| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |










From UMR369 INSERM /Université Claude Bernard-Lyon 1 and Institut Fédératif de Recherche 62,* Faculté de Médecine Lyon-RTH Laennec, Lyon; Unité Fonctionnelle de Biologie Cellulaire,
Hôpital Edouard-Herriot, Lyon; Lyon Thyroid Tumor Bank Organization,
Lyon; and INSERM U494 and Service dAnatomie Patholologique,
Hôpital Ambroise Paré, Boulogne-Billancourt, France
| Abstract |
|---|
|
|
|---|
50% of tumors contained hNIS transcripts. This dissociation between transcript and protein levels was not found for the transcript and protein encoded by the PDS gene assayed in the same tumors. The hNIS transcript-positive tumors contained small amounts of low-molecular mass hNIS-immunoreactive species identified as nonglycosylated hNIS. Tumors containing the nonmature form of hNIS exhibited a predominant intracellular immunolabeling. In conclusion, our data show that benign and malignant hypofunctioning thyroid tumors either no longer express hNIS protein or express only a very low amount of nonglycosylated hNIS and indicate that the impairment of hNIS gene expression might result from alterations at both transcriptional and posttranscriptional levels.
To try to get new information on this debated issue, we decided to investigate the alterations of hNIS gene expression occurring in thyroid tumors by analyzing hNIS transcript and hNIS protein levels in the same tumors. For this purpose, we set up a semiquantitative Western blot procedure, an approach not used in previous studies, to assess the hNIS protein content of tumors as compared to that of paired normal tissue, and we assayed hNIS transcript by a commonly used RT-PCR procedure coupled to Southern blot to increase the sensitivity of hNIS amplicon detection. Results from these combined approaches prompted us to examine the relationship between the expressed forms of hNIS and the cellular distribution of hNIS immunoreactivity in the same tumors and paired normal thyroid tissue. We confirm that the hNIS gene expression is impaired in all hypofunctioning thyroid tumors and we show that the impairment results from transcriptional alterations but also from alterations at posttranscriptional levels, including translation, maturation, and plasma membrane targeting of the protein.
| Materials and Methods |
|---|
|
|
|---|
Thyroid tissue samples were taken from the Lyon Thyroid Tumor Bank set up since 1998 at the Lyon University Hospital Center as previously described.16 Tissue samples weighing 50 to 200 mg, quickly frozen in liquid nitrogen and stored at 80°C, consisted of paired samples, benign or malignant thyroid tumors, and surrounding normal tissue (NT). Pathological and clinical annotations were anonymously associated with thyroid tissue samples classified according to World Health Organization recommendations. This study was performed on 22 unselected hypofunctioning tumors (3 FAs and 19 TCs) and paired NT samples. Among the carcinomas, 17 were papillary thyroid carcinomas (PTCs) and 2 were follicular thyroid carcinomas (FTCs). The 22 paired samples were available in duplicate or triplicate. Three toxic adenomas or TA and paired NT were used as positive (TA) or negative (paired NT) controls in the hNIS protein assay. Hypofunctioning tumor samples were obtained from euthyroid patients at the time of surgery except four patients with PTC known to be under T4 therapy before surgery. The three patients with TA presented a low serum thyroid-stimulating hormone (TSH) concentration (below 0.05 mU/L) and a hot nodule (extinctive for the adjacent NT) at thyroid scintigraphy. Thyroid scintigraphy was performed in 14 of the 22 patients with TC or FA; in all cases, the nodules appeared hypofunctioning. Patients with FA were two males and one female (mean age, 37 years) and patients with TC were 7 males and 12 females (mean age ± SD, 43 ± 15 years). According to the TNM classification, nine TCs were classified as grade I, six as grade II, and four as grade III. This study was approved by the supervision interdisciplinary committee of the Tumor Bank and performed in accordance with protocols previously approved by the local human studies committee.
Preparation and Testing of Antibodies
A peptide corresponding to the C-terminal sequence (amino acids 630 to 643) of hNIS (Swiss Prot Bank access no. Q92911) was generated by solid phase synthesis. The purified peptide, conjugated to keyhole limpet hemocyanin using glutaraldehyde, was used to immunize rabbits according to standard procedures. One immune serum, polyclonal antibody (pAb) 795, with a high anti-peptide antibody titer in enzyme-linked immunosorbent assay (higher than 1 x 106), was selected for subsequent studies. Immunological detection of hNIS by Western blot or immunohistochemistry was performed using the purified IgG fraction.
Western Blot Analyses
Frozen tissue samples were rapidly weighed and homogenized in ice-cold phosphate-buffered saline (PBS) (1 ml/100 mg tissue) supplemented with protease inhibitors (apoprotinin, peptasin, leupeptin, each at a concentration of 1 µg/ml) using a Teflon-glass Potter homogenizer. Homogenates were centrifuged at 100,000 x g for 30 minutes at 4°C to obtain the crude thyroid membrane fractions. The pelleted material was suspended in 1 ml of PBS containing protease inhibitors, and aliquots were frozen at 80°C. Protein was assayed by the Lowry method after solubilization in 0.1% sodium deoxycholate. The total amount of protein per mass of tissue and the proportion of membrane protein (100,000 x g pellet) obtained from tumors (FA, PTC, or TA) and paired NT samples were very similar;16
protein of the crude membrane fractions represented 25 to 35% of total protein. Membrane proteins (1 to 180 µg of protein) were subjected to electrophoresis on 7.5% acrylamide gel in the presence of sodium dodecyl sulfate (SDS) and electrotransferred onto Immobilon P membranes (Millipore Corp., Bedford, MA). Membranes were preincubated in PBS supplemented with 5% nonfat dry milk and 0.2% Tween 20 for 1 hour at room temperature and then incubated overnight at 4°C with the IgG fraction from pAb 795 immune serum (5 to 30 µg/ml) in the same buffer. After washes in 0.2% Tween PBS, membranes were incubated with a goat anti-rabbit IgG conjugated to horseradish peroxidase (Biorad Laboratoires Inc., Marnes la Coquette, France) for 1 hour at room temperature. Immune complexes were revealed by the enhanced chemiluminescence method using the enhanced chemiluminescent substrate from Amersham Biosciences (Orsay, France) and exposed to Kodak X-Omat AR films (Eastman Kodak Co., Rochester, NY). In a second step, the same membranes were incubated with a monoclonal antibody (mAb) directed against the
-subunit of Na+,K+-adenosine triphosphatase (Na+,K+-ATPase) at a final dilution of 1:25,00016
and then with a biotinylated goat anti-mouse Ig from Amersham Biosciences. Immune complexes were visualized using streptavidin conjugated to alkaline phosphatase and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate as substrate. Western blot signals from the enhanced chemiluminescence (hNIS) and alkaline phosphatase (Na+,K+-ATPase
-subunit) reactions were quantified as previously reported16
and expressed in luminance values. The
-subunit of the Na+,K+-ATPase was used to control the amount of protein subjected to the hNIS Western blot assay. To compare signals obtained from the large number of Western blot membranes required for the serial analyses in duplicate or triplicate of more than 50 tissue samples, a NT membrane preparation (H2) was included on each Western blot and used as an internal reference.
Detection of hNIS Transcripts by RT-PCR and Southern Blot
Total RNA was isolated from thyroid tissues using the acid guanidinium thiocyanate-phenol-chloroform method according to Chomczynski and Sacchi.17
The RNA concentration was determined by absorbance measurements at 260 nm, and RNA purity and integrity were assessed by determination of the A260/A280 ratio and electrophoresis on 1% agarose, followed by ethidium bromide staining of 28S and 18S RNA. Reverse-transcription was performed on total RNA. Human NIS cDNAs were synthesized from 3 µg of total RNA using 200 U Moloney murine leukemia virus reverse transcriptase in 20 µl of the following buffer (7 mmol/L MgCl2, 40 mmol/L KCl, 10 mmol/L dithiothreitol, 100 µg/ml bovine serum albumin, 50 mmol/L Tris-HCl, pH 8.3) containing 2 mmol/L of each dNTP and 25 U RNAsin (Promega Corp., Madison, WI). The reverse transcription was initiated by the addition of 10 pmol of the downstream primer: 1064GAGCCGCTATACATTCTGGA1083 complementary to a 3'-region of the hNIS cDNA (anti-sense primer). After 60 minutes at 42°C, the reaction mixture was heated at 95°C for 5 minutes to inactivate the reverse transcriptase and to denature the cDNA-RNA hybrids. Reverse transcription products were then amplified by PCR with the sense primer: 630CTTCTGAACTCGGTCCTCAC649. The reaction mixture (100 µl) contained 10 µl of the reverse transcription solution and 90 µl of the PCR buffer (50 mmol/L KCl, 2.5 mmol/L MgCl2, 2 mmol/L dNTP, 2 mmol/L dithiothreitol, 10 mmol/L Tris-HCl, pH 8.3) supplemented with the sense primer and 0.5 U Thermus aquaticus DNA polymerase (Promega Corp.). Samples were then submitted to 35 cycles of amplification (1 minute at 94°C for denaturation, 1 minute at 58°C for annealing, and 2 minutes at 72°C for extension). Amplified products were analyzed by electrophoresis on 1% agarose gels, stained with 0.5 µl/ml ethidium bromide and transferred to positively charged nylon membranes (Amersham Biosciences). Amplicons were identified by hybridization with a hNIS[32P]-labeled cDNA probe. After hybridization, the nylon membrane was washed twice at 42°C with 2x standard saline citrate (SSC), twice at 60°C with 2x SSC and 0.5% SDS, and twice at the same temperature with 0.2x SSC and 1% SDS, and then exposed to X-ray film at 80°C with an intensifier screen. The 0.8-kb hNIS cDNA probe, generated by RT-PCR using a pair of hNIS-specific primers (sense primer: nucleotides 799 to 820; anti-sense primer: nucleotides 1551 to 1571), was cloned into the PGEMT vector (Promega Corp.). The 0.8-kb hNIS cDNA insert was radiolabeled with [
-32P] dCTP (3000 Ci/mmol) by the random oligonucleotide primed synthesis kit from Roche Diagnostics (Meylan, France). The specific radioactivity of the cDNA probe ranged from 7 to 10 x 108 counts/minute/µg.
Thyroglobulin (Tg) transcripts were reverse-transcribed from the same RNA preparations using the following primers: 570GCCTGTCCAGTGCAAATTTGTCAAC594 (sense primer) and 1086CTTGTGCCTCCGAAAGGCAGCAGG1111 (anti-sense primer). Reaction conditions were the same as those mentioned above with the following modifications: the reverse transcription was performed from 1.5 µg of total RNA and the PCR amplification was performed from 1 µl of a 1:75 dilution of the cDNA template solution using 3.5 mmol/L of MgCl2, and an annealing temperature of 60°C. Samples were submitted to 30 cycles of amplification. Amplicons were analyzed by electrophoresis on 2% agarose gel and stained with 0.5 µg/ml of ethidium bromide. Quantification of signals was performed as previously described.16
Immunohistochemical Analyses
Formalin-fixed tissue samples were embedded in paraffin. Morphological analyses of hematoxylin and eosin-stained tissue were performed on 4-µm-thick sections. Tissue sections in 0.1 mol/L citrate, pH 7.0, were treated for 40 minutes at 90°C for antigen retrieval. After washes in PBS, endogenous peroxidase activity was blocked by a 15-minute treatment in 5% H2O2 in water. Sections were then incubated with pAb 795 IgG (20 µg/ml) for 1 hour at room temperature. Immune complexes were detected using biotinylated goat anti-rabbit Ig antibodies and streptavidin-peroxidase from DAKO (Carpinteria, CA); the color reaction was developed using 3,3-diaminobenzidine as substrate. After nuclear staining with hemalun, glass slides were mounted and observed at magnification ranging from x40 to x1000. Negative controls, including nonimmune IgG or omission of the first antibody, were performed in parallel.
| Results |
|---|
|
|
|---|
The Western blot analysis of membrane fractions from normal human thyroid tissue using pAb 795 IgG revealed a band migrating as a 75- to 80-kd species (Figure 1A)
, corresponding to glycosylated hNIS (as demonstrated farther in the article). An additional hNIS-immunoreactive species with an apparent molecular mass ranging from 50 to 55 kd was detected at high thyroid membrane protein input (Figure 1A)
. Neither the 75- to 80-kd band nor the low-molecular mass immunoreactive species were observed when pAb 795 IgG were replaced by control IgG. pAb 795 IgG detected the 75- to 80-kd hNIS from 3 to 10 µg of membrane protein prepared from normal thyroid tissue (NT). The hNIS signal intensity was proportional to the membrane protein input over a 10-fold protein concentration range (Figure 1B)
. The cellular location of the pAb 795 IgG-labeled material was examined on paraffin-embedded NT sections. The immunoreactivity was primarily located at the basolateral plasma membrane of polarized thyroid epithelial cells (Figure 1, C and D)
. A definite intracellular labeling, likely membrane-associated, was also observed. Nonepithelial cells (probably endothelial cells or fibroblasts) in the vicinity of the thyroid follicles were not stained.
|
10 times lower than that of the NT. The fractions of total RNA retro-transcribed that were chosen for subsequent semiquantitative assays of hNIS and Tg transcripts were 1/2 and 1/750, respectively. These conditions were chosen to have the highest sensitivity in the hNIS transcript assay and a good accuracy in the Tg transcript determination.
|
hNIS protein and hNIS transcript were assayed on duplicate samples of 20 hypofunctioning tumors and paired NT (3 FAs and 17 TCs). Western blot signals obtained from 7 representative paired samples of the 20 and from 1 TA are shown on Figure 3A
. RT-PCR/Southern blot signals obtained from the same tumor/NT paired samples are shown in Figure 3B
. Values obtained by quantification of hNIS protein and hNIS transcript signals corresponding to the 20 hypofunctioning tumors and paired NT, are reported in Figure 4
.
|
|
hNIS transcripts were detected in 20 of 20 NT samples, including the 4 NT samples that were hNIS protein-negative, and in 11 of 20 tumors (2 of 3 FAs and 9 of 17 TCs). In the 11 tumors, in which hNIS transcripts were detected, the average signal intensity (expressed in arbitrary units) was 14 ± 4 versus 47 ± 4 (mean ± SEM) for the paired NT. By reference to the standard plot of Figure 2C
, this decrease in signal intensity corresponded to a 10-fold reduction in hNIS transcript content.
Data of Figures 3 and 4
show that there was a dissociation between hNIS protein and hNIS transcript contents in 15 of the 40 samples: 11 tumors and the 4 NT samples from T4-treated patients. As the lack of detection of hNIS protein in samples containing hNIS transcript could simply be because of a lack of sensitivity of the protein detection method, samples giving discordant results were subjected to Western blot assay at high membrane protein input, ie, 180 µg (instead of 30 µg). In no case could the 75- to 80-kd hNIS protein be detected. This is illustrated for three tumors (FA5, PTC8, and PTC11) and one NT (NTa) in Figure 5A
; these samples contained hNIS transcripts but no 75- to 80-kd protein. To determine whether the dissociation between transcript and protein levels was a general feature of hypofunctioning tumors, transcripts of the PDS gene and the corresponding protein, pendrin (another membrane protein with an iodide transport activity), were assayed in the same tumors and NT samples, as previously described.16
Transcripts from the PDS gene and pendrin were detected in all samples. Data from four paired samples are reported in Figure 5B
. As compared to NT, PDS transcripts and pendrin were decreased by 30 to 50% in hypofunctioning thyroid tumors. There was a relationship between transcript and protein levels (Figure 5B)
; tumors exhibiting a decreased PDS transcript level had a decreased pendrin content. The pendrin to PDS transcript ratio estimated from signal quantification values corresponding to the 13 PTC/NT paired samples (analyzed for their hNIS transcript and protein contents in Figure 4
) was not statistically different in tumors and NT (0.90 ± 0.18 versus 1.28 ± 0.25).
|
Western blot analyses performed at high membrane protein input reported in Figure 5A
revealed that tumors (as well as NT from T4-treated patients) containing hNIS transcripts contained hNIS-immunoreactive species with an apparent molecular mass ranging from 50 to 55 kd. These immunoreactive species were not detected in hNIS transcript-negative samples such as PTC13 (Figure 5A)
. Given their size, we thought they could correspond to nonmature form of hNIS. To test this hypothesis, we generated hNIS maturation intermediates by deglycosylation using N-glycosidase F (Figure 6)
and we compared the electrophoretic properties of the deglycosylated forms of hNIS with those of the low-molecular mass immunoreactive species identified in tumors and unstimulated NT (Figure 7)
. Treatment of thyroid membrane fractions by N-glycosidase F in the presence of SDS led to the transformation of the 75- to 80-kd hNIS protein into a main component of
50 kd, likely representing the nonglycosylated (nG) hNIS polypeptide chain as found for rat NIS.18,19
In the absence of SDS, the enzyme had a lower efficiency and generated two main intermediate forms and a low amount of the 50-kd species. The hNIS deglycosylation pattern (Figure 6)
composed of two partially glycosylated forms named pG1, pG2, and nG was reproducibly obtained. The electrophoretic mobility of another membrane protein, the
-subunit of Na+/K+-ATPase, a nonglycosylated protein, was not modified by the enzyme treatment. The low-molecular mass hNIS-immunoreactive species, detected in hypofunctioning tumors and unstimulated NT, exactly co-migrated with the nG form of hNIS; this is shown for an unstimulated NT (paired to a TA) and two tumors (FTC4 and PTC22) in Figure 7
. The nG and/or the pG1 forms of hNIS were present in low amounts in NT (from euthyroid patients) and hyperfunctioning tissue (TA) containing mature hNIS. The nG form of hNIS was also detected in a lymph node metastasis (LNM) of a PTC, devoid of the 75- to 80-kd mature hNIS.
|
|
Tumor/NT-paired samples analyzed by Western blot in Figure 7
were processed for immunohistochemical detection of hNIS immunoreactivity (Figure 8)
. NT samples paired to either FTC4 or PTC22 that contained mature hNIS (and in addition a low amount of pG1 and/or nG forms), showed an intense labeling (although nonuniform among cells and follicular structures) of thyroid cell plasma membrane. Corresponding tumors that did not contain the 75- to 80-kd hNIS protein but only a low amount of nG hNIS, exhibited scarce groups of immunolabeled cells and, in the positive cells, the labeling did not segregate with the plasma membrane but was patchy and covered the entire cell surface. The hyperfunctioning tissue (TA3) with a high mature hNIS content presented the classical basolateral plasma membrane immunolabeling that was intense and homogeneous between cells and follicles; as compared to nonepithelial cells located between follicles, the inside of thyrocytes was clearly immunostained. By contrast, the NT paired to TA, which only contained the nG form of hNIS on Western blot, was faintly immunolabeled and the weakly positive cells mainly exhibited a diffuse intracellular labeling. The lymph node metastasis, containing the nG form of hNIS (Figure 7)
, exhibited a clear intracellular immunoreactive staining of the metastatic thyroid cells showing the typical follicle organization.
|
| Discussion |
|---|
|
|
|---|
The use of nonsaturated PCR conditions and a Southern blot procedure to identify hNIS amplicons allowed us to measure changes of hNIS transcript levels of a rather large amplitude. In approximately half of the tumors, there was an average 10-fold decrease in hNIS transcript as compared to paired NT, and in the other half, hNIS transcripts were not detected, indicating a 100-fold reduction. These quantitative changes, which are in full agreement with those obtained by real-time PCR,4,5,8 give evidence for an impairment of transcription of the hNIS gene in all hypofunctioning tumors.
The Western blot assay, that reproducibly identified the 75- to 80-kd glycosylated hNIS from 3 to 10 µg of membrane protein of NT, failed to detect the protein in all of the hypofunctioning thyroid tumors using up to 180 µg of membrane protein. This finding indicates that the mature hNIS protein content of the tumors was at least 20 times lower than that of the surrounding NT. In approximately half of the tumors, the lack of hNIS transcripts coincided with the lack of protein. In the other tumors, hNIS transcripts were present (sometimes at levels comparable to those found in NT), and we only detected low amounts of nonglycosylated hNIS. This dissociation between transcript and protein levels (not observed in the same tumors for the products of another gene, the PDS gene) indicates that the expression of hNIS gene could also be altered at posttranscriptional step(s), ie, synthesis and/or maturation of hNIS. The striking association between the presence of nonglycosylated hNIS and the intracellular location of hNIS immunoreactivity in hypofunctioning tissue, whether normal or tumoral, suggests that, when synthesized in low amounts, hNIS would not undergo glycosylation and would remain in intracellular compartments. Because nonglycosylated NIS expressed in nonthyroid cells was reported to be transported at the plasma membrane and to be active,20 alteration of hNIS glycosylation in tumors would not be per se a limitation of its transport at the cell surface. In tissues expressing mature hNIS and showing the classical basolateral plasma membrane staining, intracellular hNIS immunoreactivity was also found; it would correspond to hNIS in the course of synthesis and trafficking toward and from the plasma membrane.21,22
It is noteworthy that the observations made on hypofunctioning tumors applied in all respects to nonstimulated NT. Indeed, nonstimulated NT samples from patients under T4 treatment contained hNIS transcripts and only low amounts of nonglycosylated hNIS. Similarly, NT samples paired to TA, devoid of mature hNIS, contained nonglycosylated hNIS. Thus, the impairment of hNIS gene expression occurring in hypofunctioning thyroid tumors could simply result from a switching off of the pathway controlling the expression of hNIS gene. In vitro studies on thyroid cell models and in vivo studies in rodents indicate that the main regulator of NIS gene expression is TSH and that the hormone primarily acts at the level of transcription,23-27 but also exerts posttranscriptional regulatory actions.21 Because patients with a cold nodule, be it an adenoma or a carcinoma, are generally euthyroid with a plasma TSH concentration within the normal range, and as TSH receptor expression is maintained in these tumors,28 it is reasonable to think that the impairment of hNIS expression occurring in hypofunctioning thyroid tumors could result from alterations of regulatory elements along the TSH-activated pathway.
The difference in the hNIS protein content of tumors (either adenomas or carcinomas) versus paired NT accounts for the difference of iodide uptake activity between tumors appearing as cold nodules at scintigraphy and the surrounding functional normal thyroid tissue. Similarly, the absence of mature hNIS in NT from patients with TA fits with the loss of iodide uptake activity and shows that a lowering or a suppression of TSH secretion dramatically impairs hNIS expression. Changes in hNIS expression level in normal human thyroid tissue according to the activation and/or functional state of the tissue were expected, but had not yet been demonstrated. Interestingly, in the NT from the four T4-treated patients, hNIS protein content was dramatically diminished, whereas hNIS transcript levels were only slightly modified. This strongly suggests that the down-regulation of hNIS expression in response to a lowering of TSH could primarily involve posttranscriptional (possibly translational) regulatory mechanisms.
Although there is no simple explanation for the divergent data in the literature regarding the level of expression of hNIS in hypofunctioning thyroid tumors, one might think that some of the previous published results showing an overexpression of hNIS could have been influenced by the reference used to establish the normal hNIS expression level. This might be the case in the work of Saito and colleagues;13
these authors only detected trace amounts of hNIS transcript and hNIS protein in the NT samples they used as reference. A lowering of hNIS content of NT could be related to a T4-treatment (as we showed) or to an elevated iodide supply of patients. Indeed, iodide intake in Japan is known to be high and it has been shown that iodide exerts down-regulatory actions on NIS expression.29,30
This remark might also be applied to the immunohistochemical study of Dohan and colleagues14
who reported an overexpression of hNIS in 70% of thyroid cancer (as compared to adjacent NT) and no expression in the 30% remaining cases. The authors did not give information on the thyroid status of the patients. In addition, the interpretation of the findings of Dohan and colleagues14
is obscured by the fact that tumors expected to be hNIS-negative such as anaplastic carcinomas corresponding to fully dedifferentiated tumors no longer expressing thyroid-specific genes31,32
and medullary carcinomas that develop from C cells of neuronal crest origin, were also found highly hNIS-positive. Identification of the molecular species responsible for the immunolabeling of these tumors by Western blot would have been of a major interest to credit these findings. Using a similar immunohistochemical approach, Tonacchera and colleagues15
observed that
50% of benign thyroid tumors were hNIS-negative, whereas 50% exhibited a high intracellular immunolabeling as compared to surrounding NT. The intensity of tumor labeling, assessed by the percentage of positive cells, was however very variable (from 15 to 80%) and the intensity of labeling of NT was most often very low (from 1 to 3%). A comparative analysis of the hNIS protein content of the tumors and their paired NT by Western blot would have represented a useful complement of immunohistochemistry to conclude on the hNIS expression status of hypo- or nonfunctioning benign thyroid tumors. Indeed, contrary to Western blot measurements, immunohistochemical observations hardly give quantitative information and furthermore do not allow comparison between samples often processed separately. Dohan and colleagues14
and Tonacchera and colleagues15
both detected hNIS immunoreactivity inside the cells of benign or malignant tumors. We have made comparable observations, but in no case was this related to an overexpression of hNIS. In our study, intracellular hNIS immunoreactivity was restricted to tumor or nonstimulated NT samples that contained minute amounts of hNIS in a nonmature form.
In conclusion, our findings further document the relationship between the iodide uptake deficit of hypofunctioning benign or malignant thyroid tumors and the alterations of hNIS gene expression. In these tumors as in NT weakly or no longer stimulated by TSH, 1) transcription of the hNIS gene is reduced and frequently to a large extent, 2) translation of hNIS transcript might be less efficient (considering that minute amounts of protein were found in samples with definite hNIS transcript levels), and 3) maturation of residual hNISparticularly with regard to glycosylationand hNIS cell surface targeting are impaired.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by a grant from the Programme Hospitalier de Recherche Clinique "Cancer Différencié de la Thyroïde."
S.T.-M. and S.S.-R. are first co-authors.
Accepted for publication March 3, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Durand, C. Ferraro-Peyret, M. Joufre, A. Chave, F. Borson-Chazot, S. Selmi-Ruby, and B. Rousset Molecular characteristics of papillary thyroid carcinomas without BRAF mutation or RET/PTC rearrangement: relationship with clinico-pathological features Endocr. Relat. Cancer, June 1, 2009; 16(2): 467 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Peyrottes, V. Navarro, A. Ondo-Mendez, D. Marcellin, L. Bellanger, R. Marsault, S. Lindenthal, F. Ettore, J. Darcourt, and T. Pourcher Immunoanalysis indicates that the sodium iodide symporter is not overexpressed in intracellular compartments in thyroid and breast cancers Eur. J. Endocrinol., February 1, 2009; 160(2): 215 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. M. B. Sodre, I. G. S. Rubio, A. L. R. Galrao, M. Knobel, E. K. Tomimori, V. A. F. Alves, C. T. Kanamura, C. A. Buchpiguel, T. Watanabe, C. U. M. Friguglietti, et al. Association of Low Sodium-Iodide Symporter Messenger Ribonucleic Acid Expression in Malignant Thyroid Nodules with Increased Intracellular Protein Staining J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4141 - 4145. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Burniat, L. Jin, V. Detours, N. Driessens, J.-C. Goffard, M. Santoro, J. Rothstein, J. E. Dumont, F. Miot, and B. Corvilain Gene Expression in RET/PTC3 and E7 Transgenic Mouse Thyroids: RET/PTC3 But Not E7 Tumors Are Partial and Transient Models of Human Papillary Thyroid Cancers Endocrinology, October 1, 2008; 149(10): 5107 - 5117. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y Liu, H. Morreau, J. Kievit, J. A Romijn, N. Carrasco, and J. W Smit Combined immunostaining with galectin-3, fibronectin-1, CITED-1, Hector Battifora mesothelial-1, cytokeratin-19, peroxisome proliferator-activated receptor-{gamma}, and sodium/iodide symporter antibodies for the differential diagnosis of non-medullary thyroid carcinoma Eur. J. Endocrinol., March 1, 2008; 158(3): 375 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Krause, S. Karger, A. Schierhorn, S. Poncin, M.-C. Many, and D. Fuhrer Proteomic Profiling of Cold Thyroid Nodules Endocrinology, April 1, 2007; 148(4): 1754 - 1763. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Krause, S. Karger, O. Gimm, S.-Y. Sheu, H. Dralle, A. Tannapfel, K. W. Schmid, C. Dupuy, and D. Fuhrer Characterisation of DEHAL1 expression in thyroid pathologies Eur. J. Endocrinol., March 1, 2007; 156(3): 295 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Rhoden, S. Cianchetta, V. Stivani, C. Portulano, L. J. V. Galietta, and G. Romeo Cell-based imaging of sodium iodide symporter activity with the yellow fluorescent protein variant YFP-H148Q/I152L Am J Physiol Cell Physiol, February 1, 2007; 292(2): C814 - C823. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bernier-Valentin, S. Trouttet-Masson, R. Rabilloud, S. Selmi-Ruby, and B. Rousset Three-Dimensional Organization of Thyroid Cells into Follicle Structures Is a Pivotal Factor in the Control of Sodium/Iodide Symporter Expression Endocrinology, April 1, 2006; 147(4): 2035 - 2042. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Frohlich, F. Machicao, and R. Wahl Action of thiazolidinediones on differentiation, proliferation and apoptosis of normal and transformed thyrocytes in culture Endocr. Relat. Cancer, June 1, 2005; 12(2): 291 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Porra, C. Ferraro-Peyret, C. Durand, S. Selmi-Ruby, H. Giroud, N. Berger-Dutrieux, M. Decaussin, J.-L. Peix, C. Bournaud, J. Orgiazzi, et al. Silencing of the Tumor Suppressor Gene SLC5A8 Is Associated with BRAF Mutations in Classical Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3028 - 3035. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Arturi, E. Ferretti, I. Presta, T. Mattei, A. Scipioni, D. Scarpelli, R. Bruno, L. Lacroix, E. Tosi, A. Gulino, et al. Regulation of Iodide Uptake and Sodium/Iodide Symporter Expression in the MCF-7 Human Breast Cancer Cell Line J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2321 - 2326. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |