in the present study and decreased EET inactivation by inhibiting the soluble epoxide hydrolase may provide attractive therapeutic targets for the future.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by the Deutsche Forschungsgemeinschaft (Mu1467/1-1 and Schu822/3-1), the Klinischer-Pharmakologischer Verbund Berlin-Brandenburg, and the European Union.
Accepted for publication October 20, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. M. Williams, M. Sharma, S. Anjaiahh, J. R. Falck, and R. J. Roman Role of endogenous CYP450 metabolites of arachidonic acid in maintaining the glomerular protein permeability barrier Am J Physiol Renal Physiol, August 1, 2007; 293(2): F501 - F505. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Y. Ng, Y. Huang, L. M. Reddy, J. R. Falck, E. T. Lin, and D. L. Kroetz Cytochrome P450 Eicosanoids are Activators of Peroxisome Proliferator-Activated Receptor {alpha} Drug Metab. Dispos., July 1, 2007; 35(7): 1126 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, C. Morisseau, J. Wang, T. Yang, J. R. Falck, B. D. Hammock, and M.-H. Wang Increasing or stabilizing renal epoxyeicosatrienoic acid production attenuates abnormal renal function and hypertension in obese rats Am J Physiol Renal Physiol, July 1, 2007; 293(1): F342 - F349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pozzi, M. R. Ibanez, A. E. Gatica, S. Yang, S. Wei, S. Mei, J. R. Falck, and J. H. Capdevila Peroxisomal Proliferator-activated Receptor-{alpha}-dependent Inhibition of Endothelial Cell Proliferation and Tumorigenesis J. Biol. Chem., June 15, 2007; 282(24): 17685 - 17695. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Spector and A. W. Norris Action of epoxyeicosatrienoic acids on cellular function Am J Physiol Cell Physiol, March 1, 2007; 292(3): C996 - C1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhao, J. E. Quigley, J. Yuan, M.-H. Wang, Y. Zhou, and J. D. Imig PPAR-{alpha} activator fenofibrate increases renal CYP-derived eicosanoid synthesis and improves endothelial dilator function in obese Zucker rats Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2187 - H2195. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yu, V. Y. Ng, P. Su, M. M. Engler, M. B. Engler, Y. Huang, E. Lin, and D. L. Kroetz Induction of Renal Cytochrome P450 Arachidonic Acid Epoxygenase Activity by Dietary {gamma}-Linolenic Acid J. Pharmacol. Exp. Ther., May 1, 2006; 317(2): 732 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Elmarakby, J. E. Quigley, D. M. Pollock, and J. D. Imig Tumor Necrosis Factor {alpha} Blockade Increases Renal Cyp2c23 Expression and Slows the Progression of Renal Damage in Salt-Sensitive Hypertension Hypertension, March 1, 2006; 47(3): 557 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Shagdarsuren, M. Wellner, J.-H. Braesen, J.-K. Park, A. Fiebeler, N. Henke, R. Dechend, P. Gratze, F. C. Luft, and D. N. Muller Complement Activation in Angiotensin II-Induced Organ Damage Circ. Res., September 30, 2005; 97(7): 716 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Imig Epoxide hydrolase and epoxygenase metabolites as therapeutic targets for renal diseases Am J Physiol Renal Physiol, September 1, 2005; 289(3): F496 - F503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Seubert, F. Xu, J. P. Graves, J. B. Collins, S. O. Sieber, R. S. Paules, D. L. Kroetz, and D. C. Zeldin Differential renal gene expression in prehypertensive and hypertensive spontaneously hypertensive rats Am J Physiol Renal Physiol, September 1, 2005; 289(3): F552 - F561. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pilz, E. Shagdarsuren, M. Wellner, A. Fiebeler, R. Dechend, P. Gratze, S. Meiners, D. L. Feldman, R. L. Webb, I. M. Garrelds, et al. Aliskiren, a Human Renin Inhibitor, Ameliorates Cardiac and Renal Damage in Double-Transgenic Rats Hypertension, September 1, 2005; 46(3): 569 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
|