| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |



From the Department of Biology,*University of North Carolina at Charlotte, Charlotte; and the Departments of Medicine
and Surgery,
Duke University Medical Center, Durham, North Carolina
| Abstract |
|---|
|
|
|---|
Recent in vitro studies from our laboratory have indicated that bone-forming osteoblasts may play a previously unappreciated role in the development of inflammatory responses to bacterial challenges in bone tissue. While the major functions of osteoblasts are to synthesize the components of bone matrix and to control the bone-resorbing activity of osteoclasts, cultured murine and human osteoblasts have been shown by our laboratory to have a third function following bacterial challenge, namely, the ability to produce soluble inflammatory mediators. We have demonstrated that cultured osteoblasts exposed to bacterial species commonly associated with bone pathology secrete significant quantities of an array of inflammatory cytokines,4 colony-stimulating factors,5 and chemokines.6,7 Taken together, the pattern of inflammatory mediator production induced in osteoblasts following bacterial exposure could act in a protective manner by recruiting macrophages, neutrophils andactivated T-lymphocytes to infected sites, and to sustain inflammatory responses by maintaining the activated status of such cells. Alternatively, because of the observed high levels of immune molecules such as interleukin-6 (IL-6) produced by cultured osteoblasts in response to S. aureus exposure, one must also consider a role for such cytokines in initiating the inflammation that results in progressive bone destruction. However, the in vivo relevancy of these in vitro findings has remained unclear.
In the present study, we provide the first evidence for the in vivo production of inflammatory mediators by osteoblasts during bacterial infection of bone tissue. These studies demonstrate the expression of the key inflammatory cytokine IL-6 by murine osteoblasts in S. aureus infected bone under in situ-like conditions and in an in vivo mouse model that closely resembles the pathology of trauma-induced staphylococcal osteomyelitis. Importantly, we confirm the clinical relevancy of these findings by demonstrating the expression of IL-6 by osteoblasts in human bone tissue samples from patients with S. aureus-associated osteomyelitis. Taken together, these findings are in agreement with our earlier in vitro studies and strongly suggest a key role for osteoblasts in the initiation and/or maintenance of inflammation during bone diseases such as osteomyelitis.
| Materials and Methods |
|---|
|
|
|---|
Two-day-old neonatal BALB/c mice were euthanized and calvaria (skullcaps) removed and maintained in culture medium as described previously by our laboratory.6 Calvaria were exposed to S. aureus strain UAMS-1 (ATCC 49230), a clinical osteomyelitis isolate, for 3 hours followed by removal of media containing extracellular bacteria and replacement with media containing gentamicin. We have previously demonstrated that exposure of osteoblasts to bacteria in this manner results in the harboring of viable intracellular bacteria by these cells.5 After 48 hours in culture, calvaria were embedded in OCT solution (Sakura, Tokyo, Japan) and 5-µm frozen sections were cut (Microm HM 505E, McBain Instruments, Chatsworth, CA). Sections were placed onto Superfrost Plus microscope slides (Fisher, Pittsburgh, PA) and fixed for 10 minutes at 4°C with 4% paraformaldehyde before staining.
Murine Model of Staphylococcal Osteomyelitis
A murine model of staphylococcal osteomyelitis has been used that has been modified from one previously shown to reproduce the clinical and gross pathological phases of inflammatory bone diseases such as human posttraumatic osteomyelitis.8 BALB/c mice were anesthetized with inhalant isoflurane and the femurs surgically exposed. A trough was drilled through the bone cortex by use of a high speed drill with a round burr. Damaged bone sites were either not treated or were inoculated with S. aureus (1 x 103) in agarose beads. Agarose beads containing S. aureus were prepared as follows. 1.4% low melt agarose (Invitrogen, Carlsbad, CA) was cooled to 4042°C before the addition of bacteria. This mixture was added to mineral oil, vigorously stirred, and cooled rapidly on ice. The resulting agarose beads were washed and stored on ice before bone application. This method of application induces local infection in bone tissue but markedly reduces the risk of systemic bacterial infection. The muscle fascias and surgical incision were closed and the disease was allowed to proceed for 2 or 4 days before femur removal and tissue analysis by RT-PCR and confocal microscopy. These times were selected based on empirical determination of the progression of infection at inoculated bone sites and on previously published findings in a similar murine model of staphylococcal osteomyelitis.9
Human Bone Tissue
Two clinical bone specimens were obtained from patients undergoing surgical debridement of S. aureus-associated osteomyelitis. A control bone sample was obtained from a subject undergoing hemiarthroplasty for reasons other than osteomyelitis. All bone samples were immediately fixed in 4% paraformaldehyde and stored at -70°C before tissue analysis.
Isolation of RNA and Semiquantitative RT-PCR
Murine femurs were cleaned free of connective tissue and marrow, quick-frozen in liquid N2, and pulverized with a pestle and mortar. Total RNA was isolated from the ground tissue using TRIzol reagent (GIBCO-BRL, Gaithersburg, MD) as previously described.4-7 Poly(A)+ RNA was then isolated from total RNA using polystyrene latex-oligo dT beads (Oligotex-dT, Qiagen, Chatsworth, CA) as described previously.10,11 100 ng of poly(A)+ RNA was reverse transcribed in the presence of random hexamers using 200 U of RNase H- Moloney leukemia virus reverse transcriptase (Promega, Madison, WI) in the buffer supplied by the manufacturer, as previously described by our laboratory.10,11
PCR was performed on the reverse transcribed cDNA product to determine the expression of IL-6, as previously described.4,11 Positive and negative strand PCR primers used, respectively, were GATGCAACCAAACTGGATATAATC and GGTCCTTAGCCACTCCTTCTCTG to amplify mRNA encoding IL-6 (268 bp fragment), and CCATCACCATCTTCCAGGAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT to amplify mRNA encoding G3PDH (340 bp fragment). PCR primers were derived from the published sequences of IL-612 and G3PDH.13 These primers were designed by using Oligo 4.0 primer analysis software (National Biosciences Inc., Plymouth, MA) based on their location in different exons of the genomic sequences for IL-6 in addition to their lack of significant homology to sequences present in GenBank (MacVector Sequence analysis software, IBI, New Haven, CT).
The sensitivity and linearity of RT-PCR amplifications for each gene analyzed here were predetermined using limiting dilutions of RNA generated from in vitro transcription reactions as is routine in our laboratory.10 These initial studies insured that the RT-PCR conditions used here were in the linear range of amplification for each mRNA species. To ensure similar input RNA amounts and efficiencies of reverse transcription, PCR amplification of the housekeeping gene, G3PDH, was performed on cDNA from each sample. The identity of the PCR amplified fragments were verified by size comparison with DNA standards (Promega), and by direct DNA sequencing of representative fragments as previously described.10,11 PCR products from the same series of experiments are shown throughout this manuscript for comparison purposes.
Immunohistochemical Analysis
Bone from the murine model or human tissue samples were decalcified using a procedure that has previously resulted in the preservation of cell surface markers for staining.14 Briefly, specimens were fixed for at least 6 hours at 4°C in 4% paraformaldehyde. After fixation, sequential 15-minute washes were performed using phosphate-buffered saline (PBS) containing 5% glycerol, PBS with 10% glycerol, and finally PBS with 15% glycerol. Specimens were then placed in a decalcifying solution (EDTA in 10% glycerol, pH 7.1) at 4°C for 5 and 14 days for murine and human bone samples, respectively. Specimens were washed sequentially in PBS containing 15% sucrose and 15% glycerol for 6 hours at 4°C, PBS containing 20% sucrose and 5% glycerol for 1 hour at 4°C, and PBS containing 20% sucrose and 5% glycerol for a further hour. Tissues were then embedded in OCT and quick-frozen in a mixture of ethanol and solid CO2. Finally, 5-µm frozen sections were cut and sections were placed onto slides and allowed to air dry for 30 minutes at room temperature.
Murine bone slides were washed in PBS and exposed to blocking buffer (PBS containing 1% BSA and 0.3% nonimmune rabbit serum). Slides were stained using goat anti-mouse osteocalcin antibody (1:1000 dilution, Biomedical Technologies Inc., Stoughton, MA), or nonspecific goat sera for 18 hours. An Alexa Fluor 488 conjugated chicken anti-goat IgG (Molecular Probes) was then added for 1 hour. Slides were co-stained with a monoclonal antibody directed against mouse IL-6 (Clone MP520F3, BD PharMingen, San Diego, CA), or species and isotype matched control monoclonal antibodies (Clone R334, BD PharMingen) for 18 hours before addition of Alexa Fluor 594 conjugated chicken anti-rat IgG (H+L) for 1 hour. For some sections, slides were not exposed to primary antibodies before addition of fluorchrome labeled secondary antibodies as an additional control.
Human bone tissue sections were stained in a similar manner using a goat polyclonal antibody for human osteocalcin (Diagnostic Systems Laboratories, Inc., Webster, TX), or nonspecific goat sera, for 18 hours, followed by addition of Alexa Fluor 488 conjugated chicken anti-goat IgG (Molecular Probes) for 1 hour. In addition, slides were co-stained with a PE-conjugated rat anti-human IL-6 monoclonal antibody (Clone MQ213A5, BD PharMingen), or PE-conjugated species and isotype matched control monoclonal antibodies (Clone R334, BD PharMingen) for 18 hours. For some sections, slides were not exposed to primary antibodies before addition of fluorchrome labeled secondary antibodies as an additional control. All slide preparations were illuminated andanalyzed using an FLUOVIEW FV500 confocal laser scanning biological microscope (Olympus America Inc., Melville, NY).
| Results |
|---|
|
|
|---|
Recent studies from our laboratory have indicated that cultured osteoblasts can express the key inflammatory cytokine IL-6 following exposure to bacterial pathogens associated with inflammatory bone disease.4
To begin to determine whether osteoblasts express IL-6 in response to challenge with S. aureus in vivo, we have used a murine model that reproduces the gross pathological phases of human posttraumatic osteomyelitis to investigate the expression of mRNA encoding this inflammatory mediator in infected bone tissue. At 2 and 4 days postsurgery, RNA was isolated from femurs that were untreated, mechanically damaged, or mechanically damaged and exposed to S. aureus, and RT-PCR was performed for the presence of mRNA encoding IL-6. As shown in the representative experiment in Figure 1
, levels of mRNA encoding IL-6 were significantly elevated in bone tissue exposed to S. aureus, as compared to bone tissue that was damaged but uninfected, or bone tissue from the untreated contralateral limb. Differences in IL-6 mRNA levels could not be ascribed to differences in input RNA or to differences in the efficiencies of reverse transcription as evidenced by RT-PCR amplification of the housekeeping gene, G3PDH, for each sample (Figure 1)
. Rather, these findings are in agreement with previous demonstrations of local IL-6 production in bone tissue in both human and mouse osteomyelitis.9,15
|
The presence of elevated mRNA encoding IL-6 in infected bone tissue does not establish the identity of the cell type(s) responsible for enhanced cytokine expression. Such expression may be induced in either resident bone cell types, such as osteoblasts and osteoclasts, or might result from the confounding presence of infiltrating leukocytes. Furthermore, elevated mRNA expression may not necessarily result in increases in IL-6 protein production. To determine whether IL-6 expression is elevated in osteoblasts, and to determine whether enhanced mRNA expression translates into IL-6 production, we have performed dual stained confocal immunohistochemical analyses of bone tissue from our murine model of osteomyelitis. Bone tissue from femurs that were untreated, mechanically damaged, or mechanically damaged and exposed to S. aureus, were processed and co-stained for IL-6 expression and the presence of the osteocalcin. Osteocalcin is an osteoblast-specific marker and has been widely used to define this cell type as such.4-7,16,17
As shown in the representative experiment in Figure 2
, sham infected bone tissue demonstrated orderly deposition of matrix and osteocalcin-positive osteoblasts (green fluorescence) (Figure 2F)
and the absence of IL-6 expression (red fluorescence) (Figure 2, E and F)
. In contrast, bone tissue from femurs exposed to S. aureus demonstrated a high degree of disorganization characteristic of aberrant bone remodeling commonly associated with bacterial infections of bone tissue1
(Figure 2A)
, and exhibited marked expression of IL-6 (Figure 2B)
. Importantly, IL-6 expression co-localizes with osteocalcin positive cells and is visualized as the yellow fluorescence in Figure 2C
. As expected, this co-localization was particularly marked at the external surface of the bone cortex, an area known to contain a high density of osteoblasts (Figure 2C)
. Uninfected contralateral bone tissue in these animals failed to express detectable levels of IL-6 (data not shown), consistent with the localized application of S. aureus in these studies. Positive fluorescence could not be ascribed to nonspecific binding to murine or bacterial cells as determined by the absence of fluorescence seen in infected bone tissue stained with species and isotype matched control primary antibodies (Figure 2D)
or in tissue exposed to the secondary antibody alone (data not shown). Taken together, these data demonstrate that osteoblasts are a significant sources of the proinflammatory cytokine, IL-6, in a murine model of S. aureus-associated osteomyelitis.
|
While the expression of IL-6 in infected murine bone tissue was predominantly associated with osteocalcin positive cells (Figure 2C)
, some cells expressing IL-6 were negative for the expression of this osteoblast marker. Such expression might be due to the presence of infiltrating immune cells or other resident bone cells, such as osteoclasts or their myeloid progenitors. To preclude the involvement of infiltrating leukocytes and to confirm that bone damage alone is not a sufficient stimulus for IL-6 expression in bone tissue, we have investigated the ability of S. aureus to initiate IL-6 expression in isolated murine calvaria under tissue culture conditions. These experiments allow the cell-cell interactions between resident bone cells that are likely to occur in vivo in the absence of immune cell involvement. As shown in a representative experiment in Figure 3E
, uninfected calvaria co-stained for the presence of osteocalcin and IL-6 demonstrated a high degree of organization and the absence of IL-6 production. In contrast, and in agreement with our findings using the in vivo model of bone infection, S. aureus-exposed calvaria display a disorganized appearance and the marked up-regulation of IL-6 production (Figure 3B)
. Again, expression of IL-6 showed marked co-localization with osteocalcin-positive osteoblasts (Figure 3C)
. Notably, few osteocalcin-negative cells expressing IL-6 are visible. While the identity of these rare IL-6 expressing cells is unclear, due to the absence of any infiltrating immune cells, it is likely that these cells are osteoclasts or their myeloid progenitors. Again, positive fluorescence could not be ascribed to nonspecific binding to murine or bacterial cells as determined by the absence of fluorescence seen in infected bone tissue stained with species and isotype matched control primary antibodies (Figure 3D)
or in tissue exposed to the secondary antibody alone (data not shown). Taken together, these findings confirm the results seen in the in vivo model of murine bone infection and indicate that osteoblasts are a significant source of inflammatory cytokine production in bacterially infected bone tissue.
|
To establish the clinical relevancy of our findings in murine bone tissue, we have analyzed human bone samples from uninfected individuals and debrided bone tissue from patients with S. aureus-associated staphylococcal osteomyelitis. Diseased and uninfected bone tissue samples were processed, co-stained for the presence of IL-6 and osteocalcin expression, and analyzed by confocal microscopy. As shown in the representative preparation in Figure 4D
, uninfected bone tissue demonstrated orderly deposition of matrix and osteocalcin positive osteoblasts (green fluorescence) with no cell-associated IL-6 expression (red fluorescence). In contrast, diseased bone specimens demonstrated a high degree of disorganization and exhibited marked expression of IL-6 (Figure 4A)
. Importantly, IL-6 expression co-localized with osteocalcin positive cells as visualized by the yellow fluorescence in Figure 4B
. Importantly, positive fluorescence could not be ascribed to nonspecific binding to human or bacterial cells as determined by the absence of fluorescence seen in infected bone tissue stained with species and isotype matched control primary antibodies (Figure 4C)
or in tissue exposed to the secondary antibody alone (data not shown). Taken together, these findings are in agreement with earlier in vitro studies demonstrating the ability of cultured human osteoblasts to secrete IL-6 following exposure to bacterial pathogens associated with osteomyelitis.4
Furthermore, these findings mirror our in vivo and in situ experiments in murine bone tissue and strongly support the notion that bacterially exposed osteoblasts are a significant source of proinflammatory molecule production in response to bacterial challenges in vivo.
|
| Discussion |
|---|
|
|
|---|
In the present study we have extended our in vitro findings to a murine model that reproduces many of the pathological features of human trauma-induced staphylococcal osteomyelitis.8 We confirm the elevated expression of mRNA encoding the key proinflammatory cytokine, IL-6, in bacterially infected bone consistent with earlier studies in murine bone tissue15 and with our previous studies using isolated osteoblasts.4 Importantly, in the present study we provide the first in vivo evidence for osteoblasts as a significant source of such inflammatory mediator production in response to bacterial challenge. We have used confocal microscopy techniques to co-localize the expression of IL-6 in infected bone tissue with the presence of osteocalcin, a specific marker for osteoblasts. IL-6 production was observed in osteoblasts at infected sites in our in vivo murine model. Such production could not be attributed to nonspecific antibody binding due to the absence of positive staining in infected tissue stained with species and isotype matched control antibodies, and the absence of staining with the secondary antibody alone. This expression was not constitutive as assessed by analysis of the contralateral limb bone, and does not occur as a direct result of mechanical damage as uninfected sham damaged bone failed to display detectable IL-6 production. This conclusion was confirmed in studies using isolated murine calvaria that were infected in vitro but were otherwise undamaged. Furthermore, the use of isolated calvaria confirmed the production of IL-6 by bacterially exposed osteoblasts in a system that allows interaction between resident bone cells, but precludes the involvement of infiltrating leukocytes. Finally, and most importantly, we establish the clinical relevancy of our findings by demonstrating the in vivo production of IL-6 by osteoblasts in bone specimens from patients with S. aureus-associated osteomyelitis.
While a wide range of cell types, including non-leukocytic cells, have been shown to be capable of producing IL-6 (for review see ref. 21 ), the implications for the secretion of this cytokine by osteoblasts in vivo following exposure to this clinically important pathogen are significant. The production of inflammatory cytokines by infected osteoblasts may contribute to protective host immune responses to bone pathogens. The presence of IL-6 can directly augment the development of both humoral and cell-mediated immune responses.22 In addition, IL-6 has recently been reported to play a role in blocking the suppressive activity of regulatory CD4+ CD25+ regulatory T-cells,23 thereby enabling the progression of immune responses. Alternatively, immune molecule production by bacterially exposed osteoblasts may contribute to the development of the progressive inflammatory damage and aberrant bone remodeling associated with the pathology of staphylococcal osteomyelitis. IL-6 produced by osteoblasts can directly or indirectly modulate the activity of bone-resorptive osteoclasts,24-26 resulting in induction of osteoclast differentiation or osteoclast-mediated bone demineralization. As such, the ability of S. aureus to induce IL-6 production by osteoblasts in vivo may have important implications for bone formation or destruction in osteomyelitis.
The increasing incidence in bacterial infections caused by S. aureus and the emergence of strains of this organism that are resistant or show reduced susceptibility to antibiotics such as methicillin3 and vancomycin27 have made understanding the pathogenesis of S. aureus-associated disease imperative. The present demonstration that bone-forming osteoblasts produce a key inflammatory mediator in both an animal model ofstaphylococcal osteomyelitis and in clinical specimens from patients suffering from this condition represents a potentially critical new role for osteoblasts during infection of bone tissues, namely, the ability to orchestrate immune responses in inflammatory bone diseases.
| Footnotes |
|---|
Supported by National Institutes of Health grants AR47585 and AI48842 to I.M.
Accepted for publication January 6, 2004.
| References |
|---|
|
|
|---|
in an experimental model of murine osteomyelitis due to staphylococcus aureus. Cytokine 2002, 19:59-65[Medline]
-induced TGF-ß 1 production by cultured murine macrophages. Cell Immunol 1998, 183:113-120[Medline]
, interleukin-6 and interleukin-8 in bacterial osteomyelitis. Trans R Soc Trop Med Hyg 2000, 94:221-224[Medline]
This article has been cited by other articles:
![]() |
S. N. Somayaji, S. Ritchie, M. Sahraei, I. Marriott, and M. C. Hudson Staphylococcus aureus Induces Expression of Receptor Activator of NF-{kappa}B Ligand and Prostaglandin E2 in Infected Murine Osteoblasts Infect. Immun., November 1, 2008; 76(11): 5120 - 5126. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Potter, T. C. Burns, A. P. Lacap, R. R. Granville, and D. A. Gajewski Heterotopic Ossification Following Traumatic and Combat-Related Amputations. Prevalence, Risk Factors, and Preliminary Results of Excision J. Bone Joint Surg. Am., March 1, 2007; 89(3): 476 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, D. M. Kemeny, B. C. Heng, H. W. Ouyang, A. J. Melendez, and T. Cao The immunogenicity and immunomodulatory function of osteogenic cells differentiated from mesenchymal stem cells. J. Immunol., March 1, 2006; 176(5): 2864 - 2871. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Bosse, H. E. Gruber, and W. K. Ramp Internalization of Bacteria by Osteoblasts in a Patient with Recurrent, Long-Term Osteomyelitis. A Case Report J. Bone Joint Surg. Am., June 1, 2005; 87(6): 1343 - 1347. [Full Text] [PDF] |
||||
![]() |
I. Marriott, D. M. Rati, S. H. McCall, and S. L. Tranguch Induction of Nod1 and Nod2 Intracellular Pattern Recognition Receptors in Murine Osteoblasts following Bacterial Challenge Infect. Immun., May 1, 2005; 73(5): 2967 - 2973. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |