help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paisley, D.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paisley, D.
Right arrow Articles by Melton, D. W.
(American Journal of Pathology. 2004;164:2279-2288.)
© 2004 American Society for Investigative Pathology

Male Infertility and DNA Damage in Doppel Knockout and Prion Protein/Doppel Double-Knockout Mice

Derek Paisley*, Stephen Banks{dagger}, Jim Selfridge{ddagger}, Neil F. McLennan*§, Ann-Marie Ritchie*, Carolanne McEwan*, D. Stewart Irvine{dagger}, Philippa T. K. Saunders{dagger}, Jean C. Manson and David W. Melton*

From the Molecular Medicine Centre,*Sir Alastair Currie Cancer Research UK Laboratories, the Medical Research Council Human Reproductive Sciences Unit,{dagger}Centre for Reproductive Biology, the Institute of Cell and Molecular Biology,{ddagger}and the National Creutzfeldt-Jakob Disease Surveillance Unit,§University of Edinburgh, Edinburgh; and the Neuropathogenesis Unit,Institute for Animal Health, Edinburgh, Scotland


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
The prion protein (PrP) and Doppel (Dpl) have many structural and biochemical properties in common, leading to the suggestion that the lack of an obvious phenotype in PrP-deficient mice maybe because of compensation by Dpl. To test this hypothesis and also investigate the function of Dpl we have generated Prnd–/– and Prnp–/–/Prnd–/– mouse lines. Both develop normally and display an identical male sterility phenotype that differs from that reported for another Prnd–/– mouse line. Sperm from both our mutant lines were present at normal concentrations, had normal motility, and no morphological abnormalities. Despite only rarely fertilizing oocytes in vivo, because of an inability to perform the acrosome reaction, mutant sperm were capable of fertilization in vitro, albeit at reduced rates compared to wild type. Elevated levels of oxidative DNA damage were found in both types of mutant sperm and resulting embryos failed at an early stage. Therefore we found no evidence that Dpl compensates for the loss of PrP function in mutant mouse lines, but it does have an important anti-oxidant function necessary for sperm integrity and male fertility.

An abnormal isoform of PrP (PrPSc) accumulates in the central nervous system in the transmissible spongiform encephalopathies, which are fatal neurodegenerative disorders occurring in man and animals. The cellular prion protein (PrPC), encoded by the Prnp gene, is a cell surface sialoglycoprotein expressed preferentially in the central nervous system and at lower levels in a number of nonneural tissues. To gain insight into the function of PrPC, a number of Prnp–/– mouse lines have been generated. The first knockout lines, ZrchI and Npu, were generated by disrupting the PrP coding region located in exon 3 of the Prnp gene.1,2 Studies on these lines indicated only a mild phenotype associated with PrP deficiency.3,4 Subsequently, in the Ngsk, Rcm0, and ZrchII lines, the entire coding region and part of intron 2 were deleted.5-7 Surprisingly, a late-onset ataxia, because of cerebellar Purkinje cell loss, developed in Rcm0, Ngsk, and ZrchII, but not ZrchI or Npu. This prompted the discovery of the Prnd gene, located 16 kb downstream of Prnp, encoding the prion-related protein, Doppel (Dpl).8 Because of the structure of the targeted Prnp allele, intergenic splicing between Prnp and Prnd led to ectopic expression of Dpl in the brains of the ataxic, but not the nonataxic, PrP-null mouse lines.

Evidence that ectopic Dpl expression is responsible for Purkinje cell death in the ataxic Prnp–/– lines has been provided by the generation of Prnp–/–/Dpl-overexpressing transgenic strains that show an inverse correlation between levels of Dpl in the brain and the age of onset of ataxia.7,9 The abrogation of the ataxic phenotype in the Ngsk and ZrchII lines by the introduction of a PrP-overexpressing transgene suggests that the absence of PrPC function is required for Dpl-induced neuronal death and that PrPC functions antagonistically with respect to Dpl neurotoxicity.7,9,10 This suggests some shared biological but distinct biochemical activities between PrPC and Dpl and it seems plausible that the toxicity of ectopically expressed Dpl is at least in part because of it interfering with PrPC -dependent pathways in the absence of that protein.

The amino acid sequence of Dpl is 23% homologous with PrP and has an N-terminal signal peptide sequence and C-terminal consensus sequences for Asn-linked glycosylation and GPI anchor addition.11 Both proteins bind copper [Cu(II)] ions12,13 and the solution structure of recombinant Dpl displays a similar topology to PrPC such that it closely resembles an N-terminally truncated PrPC lacking the octapeptide repeat region.14 It is of note that N-terminally truncated PrPC is incapable of rescuing Dpl-dependent ataxia and can indeed cause a similar ataxic phenotype in the absence of the wild-type PrPC protein.15,16

In mice, Dpl is normally expressed at high levels in adult testis and heart, but is only detectable in the brain during embryogenesis and in neonates.17 Dpl overexpression in the brain does not effect disease progression in scrapie-challenged Rcm0 PrP-null mice.18 In another study, after inoculation with scrapie prions, Dpl-deficient neural grafts showed spongiosis, gliosis, and normal PrPSc accumulation and infectivity.19 Polymorphisms in the human Prnd gene have been described, but no association between these and the development of human prion diseases has been identified.20,21 Thus, substantial evidence exists that Dpl is not required for susceptibility to prion diseases and PrPSc production.

In the adult mouse testis, Dpl immunoreactivity was found in both round and elongated spermatids.22 In humans, Dpl expression was also found in the testis, but in this case localized to Sertoli cells and also on the flagellum of ejaculated mature spermatozoa and in the seminal plasma.23 Behrens and colleagues22 generated Dpl-deficient mice and found that they develop normally to adulthood, but males are infertile. A partial blockade of spermiogenesis, resulting in reduced numbers of spermatozoa in mutant seminiferous tubules and epididymes was reported. Furthermore, Dpl-deficient spermatozoa had reduced motility and displayed both sperm head and flagellar morphological abnormalities. Dpl-deficient sperm were found to be incapable of fertilization in vitro unless the zona pellucida was partially dissected. This observation led the authors to propose that Dpl function regulates the development of the acrosome, a sperm head-specific structure required for the penetration of the zona pellucida.

The expression of PrPC has been reported in the male reproductive system of both mice and humans.23,24 PrPC is found in epididymal cells and truncated isoforms have been identified on ejaculated human spermatozoa, although the nature of the truncation is unclear, with the first report describing a C-terminally truncated isoform and the second an N-terminal truncation. All Prnp–/– mouse lines reproduce normally, suggesting that PrPC expression is not essential for normal reproductive function, or that a related protein compensates for the loss of PrPC function in these mice. However it has been shown that PrPC can protect sperm from the detrimental effects of copper toxicity and associated oxidative stress,24 and because of the biochemical similarities between PrPC and Dpl it is not unreasonable to suggest Dpl may play a similar role.

To investigate the relationship between PrPC and Dpl we have generated a Prnp–/–Prnd–/– mouse line as well a new Prnd–/– line by gene targeting and found that Prnp–/–/Prnd–/– animals develop normally to adulthood and display a male sterility phenotype indistinguishable from that of our Prnd–/– line. Surprisingly, this sterility phenotype differs in a number of ways from that of the Prnd–/– line produced by Behrens and colleagues.22 Mutant spermatozoa from our lines were capable of fertilization in vitro, albeit at a significantly reduced frequency than wild-type control sperm, despite an inability to undergo the acrosome reaction in response to a calcium ionophore. Embryos arising from mutant sperm failed at an early stage and we found elevated levels of oxidative DNA damage in mutant sperm. We find no evidence that Dpl compensates for PrPC activity in the development or integrity of the nervous system, but Dpl does play a critical role in multiple areas of sperm function.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Generation of Prnd–/– and Prnp–/–/Prnd–/– Mice

Gene targeting was performed using the Hprt-deficient strain 129/Ola ES cell line, HM-1.25 The Hprt mutation was crossed out before the establishment of targeted lines and all mouse lines were maintained on a 129/Ola inbred background. The 1.25-kb 5' homology arm of the Prnd-targeting construct was generated by polymerase chain reaction (PCR) using primers F4521 (BamHI linker then 5' GCTGCCTCAGTATTCCTATGCTCTGATG, positions 34,237to 34,264; GenBank accession no. U29187) and F4522 (5' GCCTCCCACCCTCCAACAAGTGACAG, positions 36,164 to 36,139) to generate a 1.9-kb fragment that was subsequently trimmed at a naturally occurring EcoRI at the 3' side. The 2.5-kb 3' homology arm was generated using primers F3984 (EcoRI linker then 5'GCTGGGTTTCGTTTGGTTCATTGTGAAG, positions 36,721 to 36,748) and F3985 (ClaI linker then 5' AGTCACTTGCAGCACATCTGTACTGTGG, positions 39,241 to 39,214). The two arms were cloned together into BamHI/ClaI-cut pBluescriptII SK(+) (Stratagene, La Jolla, CA) and the Hprt minigene PGK-HPRT(RI)26 was cloned into the central EcoRI site in the opposite transcriptional orientation to Prnd. An HSV-TK marker for negative selection was cloned adjacent to the 5' homology arm as a NotI/BamHI fragment and the vector was linearized with ClaI. Gene targeting was performed as described27 and targeted clones were identified by PCR, using primers f11976 (5' GATGCTAGGAGCCTGCTCATTCATTCC, positions 34,208 to 34,234) and 262W (located in the 3' end of the Hprt marker6 ) (see Figure 1a ). Targeting was confirmed by Southern analysis using a 147-bp probe generated by PCR (positions 34,088 to 34,234; GenBank accession no. U29187). A 3.7-kb wild type Prnd SacI fragment was replaced with a 5.2-kb targeting-specific fragment, whereas a 2.0-kb PstI fragment was replaced with a 5.7-kb targeting-specific fragment (see Figure 1a , data not shown).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 1. Generation of Prnd–/– and Prnp–/–/Prnd–/– mouse lines by gene targeting. a, Prnd; b, Prnp/Prnd. The structure of the Prnp and Prnd loci, targeting constructs, and targeted loci are shown schematically. Exons for each gene are indicated: filled boxes, coding regions; shaded boxes, untranslated regions. In the targeting constructs the positive (HPRT) and negative (HSV-TK) selectable markers are indicated. The locations of PCR primers, probes, and restriction fragments used to identify targeted clones are shown. Restriction sites: B, BamHI; E, EcoRI; P, PstI; S, ScaI; X, XhoI.

 
The Prnp/Prnd targeting construct contained the same 5' PstI/EcoRI fragment of Prnp sequence used in making the Rcm0 PrP-null mouse line,6 whereas the 3' homology region and cloning of the selectable markers were the same as in the Prnd targeting construct (described above). Targeted clones were identified by PCR, using the primers G1176mod (5' CTGCCGCACTTCTTGTGAATGCAGC) and 262W in the reaction previously described for the identification of the Rcm0 line.6 Targeting of the Prnd locus was confirmed by Southern analysis using a 171-bp 3' probe generated by PCR (positions 39,510 to 39,680; GenBank accession no. U29187). This probe detected the replacement of a 7.5-kb wild-type Prnd XhoI/BamHI fragment with a 5.0-kb targeting-specific fragment (see Figure 1b , data not shown). Successful targeting of the Prnp locus was confirmed by Southern analysis using a BamHI/PstI probe fragment to detect 8.5-kb wild-type BamHI and 3.8-kb targeted BamHI/XhoI fragments, as described previously (see Figure 1b , data not shown).6

Western Blotting

Tissue homogenates were prepared (10% w/v) in lysis buffer [10 mmol/L Tris-HCl, pH 7.6, 10 mmol/L ethylenediaminetetraacetic acid (EDTA), 100 mmol/L NaCl, 0.5% v/v Nonidet P-40, and 0.5% w/v sodium deoxycholate, 0.2 mmol/L phenylmethyl sulfonyl fluoride] and clarified by centrifugation. Protein concentrations of the sample supernatants were determined (DC Protein Assay kit, Bio-Rad, Hercules, CA) and samples (20 µg total protein) were mixed with gel-loading buffer, boiled for 3 minutes, cooled, and electrophoresed through a 12% sodium dodecyl sulfate-polyacrylamide gel. Proteins were then transferred by electroblotting onto Immobilon-P polyvinylidene difluoride membranes (Amersham Pharmacia Biotech, Uppsala, Sweden). Blots were incubated in primary antibodies [polyclonal anti-Dpl, Rb2 (a kind gift from I. Sylvester, Institute of Animal Health, Compton, UK); monoclonal anti-PrP, 6H4 (Prionics, Schlieren, Switzerland); monoclonal anti-GAPDH (Chemicon International, Temecula, CA)], followed by the appropriate horseradish peroxidase-conjugated secondary antibody. Blots were developed using the ECL+ Plus detection kit and exposed to Hyperfilm ECL (both Amersham Pharmacia Biotech).

Sperm Analysis

The cauda epididymes of 6- to 10-week-old male mice were dissected into 1 ml of activation buffer,28 diced, and incubated at 37°C for 30 minutes to allow sperm to disperse into the medium. Aliquots of the epididymal suspension were fixed in 5% paraformaldehyde and counted using a hemocytometer. Sperm motility was assessed by counting the number of sperm that showed tail motion29 and expressing this as a percentage of the total number of sperm (minimum of 100) counted. To assess sperm morphology a minimum of 200 sperm were counted with the numbers of morphologically normal sperm and those with abnormal heads or flagellae being recorded. Computer-assisted sperm analysis of motility was performed as described.30

In Vitro Fertilization

Female 129/Ola mice were superovulated by intraperitoneal injections of 5 IU pregnant mare serum gonadotrophin, followed by 5 IU of human chorionic gonadotrophin (hCG) 48 hours later. Oocytes were collected 8 hours after hCG administration, washed, and held in T6 medium.31 Spermatozoa were isolated from the cauda epididymes and vas deferens and allowed to capacitate in drops of T6 medium overlaid with silicone fluid for 2 hours at 37°C in 5% CO2. Sperm (1 to 2 x 106) were added to 30 to 40 oocytes held in a 0.5-ml drop of T6 medium and incubated for 4 to 5 hours at 37°C in 5% CO2 to allow fertilization to occur. Oocytes were then transferred to 200-µl drops of KSOM medium,32 overlaid with silicone fluid, and incubated at 37°C in 5% CO2 to allow development to proceed. The following day two-cell embryos were scored as a measure of successful fertilization and transferred to smaller drops (2 µl of medium per embryo) of KSOM and left in the incubator to develop further. Developmental progress to the morula stage was scored.

Acrosome Reaction

This was performed essentially as described.33 Briefly, spermatozoa were squeezed from the cauda epididymes and vas deferens of 8- to 10-week-old animals into 0.5 ml of human tubule fluid using a pair of fine forceps. Spermatozoa were incubated for 1 hour at 37°C in 5% CO2 to allow capacitation. Capacitated sperm were counted and adjusted to a concentration of ~1 x 106 sperm/ml in human tubule fluid medium. Aliquots (25 µl) were added to 25 µl of medium, either with or without, the calcium ionophore A23187 (40 µmol/L). After a further 30-minute incubation at 37°C in 5% CO2, sperm samples were fixed in 100 µl of 5% paraformaldehyde for 10 minutes. After two rounds of centrifugation and resuspension in 0.1 mol/L of ammonium acetate (pH 9.0), sperm aliquots (10 µl) were dried onto glass slides and stained for 2 minutes with 0.22% Coomassie Blue G-250 in 50% methanol/10% glacial acetic acid. Slides were rinsed with H2O and mounted before scoring at least 300 sperm from each sample as being either acrosome-reacted or acrosome-intact. Intense staining on the anterior aspect of the sperm head in acrosome-intact sperm was lost in acrosome-reacted sperm.

Sperm Chromatin Structure Assay (SCSA)

Sperm samples from the cauda epididymes were adjusted to a concentration of 2 x 106 cells/ml with TNE (0.15 mol/L NaCl, 0.1 mol/L Tris, 1 mmol/L EDTA, pH 7.4). One hundred µl of the sample was taken and 200 µl of acid detergent solution (0.1% Triton X-100, 0.15 mol/L NaCl, 0.08 N HCl, pH 1.2) added and left at room temperature. After 30 seconds 600 µl of acridine orange staining solution was added (37 mmol/L citric acid, 126 mmol/L Na2HPO4, 1 mmol/L EDTA, 0.15 mol/L NaCl, pH 7.4 with acridine orange added fresh to 6 µg/ml) and left at room temperature for 150 seconds. The cells were then immediately analyzed in a Coulter Epics XL Flow Cytometer. Red fluorescence (from single-stranded DNA) was measured using a 675-nm detector and green fluorescence (from double-stranded DNA) measured using a 525-nm detector. The Epics XL was calibrated for each run by adjusting the wild-type control samples to give a mean fluorescence value of 145 ± 10 at 675 nm and 445 ± 10 at 525 nm. Ten thousand events were collected for each sample and each was run in triplicate. Raw data were then exported in Listmode format and analyzed using FlowJo (Tree Star, Inc., Ashland, OR). Background contamination (bacterial contaminants and cells other than spermatozoa) was removed by gating and the results expressed in terms of {alpha}t [= red/(red + green) fluorescence, expressed as a percentage value] and COMP {alpha}t.34 COMP {alpha}t (cells outside the main population) was calculated as the percentage of cells in the population exhibiting an {alpha}t value greater than 26%.

Terminal dUTP Nick-End Labeling (TUNEL) Assay

Sperm samples were measured for DNA strand breaks using the TUNEL assay.35 Ten thousand events were counted for each sample.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Prnd–/–- and Prnp–/–/Prnd–/–-Null Animals Are Viable but Males Are Infertile

To investigate the function of Dpl we generated a Prnd–/– mouse line by gene targeting in embryonic stem cells. The Dpl ORF (except the last 31 bases) and a further 713 bases upstream were replaced by a selectable Hprt minigene (Figure 1a) . To test for possible compensation by Dpl for PrPC we also generated a Prnp–/–/Prnd–/– mouse line in which both the PrP- and Dpl-coding regions were ablated. Owing to the small distance between the two genes (~16 kb), we deleted both coding regions in a single targeting event. Eighteen kb of sequence, spanning the Prnp and Prnd loci, was replaced by an Hprt minigene (Figure 1b) . Immunoblotting confirmed the ablation of Dpl expression in the Prnd–/– line and the absence of both PrP and Dpl expression in the Prnp–/–/Prnd–/– line (Figure 2, a and b) .



View larger version (37K):
[in this window]
[in a new window]
  		Figure 2. Ablation of Dpl in Prnd–/– and Prnp–/–/Prnd–/– mouse lines. a: Immunoblotting of wild-type (wt), Prnd–/– (Dpl ko) and Prnp–/–/Prnd–/– (PrP/Dpl ko) testis lysates using an anti-Dpl antibody only detected a diffuse band of Dpl immunoreactivity in the wild-type sample. The mobility of molecular weight markers on the same gel is shown. Immunoreactivity against GAPDH in all samples provided an internal control for protein loading. b: Ablation of PrP in the Prnp–/–/Prnd–/– mouse line. Immunoblotting of wild-type (wt), Prnd–/– (Dpl ko) and Prnp–/–/Prnd–/– (PrP/Dpl ko) brain lysates with an anti-PrP antibody only detected PrP immunoreactivity in the wild-type and Prnd–/– samples.

 
Animals from both lines developed normally well into adulthood. Despite Dpl expression in wild-type mouse brain during embryonic development and in neonates, and strong neuronal expression of PrP throughout development and during adulthood, Prnd–/– (n = 6) and Prnp–/–/Prnd–/– animals (n = 8) of older than 90 weeks displayed no obvious neurological abnormalities.

Although Prnd–/– and Prnp–/–/Prnd–/– females reproduced normally, male nulls from both lines never reproduced successfully despite displaying normal mating behavior, as judged by the production of copulation plugs. Furthermore, spermatozoa were recovered from the uteri of females after copulation with Prnd–/– and Prnp–/–/Prnd–/– males, confirming that these animals are capable of ejaculation.

Normal Number, Motility, and Morphology of Prnd–/– and Prnp–/–/Prnd–/– Spermatozoa

The morphological appearance of Prnd–/– and Prnp–/–/Prnd–/– testis was normal, as judged by histological analysis (Figure 3a) , with all spermatogenic cell types present at normal levels. Analysis of sperm extracted from the cauda epididymes revealed no significant differences between wild type and both mutant lines in terms of number, progressive motility, and the presence of head or tail malformations (Figure 3; b to d ). In the case of Prnd–/– sperm, these results contrast directly with those reported for an independently generated Prnd–/– mouse line.22 For this reason and because we were concerned that our simple observations may be missing more subtle motility differences, we also performed a computer-assisted sperm analysis. With the exception of a (just) significant increase in the amplitude of lateral head displacement in Prnd–/– sperm, no significant differences were found between either type of mutant and control sperm for any of the parameters of sperm motility measured (Table 1) .



View larger version (65K):
[in this window]
[in a new window]
  		Figure 3. Spermatogenesis in Prnd–/– and Prnp–/–/Prnd–/– mouse lines. a: H&E-stained testis sections from wild-type, Prnd–/–, and Prnp–/–/Prnd–/– mice, showing normal histology with all spermatogenic cell types present. b: Epididymal sperm counts. Normal counts in wild-type (n = 4 animals examined), Prnd–/– (n = 2), and Prnp–/–/Prnd–/– (n = 4). c: Sperm motility. Normal motility in wild-type (n = 6), Prnd–/– (n = 4), and Prnp–/–/Prnd–/– (n = 4). d: Sperm morphology. Normal morphology with low levels of head and tail abnormalities in wild-type, Prnd–/–, and Prnp–/–/Prnd–/– (all n = 4).

 

View this table:
[in this window]
[in a new window]
  		Table 1. Computer-Assisted Sperm Analysis*

 
Prnd–/– and Prnp–/–/Prnd–/– Sperm Fertilize in Vitro but Only Rarely in Vivo

To gain further insight into the exact nature of the male infertility in our mutant animals, timed matings were set up between wild-type females and wild-type, Prnd–/– or Prnp–/–/Prnd–/– males. Uteri were flushed 1.5 days post coitum and the number of two- and four-cell embryos and unfertilized oocytes counted (Figure 4a) . No cleaved embryos were recovered from matings with Prnd–/– males and only a single embryo from Prnp–/–/Prnd–/– males, compared to 44% cleaved embryos from control males. Thus, Prnd–/– or Prnp–/–/Prnd–/– spermatozoa only rarely successfully fertilize oocytes in vivo.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Fertilization potential of Prnd–/– and Prnp–/–/Prnd–/– sperm. a: Frequency of in vivo and in vitro fertilization by wild-type, Prnd–/–, and Prnp–/–/Prnd–/– sperm. b: Frequency of two-cell stage embryos after in vitro fertilization. Two separate determinations were performed for wild-type, Prnd–/–, and Prnp–/–/Prnd–/– sperm. c: Frequency of two-cell stage embryos, produced by in vitro fertilization, that develop to four-cell and morula stages. Two separate determinations were performed for wild-type, Prnd–/–, and Prnp–/–/Prnd–/–.

 
To test whether mutant spermatozoa are actually incapable of fertilization, or that some other defect is responsible for the lack of successful fertilization in vivo (eg, an inability of mutant sperm to reach the site of fertilization), we performed in vitro fertilization using wild-type, Prnd–/– and Prnp–/–/Prnd–/– spermatozoa with wild-type oocytes. Both Prnd–/– and Prnp–/–/Prnd–/– sperm were able to produce two-cell stage embryos, indicative of successful fertilization (Figure 4, a and b) . The rate of fertilization with mutant sperm was reduced compared to wild type, but this difference was not significant. Two-cell embryos were allowed to develop further in culture and the number developing to the four-cell and morula stages was recorded (Figure 4c) . The percentage of embryos generated from Prnd–/– or Prnp–/–/Prnd–/– sperm that developed to these later stages in vitro was again reduced in comparison to wild-type controls, this time significantly in the case of development to the morula stage (P = 0.04 for Prnd–/–; P = 0.05 for Prnp–/–/Prnd–/– by Student’s t-test). Thus, in addition to a greatly reduced ability to successfully fertilize in vivo, Prnd–/– and Prnp–/–/Prnd–/– sperm have a further defect that prevents embryos generated in vitro progressing beyond all but the earliest stages of development. This early embryonic failure could also contribute to the infertility observed.

Prnd–/– and Prnp–/–/Prnd–/– Sperm Do Not Undergo the Acrosome Reaction in Response to a Calcium Ionophore

The ability of sperm from our Prnd–/– line to fertilize oocytes in vitro contrasts with a previous report on an independently generated Prnd–/– mouse line, which found that mutant sperm was only capable of fertilization in vitro after partial dissection of the zona pellucida.22 This led the authors to propose that a defect in acrosome biogenesis, leading to an inability to perform the acrosome reaction, was the basis of the male infertility. Consequently, we tested the ability of sperm from our Prnd–/– and Prnp–/–/Prnd–/– lines to undergo the acrosome reaction in response to treatment with the calcium ionophore A23187. Sperm from both mutant lines underwent a spontaneous acrosome reaction to the same extent as that from wild-type controls (Figure 5, a and b) . However, unlike controls, mutant sperm failed to show increased levels of the acrosome reaction after exposure to A23187 and this difference was significant (P = 0.02 for both Prnd–/– and Prnp–/–/Prnd–/– by Student’s t-test). Thus, as proposed by Behrens and colleagues,22 the acrosome reaction is indeed defective in Prnd–/– sperm.



View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Defective acrosome reaction in Prnd–/– and Prnp–/–/Prnd–/– sperm. a: Illustration of acrosome-reacted and nonreacted (intact) sperm heads stained with Coomassie blue G-250. b: Frequency of acrosome-reacted sperm in the presence and absence of calcium ionophore A23187 for wild-type (n = 3 separate determinations), Prnd–/– (n = 2), and Prnp–/–/Prnd–/– (n = 3) sperm.

 
Prnd–/– and Prnp–/– /Prnd–/– Spermatozoa Show Increased Levels of DNA Strand Breaks and Altered Chromatin Structure

Any explanation for the early embryonic failure resulting from in vitro fertilization by Prnd–/– and Prnp–/–/Prnd–/– sperm must take into account that the principal contribution of the sperm to the embryo is the paternal genome. If this DNA were damaged it could explain the observed developmental failure that occurs soon after activation of embryonic gene expression. To investigate whether there was altered chromatin structure and DNA damage within the spermatozoa from the mutant lines, the same spermatozoa used for the computer-assisted sperm analysis were assayed for DNA integrity using the SCSA and for DNA strand breaks using the TUNEL assay. In the SCSA the extent of DNA denaturation in each sperm head is quantified by the calculated parameter {alpha}t and the COMP {alpha}t value gives a measure of the number of sperm in the population with increased levels of DNA denaturation. Very strong correlations between COMP {alpha}t values and conventional DNA strand break assays (TUNEL and COMET) have shown that the DNA denaturation measured in the SCSA is primarily because of DNA strand breaks.36,37 The SCSA (Figure 6a) showed significant increases in DNA damage for the two mutant lines over wild type (P = 0.04 for Prnd–/– and P = 0.01 for Prnp–/–/Prnd–/–), but no significant difference between the mutant lines (P = 0.37). Similarly, when DNA strand breaks were measured directly by TUNEL assay (Figure 6b) , a significant increase in the level of damage was observed for the two mutant lines over wild-type (P = 0.05 for both Prnd–/– and Prnp–/–/Prnd–/–), but there was no significant difference between the mutant lines (P = 0.87). Thus, sperm from Prnd–/– and Prnp–/–/Prnd–/– lines has elevated levels of DNA strand breaks and this is because of the lack of Dpl.



View larger version (8K):
[in this window]
[in a new window]
  		Figure 6. a: Levels of DNA damage measured by the SCSA. Prnd–/– and Prnp–/–/Prnd–/– samples show a significant increase in COMP {alpha}t values greater than the wild-type control. Open points represent individual data, filled points represent the means for each genotype (n = 4 independent samples for each genotype). b: Levels of DNA damage measured by the TUNEL assay. Prnd–/– and Prnp–/–/Prnd–/– samples show a significant increase in the frequency of TUNEL-stained sperm greater than the wild-type control. Open points represent individual data, filled points represent the means for each genotype (n = 4 independent samples for each genotype).

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Only mild phenotypic changes have been attributed to the loss of PrPC function in gene-targeted mouse lines. Often the ablation of a protein can be compensated for by the expression of a related protein, thus masking the development of a phenotype. It has been suggested that a PrP-like protein compensates for the loss of PrP in the various Prnp–/– mouse lines, thus preventing the manifestation of a more striking phenotype. If this is the case then our finding that PrP/Dpl double-knockout mice lack any overt neurological phenotype well into adulthood excludes Dpl from having such a role.

Behrens and colleagues22 reported the production of a Prnd–/– mouse line and found that Dpl is essential for male fertility. They discovered a partial blockade of spermiogenesis leading to a reduction in numbers of spermatozoa in the seminiferous tubules and cauda epididymes. Mutant epididymal sperm also had significantly reduced levels of motility and abnormal head and flagellar morphology. In addition, these sperm were found to be incapable of fertilizing oocytes in vitro unless the zona pellucida was partially dissected.

The male sterility phenotypes reported in our Prnd–/– and Prnp–/–/Prnd–/– lines are indistinguishable. This, combined with no reports of reproductive defects in any Prnp–/– lines generated to date, strongly suggests that PrPC does not have a fundamental role in male reproductive function, although it can protect sperm cells from environmental damage under certain circumstances. Surprisingly though, the nature of the infertility reported in our Prnd–/– (and Prnp–/–/Prnd–/–) males differs in a number of important aspects from that described by Behrens and colleagues.22 Firstly, we find no differences between mutant and control animals in epididymal sperm concentration, motility (even using computer-assisted sperm analysis), and morphology. Secondly, although mutant sperm only rarely fertilize oocytes in vivo, they can (unlike those of Behrens and colleagues22 ) successfully fertilize in vitro, albeit at reduced frequencies compared to control sperm. The calcium ionophore A23187 is commonly used to induce the acrosome reaction in capacitated sperm. We found that treating sperm from our mutant lines with A23187 failed to induce the acrosome reaction. Based on the observation that sperm from their Prnd–/– line displayed sperm head abnormalities and were incapable of fertilization in vitro unless the zona pellucida was partially dissected, Behrens and colleagues22 proposed that Dpl was involved in acrosome biogenesis. Our results support this hypothesis, and explain the reduced rate of fertilization observed in vitro for our Prnd–/– sperm. Studies on other male sterile mouse mutants have found that an inability to perform the acrosome reaction in response to A23187 correlates with a reduced rate of fertilization in vitro eg, Tnp2- and Dax-1-deficient mouse lines.33,38

The reasons for the differences in the infertility phenotype between the different Prnd–/– lines may lie in their different genetic backgrounds. All of our mice are kept on an inbred 129/Ola background, whereas those of Behrens and colleagues22 are on a mixed C57BL6/CBA background. Background related differences in male infertility phenotypes have been reported in other targeted mouse mutants, including the sperm mitochondria-associated cysteine-rich protein, transition proteins 1 and 2, and desert hedgehog genes.38-41

In addition to a greatly reduced ability to fertilize in vivo, Prnd–/– and Prnp–/–/Prnd–/– sperm are unable to support the development of embryos generated in vitro beyond the morula stage. This suggests that Dpl plays an important role in a second area of sperm function. What could this be? In the mouse the centrosome is provided by the oocyte, not the sperm.42 Thus, the contribution that a sperm makes to embryonic development is primarily restricted to providing the paternal genome. If this DNA is damaged then early embryonic failure might be anticipated soon after the activation of embryonic gene transcription, because many forms of damage will prevent transcription. In the mouse many embryonic genes are switched on at the two-cell stage.43 Alternatively, unrepaired DNA damage could lead to genome instability and embryonic failure during the rapid early cleavage divisions. Targeted disruption of DNA repair genes, Rad51 and Brca1, leads to preimplantation and early postimplantation lethality, respectively.44,45 We demonstrated increased levels of DNA damage in Prnd–/– and Prnp–/–/Prnd–/– sperm using two independent assays. The simple SCSA, in which increased levels of DNA denaturation correlate closely with increased DNA strand breaks measured by the more direct, but laborious TUNEL and COMET assays.36,37 These results were confirmed by TUNEL assay. In human fertility clinics a high level of DNA damage in sperm (measured as a high percentage of sperm in the sample with high levels of DNA denaturation outside the normal range) is the best predictor for infertility.34 It is tempting to speculate that the elevated levels of DNA strand breaks in Prnd–/– and Prnp–/–/Prnd–/– sperm are the cause of the early embryonic failure we observed after in vitro fertilization. We have observed a very low level of in vivo fertilization with mutant sperm, but have never seen live births. The failure of these embryos to develop could also be because of the DNA damage in Prnd–/– and Prnp–/–/Prnd–/– sperm.

Endogenously generated reactive oxygen species are a potent cause of DNA strand breaks and exposure of sperm to hydrogen peroxide causes increased DNA denaturation in the SCSA.34 The involvement of PrP in antioxidant defenses against reactive oxygen species in the central nervous system and reproductive system has been suggested. Studies in vivo, on the brains of PrP-null mouse lines, and in vitro, on primary neuronal cultures derived from these lines, have revealed a reduction in the activities of the antioxidant enzymes SOD1 and glutathione reductase in the absence of PrP.46,47 Additionally, cultured PrP-deficient neurons were found to have increased susceptibility to hydrogen peroxide or oxygen-free radical toxicity. Furthermore, we have found evidence of oxidative stress-induced damage in the form of increased levels of protein oxidation and lipid peroxidation in the brains of the Dpl-expressing ataxic, Rcm0, line as compared with the nonataxic, Npu, line.48 The oxidative stress proteins, heme-oxygenase-1 and nitric oxide synthase were also induced in the brains of these mice. The abrogation of the ataxic phenotype in the Ngsk line by the introduction of a PrP-expressing transgene suggests a possible antagonistic interaction between PrPC and ectopically expressed Dpl with respect to their involvement in oxidative stress in the central nervous system.10 The situation may be different in the testis with Dpl rather than PrPC having the leading role in protection from oxidative stress. This would certainly be compatible with the elevated levels of oxidative DNA damage observed in Prnd–/– and Prnp–/–/Prnd–/– sperm.

In summary, we have found no evidence that Dpl compensates for the loss of PrP expression in Prnp–/– targeted mouse lines, but it is required for spermatozoa to perform the acrosome reaction and therefore for fertilization in vivo. Furthermore Dpl is also required for sperm to contribute to embryonic development beyond the morula stage and the elevated levels of DNA damage observed in Prnd–/– sperm indicate that it is involved in protection from oxidative stress. Further insight into the function of Dpl could be important for two reasons. Firstly, it might facilitate a greater understanding of the role of the structurally similar PrP, which could have major implications for treatment of transmissible spongiform encephalopathies. Secondly, human mutations in Dpl may be responsible for a subset of male infertility cases. The Prnd–/– mouse strain could thus provide an invaluable tool for the understanding of male infertility and the development of much needed therapies.


   Acknowledgements
 
We thank Alison Murray and Norah Spears (Division of Biomedical and Clinical Laboratory Sciences) for their assistance with the in vitro fertilization work; Haley Scott and Jenny Templeman (Medical Research Council Human Reproductive Sciences Unit) for computer-assisted sperm analysis; and Dr. Iain Sylvester (Institute of Animal Health, Compton) for kindly providing the anti-Dpl antisera.


   Footnotes
 
Address reprint requests to Prof. David W. Melton, Sir Alastair Currie Cancer Research UK Laboratories, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Crewe Rd., Edinburgh EH4 2XU, UK. E-mail: david.melton{at}ed.ac.uk

Supported by the Medical Research Council (grant G9818420).

Accepted for publication February 2, 2004.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bueler H, Fischer M, Lang Y, Bluethmann H, Lipp HP, DeArmond SJ, Prusiner SB, Aguet M, Weissmann C: Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature 1992, 356:577-582[Medline]
  2. Manson JC, Clarke AR, Hooper ML, Aitchison L, McConnell I, Hope J: 129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal. Mol Neurobiol 1994, 8:121-127[Medline]
  3. Collinge J, Whittington MA, Sidle KCL, Smith CJ, Palmer MS, Clarke AR, Jefferys JGR: Prion protein is necessary for normal synaptic function. Nature 1994, 370:295-297[Medline]
  4. Tobler I, Gaus SE, Deboer T, Achermann P, Fischer M, Rulicke T, Moser M, Oesch B, McBride PA, Manson JC: Altered circadian activity rhythms and sleep in mice devoid of prion protein. Nature 1996, 380:639-642[Medline]
  5. Sakaguchi S, Katamine S, Nishida N, Moriuchi R, Shigematsu K, Sugimoto T, Nakatani A, Kataoka Y, Houtani T, Shirabe S, Okada H, Hasegawa S, Miyamoto T, Noda T: Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene. Nature 1996, 380:528-531[Medline]
  6. Moore RC, Redhead NJ, Selfridge J, Hope J, Manson JC, Melton DW: Double replacement gene targeting for the production of a series of mouse strains with different prion protein gene alterations. Biotechnology 1995, 13:999-1004[Medline]
  7. Rossi D, Cozzio A, Flechsig E, Klein MA, Rulicke T, Aguzzi A, Weissmann C: Onset of ataxia and Purkinje cell loss in PrP null mice inversely correlated with Dpl level in brain. EMBO J 2001, 20:694-702[Medline]
  8. Moore RC, Lee IY, Silverman GL, Harrison PM, Strome R, Heinrich C, Karunaratne A, Pasternak SH, Chishti MA, Liang Y, Mastrangelo P, Wang K, Smit AFA, Katamine S, Carlson GA, Cohen FE, Prusiner SB, Melton DW, Tremblay P, Hood LE, Westaway D: Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein Doppel. J Mol Biol 1999, 292:797-817[Medline]
  9. Moore RC, Mastrangelo P, Bouzamondo E, Heinrich C, Legname G, Prusiner SB, Hood L, Westaway D, DeArmond SJ, Tremblay P: Doppel-induced cerebellar degeneration in transgenic mice. Proc Natl Acad Sci USA 2001, 98:15288-15293[Abstract/Free Full Text]
  10. Nishida N, Tremblay P, Sugimoto T, Shigematsu K, Shirabe S, Petromilli C, Erpel SP, Nakaoke R, Atarashi R, Houtani T, Torchia M, Sakaguchi S, DeArmond SJ, Prusiner SB, Katamine S: A mouse prion protein transgene rescues mice deficient for the prion protein gene from Purkinje cell degeneration and demyelination. Lab Invest 1999, 79:689-697[Medline]
  11. Silverman GL, Qin K, Moore RC, Yang Y, Mastrangelo P, Tremblay P, Prusiner SB, Cohen FE, Westaway D: Doppel is an N-glycosylated, glycosylphosphatidylinositol-anchored protein. Expression in testis and ectopic production in the brains of Prnp(0/0) mice predisposed to Purkinje cell loss. J Biol Chem 2000, 275:26834-26841[Abstract/Free Full Text]
  12. Brown DR, Qin K, Herms JW, Madlung A, Manson J, Strome R, Fraser PE, Kruck T, von Bohlen A, Schulz-Schaeffer W, Giese A, Westaway D, Kretzschmar H: The cellular prion protein binds copper in vivo. Nature 1997, 390:684-687[Medline]
  13. Qin K, Coomaraswamy J, Mastrangelo P, Yang Y, Lugowski S, Petromilli C, Prusiner SB, Fraser PE, Goldberg JM, Chakrabartty A, Westaway D: The PrP-like protein Doppel binds copper. J Biol Chem 2003, 278:8888-8896[Abstract/Free Full Text]
  14. Mo H, Moore RC, Cohen FE, Westaway D, Prusiner SB, Wright PE, Dyson HJ: Two different neurodegenerative diseases caused by proteins with similar structures. Proc Natl Acad Sci USA 2001, 98:2352-2357[Abstract/Free Full Text]
  15. Atarashi R, Nishida N, Shigematsu K, Goto S, Kondo T, Sakaguchi S, Katamine S: Deletion of N-terminal residues 23–88 from prion protein (PrP) abrogates the potential to rescue PrP-deficient mice from PrP-like protein/Doppel-induced neurodegeneration. J Biol Chem 2003, 278:28944-28949[Abstract/Free Full Text]
  16. Flechsig E, Hegyi I, Leimeroth R, Zuniga A, Rossi D, Cozzio A, Schwarz P, Rülicke T, Götz J, Aguzzi A, Weissmann C: Expression of truncated PrP targeted to Purkinje cells of PrP knockout mice causes Purkinje cell death and ataxia. EMBO J 2003, 22:3095-3101[Medline]
  17. Li A, Sakaguchi S, Shigematsu K, Atarashi R, Roy BC, Nakaoke R, Arima K, Okimura N, Kopacek J, Katamine S: Physiological expression of the gene for PrP-like protein, PrPLP/Dpl, by brain endothelial cells and its ectopic expression in neurons of PrP-deficient mice ataxic due to Purkinje cell degeneration. Am J Pathol 2000, 157:1447-1452[Abstract/Free Full Text]
  18. Tuzi NL, Gall E, Melton D, Manson JC: Expression of Doppel in the CNS of mice does not modulate transmissible spongiform encephalopathy disease. J Gen Virol 2002, 83:705-711[Abstract/Free Full Text]
  19. Behrens A, Brandner S, Genoud N, Aguzzi A: Normal neurogenesis and scrapie pathogenesis in neural grafts lacking the prion protein homologue Doppel. EMBO Rep 2001, 2:347-352[Medline]
  20. Mead S, Beck J, Dickinson A, Fisher EMC, Collinge J: Examination of the human prion protein-like gene Doppel for genetic susceptibility to sporadic and variant Creutzfeldt-Jakob disease. Neurosci Lett 2000, 290:117-120[Medline]
  21. Peoc’h K, Guerin C, Brandel JP, Launay JM, Laplanche JL: First report of polymorphisms in the prion-like protein gene (PRND): implications for human prion diseases. Neurosci Lett 2000, 286:144-148[Medline]
  22. Behrens A, Genoud N, Naumann H, Rulicke T, Janett F, Heppner FL, Ledermann B, Aguzzi A: Absence of the prion protein homologue Doppel causes male sterility. EMBO J 2002, 21:3652-3658[Medline]
  23. Peoc’h K, Serres C, Frobert Y, Martin C, Lehmann S, Chasseigneaux S, Sazdovitch V, Grassi J, Jouannet P, Launay JM, Laplanche JL: The human "prion-like" protein Doppel is expressed in both Sertoli cells and spermatozoa. J Biol Chem 2002, 277:43071-43078[Abstract/Free Full Text]
  24. Shaked Y, Rosenmann H, Talmor G, Gabizon R: A C-terminal-truncated PrP isoform is present in mature sperm. J Biol Chem 1999, 274:32153-32158[Abstract/Free Full Text]
  25. Selfridge J, Pow AM, McWhir J, Magin TM, Melton DW: Gene targeting using a mouse HPRT minigene/HPRT-deficient embryonic stem cell system: inactivation of the mouse ERCC-1 gene. Som Cell Mol Genet 1992, 18:325-336[Medline]
  26. Magin TM, McEwan C, Milne M, Pow AM, Selfridge J, Melton DW: A position and orientation dependent element in the first intron is required for expression of the mouse HPRT gene in embryonic stem cells. Gene 1992, 122:289-296[Medline]
  27. Thompson S, Clarke AR, Pow AM, Hooper ML, Melton DW: Germ line transmission of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 1989, 56:313-321[Medline]
  28. Tash JS, Bracho GE: Identification of phosphoproteins coupled to initiation of motility in live epididymal mouse sperm. Biochem Biophys Res Commun 1998, 251:557-563[Medline]
  29. Chapin RE, Sloane RA, Haseman JK: The relationships among reproductive endpoints in Swiss mice, using the reproductive assessment by Continuous Breeding database. Fundam Appl Toxicol 1997, 38:129-142[Medline]
  30. : WHO: WHO Laboratory Manual for the Examination of Human Semen and Sperm—Cervical Mucus Interaction ed 4 1999:90-93 Cambridge University Press Cambridge
  31. Quinn P, Barros C, Whittingham DG: Preservation of hamster oocytes to assay the fertilizing capacity of human spermatozoa. J Reprod Fertil 1982, 66:161-168[Abstract/Free Full Text]
  32. Devreker F, Hardy K: Effects of glutamine and taurine on preimplantation development and cleavage of mouse embryos in vitro. Biol Reprod 1997, 57:921-928[Abstract]
  33. Jeffs B, Ito M, Yu RN, Martinson FA, Wang ZJ, Doglio LT, Jameson JL: Sertoli cell-specific rescue of fertility, but not testicular pathology, in Dax1 (Ahch)-deficient male mice. Endocrinology 2001, 142:2481-2488[Abstract/Free Full Text]
  34. Evenson DP, Jost LK, Marshall D, Zinaman MJ, Clegg E, Purvis K, de Angelis P, Claussen OP: Utility of the sperm chromatin structure assay as a diagnostic and prognostic tool in the human fertility clinic. Hum Reprod 1999, 14:1029-1049
  35. Gavrieli Y, Sherman Y, Ben-Sasson SA: Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 1992, 119:493-501[Abstract/Free Full Text]
  36. Gorczyca W, Gong JP, Darzynkiewicz Z: Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res 1993, 53:1945-1951[Abstract/Free Full Text]
  37. Singh NP, McCoy MT, Tice RR, Schneider EL: A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 1988, 175:184-191[Medline]
  38. Adham IM, Nayernia K, Burkhardt-Gottges E, Topaloglu O, Dixkens C, Holstein AF, Engel W: Teratozoospermia in mice lacking the transition protein 2 (Tnp2). Mol Hum Reprod 2001, 7:513-520[Abstract/Free Full Text]
  39. Nayernia K, Adham IM, Burkhardt-Gottges E, Neesen J, Rieche M, Wolf S, Sancken U, Kleene K, Engel W: Asthenozoospermia in mice with targeted deletion of the sperm mitochondrion-associated cysteine-rich protein (Smcp) gene. Mol Cell Biol 2002, 22:3046-3052[Abstract/Free Full Text]
  40. Yu YE, Zhang Y, Unni E, Shirley CR, Deng JM, Russell LD, Weil MM, Behringer RR, Meistrich ML: Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice. Proc Natl Acad Sci USA 2000, 97:4683-4688[Abstract/Free Full Text]
  41. Bitgood MJ, Shen L, McMahon AP: Sertoli cell signaling by desert hedgehog regulates the male germline. Curr Biol 1996, 6:298-304[Medline]
  42. Schatten H, Schatten G, Mazia D, Balczon R, Simerly C: Behavior of centrosomes during fertilization and cell division in mouse oocytes and in sea urchin eggs. Proc Natl Acad Sci USA 1986, 83:105-109[Abstract/Free Full Text]
  43. Kidder GM: The genetic program for preimplantation development. Dev Genet 1992, 13:319-325[Medline]
  44. de Boer J, Donker I, de Wit J, Hoeijmakers JH, Weeda G: Disruption of the mouse xeroderma pigmentosum group D DNA repair/basal transcription gene results in preimplantation lethality. Cancer Res 1998, 58:89-94[Abstract/Free Full Text]
  45. Liu CY, Flesken-Nikitin A, Li S, Zeng Y, Lee WH: Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev 1996, 10:1835-1843[Abstract/Free Full Text]
  46. Brown DR, Schulz-Schaeffer WJ, Schmidt B, Kretzschmar HA: Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Exp Neurol 1997, 146:104-112[Medline]
  47. White AR, Collins SJ, Maher F, Jobling MF, Stewart LR, Thyer JM, Beyreuther K, Masters CL, Cappai R: Prion protein-deficient neurons reveal lower glutathione reductase activity and increased susceptibility to hydrogen peroxide toxicity. Am J Pathol 1999, 155:1723-1730[Abstract/Free Full Text]
  48. Wong BS, Liu T, Paisley D, Li RL, Pan T, Chen SG, Perry G, Petersen RB, Smith MA, Melton DW, Gambetti P, Brown DR, Sy MS: Induction of HO-1 and NOS in Doppel-expressing mice devoid of PrP: implications for Doppel function. Mol Cell Neurosci 2001, 17:768-775[Medline]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
J. Dong, A. Li, N. Yamaguchi, S. Sakaguchi, and D. A. Harris
Doppel Induces Degeneration of Cerebellar Purkinje Cells Independently of Bax
Am. J. Pathol., August 1, 2007; 171(2): 599 - 607.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
C. Serres, K. Peoc'h, A.M. Courtot, C. Lesaffre, P. Jouannet, and J.L. Laplanche
Spatio-Developmental Distribution of the Prion-Like Protein Doppel in Mammalian Testis: A Comparative Analysis Focusing on Its Presence in the Acrosome of Spermatids
Biol Reprod, May 1, 2006; 74(5): 816 - 823.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paisley, D.
Right arrow Articles by Melton, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paisley, D.
Right arrow Articles by Melton, D. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS