| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
E by Mucosal Mast Cells in the Intestinal Epithelium and Its Absence in Nematode-Infected Mice Lacking the Transforming Growth Factor-ß1-Activating Integrin
vß6
From the Department of Veterinary Clinical Studies, Easter Bush Veterinary Centre, the University of Edinburgh, Midlothian, United Kingdom
| Abstract |
|---|
|
|
|---|
Eß7 by MMCs has not been formally demonstrated, it has been proposed as a potential mechanism to account for the predominantly intraepithelial location of MMCs during nematode infection. Co-expression of integrin-
Eß7 and the MMC chymase mouse mast cell protease-1, by mouse bone marrow-derived mast cells, is strictly regulated by transforming growth factor (TGF)-ß1. However, TGF-ß1 is secreted as part of a latent complex in vivo and subsequent extracellular modification is required to render it biologically active. We now show, for the first time, that intraepithelial MMCs express integrin-
Eß7 in Trichinella-infected BALB/c and S129 mice. In S129 mice that lack the gene for the integrin-ß6 subunit and, as consequence, do not express the epithelial integrin-
vß6, integrin-
E expression is virtually abolished and recruitment of MMCs into the intestinal epithelium is dramatically reduced despite significant overall augmentation of the MMC population. Because a major function of integrin-
vß6 is to activate latent TGF-ß1, these findings strongly support a role for TGF-ß1 in both the recruitment and differentiation of murine MMCs during nematode infection.
Previous studies, by our group, have shown that expression of the MMC-specific ß-chymase mouse mast cell protease-1 (mMCP-1) is strictly regulated by the multifunctional cytokine, transforming growth factor (TGF)-ß1.10
Indeed, mouse bone marrow-derived mast cells (mBMMCs) cultured in TGF-ß1 together with interleukin (IL)-3, IL-9, and stem cell factor are highly homologous to MMCs.10-13
In agreement with studies on T lymphocytes,14,15
mBMMC expression of the
E chain of integrin-
Eß7 is also TGF-ß1-dependent.13,16
The presence of integrin-
Eß7 has been demonstrated on the surface of intraepithelial T lymphocytes in vivo,15,17
but its expression by MMCs has not been previously demonstrated, although antibody-blocking studies provide indirect evidence that
E is required for recruitment and survival of MMCs within the epithelium.18
Given that the ligand for integrin-
Eß7, E-cadherin,19
is expressed exclusively by epithelial cells,20
TGF-ß1-mediated expression of integrin-
Eß7 by mMCP-1-positive mBMMCs13
is consistent with the predominantly intraepithelial location of mMCP-1-positive MMCs during the immune rejection of gastrointestinal nematodes.9
It therefore seems highly likely that, like intestinal epithelial T lymphocytes,15
intraepithelial MMCs express integrin-
Eß7 through a TGF-ß1-dependent mechanism and that the interaction between integrin-
Eß7 and E-cadherin contributes to their recruitment into the intestinal epithelium during nematode infection.
TGF-ß1 is ubiquitously expressed in most tissue microenvironments but is secreted as a latent complex with latency-associated protein, derived from the N-terminal sequence of the TGF-ß1 proprotein.21
We hypothesize that the interaction of the TGF-ß1-latency-associated protein complex with integrin-
vß6 and the subsequent presentation of active TGF-ß1 on the surface of epithelial cells22
is a mechanism of activating latent TGF-ß1 that is likely to be important for MMC recruitment and differentiation during gastrointestinal nematode infection. In support of this hypothesis, we have previously shown that integrin-ß6-null mutation (ß6/) mice23
are severely compromised in their ability to mount a MMC response during infection with Nippostrongylus brasiliensis.24
However, the rat-adapted strain of N. brasiliensis used in these studies stimulates relatively poor MMC recruitment in the mouse (PA Knight, unpublished observation).24
In the current study, ß6/ and ß6+/+ mice were infected with the epithelium-dwelling gastrointestinal nematode Trichinella spiralis, to generate a maximal MMC response. The specific aims of the current study were: 1) to formally demonstrate that MMCs express integrin-
Eß7 in vivo; 2) to analyze the effects of the integrin-ß6-null mutation on the TGF-ß1-dependent expression of the integrin-
E subunit; and 3) to determine whether MMC recruitment is attenuated by the integrin-ß6-null mutation.
| Materials and Methods |
|---|
|
|
|---|
Antibodies
Purified and fluorescein isothiocyanate (FITC)-conjugated monoclonal rat IgG1 anti-mouse IgE (clone 23G3; SouthernBiotech, Birmingham, AL) were purchased from Cambridge BioScience, Cambridge, UK. Purified monoclonal rat IgG2a anti-human integrin-
6 (clone GoH3), control rat IgG2a (clone R35-95), control rat IgG1 (clone R3-34), and FITC-conjugated control rat IgG1 (clone R3-34) were purchased from BD Biosciences, Cowley, UK. Purified rat IgG2a anti-integrin-
E (clone M290) and anti-integrin-ß7 hybridoma supernatant (clone M293) were provided by Dr. Peter Kilshaw (The Babraham Institute, Babraham, Cambridge, UK).14,25
Rat anti-mMCP-1 monoclonal IgG1 (clone RF6.1)9
and rabbit polyclonal anti-equine tryptase immunoglobulin (Ig)26
were purified using affinity columns (Hi-Trap NHS-activated, 1 ml; Amersham Biosciences, Little Chalfont, UK) to which 1 mg of purified protein had been coupled according to the manufacturers instructions. Alkaline phosphatase-conjugated mouse anti-rabbit IgG (clone RG-96) and purified control rabbit IgG were purchased from Sigma-Aldrich Company, Poole, UK. Proliferating cell nuclear antigen (PCNA)-specific and negative control DAKO EPOS conjugates were purchased from DakoCytomation Ltd., Ely, UK. Fluorophore conjugated monovalent goat anti-rat IgG and anti-rabbit IgG Fab fragments (Jackson ImmunoResearch Laboratories, West Grove, PA) were purchased from Stratech Scientific, Soham, UK.
Western Blot Analysis of Mouse Bone Marrow-Derived Mast Cells with Rabbit Anti-Equine Tryptase Immunoglobulin
Bone marrow cells, prepared from 10- to 12-week-old male BALB/c mice, were cultured for 12 days ex vivo in the presence of recombinant human TGF-ß1 (1 ng/ml; Sigma-Aldrich), recombinant mouse IL-3 (1 ng/ml; R&D Systems, Abingdon, UK), recombinant mouse IL-9 (5 ng/ml; R&D Systems), and recombinant mouse stem cell factor (50 ng/ml; PeproTech EC Ltd., London, UK).11 The resultant mouse mBMMC cultures were extracted with 20 mmol/L of Tris-HCl, pH 7.5, containing 1 mol/L NaCl. Sodium dodecyl sulfate gels (12%) (Mini-Protean-II; Bio-Rad Laboratories, Hemel Hempstead, UK) were run containing molecular weight markers (Bio-Rad Laboratories) and mBMMC extract (equivalent of 5 x 104 cells/lane). Gels were either stained with Coomassie Brilliant Blue (Bio-Rad Laboratories), or transferred to polyvinylidene difluoride membrane (Immobilon-P; Millipore, Watford, UK) and probed with 1 µg/ml of affinity-purified rabbit anti-equine tryptase Ig26 followed by alkaline phosphatase-conjugated mouse anti-rabbit IgG (1/20,000 dilution). Blots were developed using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma-Aldrich).
Parasite Infections
All experiments involving laboratory animals were performed in accordance with the United Kingdoms Animals (Scientific Procedures) Act 1986. Integrin-ß6-null (S129 strain background; S129 ß6/) mice23 were originally obtained from Dr. Kairbaan Hodivala-Dilke (Cell Adhesion and Disease Laboratory, GKT School of Medicine, St. Thomas Hospital, London, UK) and backcrossed with S129 ß6+/+ controls (B&K Universal, Hull, UK). Breeding colonies of S129 ß6/, S129 ß6+/+, and BALB/c mice were maintained at the Easter Bush Veterinary Centre animal facility. Maintenance, infection, and recovery of Trichinella spiralis larvae were performed using standard methods.27 Mice, 8- to 15-week-old, age- and sex-matched BALB/c (B&K Universal, Hull, UK), S129 ß6+/+ (B&K), and S129 ß6/, were infected by gavage with 250 muscle larvae in 0.2 ml of phosphate-buffered saline (PBS)/0.1% agar, freshly isolated from muscle cysts from 30- to 90-day infected BALB/c mice. Groups of mice (n = 4) were killed on days 7 and 13 (S129) or 14 (BALB/c) after infection. Adult worms were isolated from the small intestine of S129 mice using a modified Baermans technique1 and samples of jejunum were prepared as described below. Samples were also prepared from age-matched uninfected controls.
Isolated Jejunal Epithelial Whole Mounts
Intact sheets of jejunal epithelium that included both villi and crypts were isolated by vascular perfusion with ethylenediaminetetraacetic acid12 from 8- to 15-week-old female BALB/c mice 14 days after infection with T. spiralis, and from age- and sex-matched uninfected controls. Isolated epithelium was allowed to settle in ice-cold PBS before transfer into 20°C absolute methanol. After 20 minutes, small volumes of methanol/epithelium suspension were air-dried onto Snow Coat X-tra-charged slides (Surgipath Europe, Peterborough, UK). Samples were rehydrated and washed in three changes of PBS before proceeding with immunocytochemistry.
Jejunal Samples for Histochemistry, Immunocytochemistry, and RNA Analysis
Age- and sex-matched S129 ß6/ and ß6+/+ mice (n = 4) were killed on days 7 and 13 after infection with T. spiralis, along with uninfected controls. Freshly isolated samples of jejunum were collected into RNA-Later (Ambion, Huntingdon, UK) for RNA isolation (0.5 cm) and into Carnoys fixative for histochemistry (3 cm).1 Samples of jejunum (3.0 cm) from mice killed on day 13 were embedded in OCT compound (BDH Laboratory Supplies, Dorset, UK) and snap-frozen in dry ice-chilled isopentane. Adult worms were isolated from the reminder of the small intestine.1 Snap-frozen samples were also prepared from age-matched female BALB/c mice (n = 4) 14 days after infection with T. spiralis, and from uninfected controls. For immunocytochemistry, 10-µm cryostat sections from frozen jejunal samples were mounted on Snow Coat X-tra-charged slides, air-dried for 10 minutes, and stored at 70°C. For histochemical mast cell evaluation, Carnoys-fixed, paraffin-embedded 4-µm microtome sections of jejunum were stained overnight in 0.5% toluidine blue in 0.5 mol/L HCl, pH 0.5, and counterstained with 1% eosin solution. Toluidine blue-stained sections prepared from S129 ß6/ and ß6+/+ mice on day 13 were also washed thoroughly with PBS and probed with anti-PCNA or control EPOS antibodies as directed by the manufacturer (DakoCytomation Ltd.). PCNA-specific labeling was visualized with 3,3'-diaminobenzidine substrate (Vector Laboratories Ltd., Peterborough, UK).
Fixation and 3,3'-Diaminobenzidine Pretreatment of Frozen Sections
Frozen sections were thawed for 10 minutes at 21°C, fixed in absolute methanol for 10 minutes at 20°C, and air-dried for a further 10 minutes under forced air. Sections were washed and rehydrated in pH 7.4 PBS containing 0.5% Tween 80 (Sigma-Aldrich). Eosinophil autofluorescence was quenched using a modified version of the procedure described by Kingston and Pearson.28 Noneosinophil-derived endogenous peroxidase activity was quenched for 30 minutes with 1% H2O2 in pH 7.4 PBS containing 0.5% Tween 80. Sections were then washed with PBS and incubated for 3 minutes with 3,3'-diaminobenzidine substrate. Sections were washed thoroughly with PBS before proceeding with immunocytochemistry.
Immunocytochemistry: Standard Conditions and Reagents
Unless stated otherwise, immunocytochemical procedures were performed at 21°C under humidified conditions in a Sequenza immunostaining center (Thermo Shandon, Runcorn, UK). Antibodies and blocking sera were diluted in staining buffer (pH 7.4 PBS containing 0.5 mol/L NaCl and 0.5% Tween 80). After immunocytochemical labeling, samples were washed in PBS and mounted with no. 1.5 (0.17-mm-thick) glass coverslips (BDH Laboratory Supplies) using Mowiol (pH 8.5) mounting media (EMD Biosciences, San Diego, CA).
IgE and mMCP-1 Dual-Immunofluorescent Labeling in Isolated Jejunal Epithelium
Nonspecific immunoglobulin interactions were blocked for 1 hour with staining buffer containing 10% heat-inactivated normal mouse serum (NMS). Samples were then incubated for 30 minutes with rat IgG1 anti-mMCP-1 or control rat IgG1, diluted to 5 µg/ml in staining buffer and 10% NMS. After washing with PBS, slides were incubated for 30 minutes with Rhodamine Red-X (RRX)-conjugated goat anti-rat IgG Fab fragments, diluted to 4 µg/ml in staining buffer and 10% NMS. Samples were washed in PBS, blocked for 1 hour in staining buffer containing 10% heat-inactivated normal rat serum (NRtS), and then incubated for 30 minutes with FITC-conjugated rat IgG1 anti-mouse IgE or FITC-conjugated control rat IgG1, diluted to 5 µg/ml in staining buffer and 10% NRtS. Samples were then washed with PBS and counterstained for 10 minutes with DRAQ5 (Biostatus Limited, Shepshed, Leicestershire, UK), diluted to 5 µmol/L in PBS.
Triple-Immunofluorescent Labeling of Frozen Sections
Nonspecific immunoglobulin interactions were blocked for 1 hour with staining buffer and 10% NMS. Sections were then incubated for 1 hour with staining buffer and 10% NMS containing rat anti-mouse integrin-
E IgG2a (2 µg/ml), integrin-ß7 IgG2a (1/50 dilution of hybridoma supernatant), control rat IgG2a (2 µg/ml), rabbit anti-equine tryptase Ig (2 µg/ml), or control rabbit IgG (2 µg/ml). Samples were washed with PBS and incubated for 30 minutes with staining buffer and 10% NMS containing Cyanine-5 (Cy5)-conjugated goat anti-rat or goat anti-rabbit Fab fragments (2 µg/ml) as appropriate.
IgE and integrin-
6 were labeled simultaneously using Fab fragment complexes. Samples were blocked for 1 hour with staining buffer and 10% NRtS. During this time, primary rat antibodies were incubated for 20 minutes at 21°C with fluorophore-conjugated anti-rat IgG Fab fragments in a small volume, 10 µl per 1 µg of primary antibody, of staining buffer in a microcentrifuge tube. Rat anti-mouse IgE and control IgG1 were labeled with FITC-conjugated Fab fragments at a ratio of 5 µg of Fab fragments per µg of primary rat IgG1. Rat anti-human integrin-
6 and control IgG2a were labeled with RRX-conjugated Fab fragments at a ratio of 5 µg of Fab fragments per µg of primary rat IgG2a. The resultant Fab fragment complexes were diluted to 4 µg/ml of primary antibody with staining buffer and 10% NRtS and incubated for 10 minutes at 21°C to block any unbound Fab fragment paratopes. Tissue sections were then incubated for 1 hour with the following combinations of Fab fragment complexes (mixed 1:1 to yield a final concentration of 2 µg/ml of each primary/control antibody): IgE-specific Fab FITC and integrin-
6-specific Fab RRX; IgE-specific Fab FITC and isotype-matched control Fab RRX; isotype-matched control-Fab FITC and integrin-
6-specific Fab RRX; and isotype-matched control Fab FITC and isotype-matched control Fab RRX.
Microscopy and Imaging
Bright-field images were acquired with a Sony DXC-390P 3CCD color video camera (Scion Corp., Frederick, MD) mounted on an Axiovert 100 inverted microscope (Carl Zeiss, Welwyn Garden City, UK). The RGB video signal from the camera was digitized using Scion Image (Scion Corp.) installed in a G4 Macintosh computer (Apple Computer, Cupertino, CA) fitted with a CG-7 frame grabber (Scion Corp.).
Fluorescent images were acquired using an MRC-600 confocal laser-scanning microscope (CLSM; Bio-Rad Laboratories) mounted on an Axiovert 100 inverted microscope equipped with Plan-Apochromat objective lenses (Carl Zeiss). Fluorophores were excited and imaged sequentially using the 488-nm (FITC), 568-nm (RRX), and 647-nm (DRAQ5 and Cy5) lines from a 15 mW Kr/Ar laser (Bio-Rad Laboratories).
Toluidine blue-based mast cell counts were determined from 20 jejunal villus-crypt units (VCU) per mouse. The proportion of mast cells expressing PCNA in samples from ß6/ and ß6+/+ S129 mice on day 13 after infection was determined by evaluation of 200 toluidine blue-positive mast cells per mouse. Manual cell counting and stereology measurements (Cavalieri method)29 were performed on images of fluorescently labeled samples using custom software developed for Object-Image.30 Object-Image is a public domain software package, based on NIH Image,31 developed by Norbert Vischer (The University of Amsterdam, Amsterdam, The Netherlands) and is available via the Internet at http://simon.bio.uva.nl/object-image.html. Images were prepared for publication using Object-Image and Photoshop [Adobe Systems (UK),Uxbridge, UK].
Detection of Integrin Transcripts by Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from RNA-Later (Ambion)-fixed jejunal samples using Tri-Reagent (Sigma-Aldrich) and contaminating DNA removed using DNA-free DNase (Ambion).1
One mg of RNA was reverse-transcribed using 2.5 mmol/L (dT)15. A one-twentieth volume was amplified by PCR using gene-specific primers for
E [AED (sense), CCCTTACTCTCCTTAGGACGATCAA; AEF (anti-sense), TATCAGTCATCAAAACGCATG] that give a RT-PCR product of 197 bp, and ß7 [B7D (sense), GCTCTCTGTGGAAATCTACGA, B7F (anti-sense), TCACTCTGAAAAATCTCAGCG) that give a RT-PCR product of 278 bp, or for the housekeeping gene GAPDH,1
with equivalent quantities of nonreverse-transcribed RNA as negative controls. Reaction conditions were optimized to ensure the number of thermocycles used coincided with the amplification phase of the PCR. Amplifications were performed for 40 seconds at 94°C, 40 seconds at 55°C, and 120 seconds at 72°C for 34 thermocycles for
E and ß7, and for 40 seconds at 94°C, 40 seconds at 60°C, and 120 seconds at 72°C for 32 thermocycles for GAPDH, in a final magnesium concentration of 1.5 mmol/L, pH 8.3. Resultant PCR products were visualized on ethidium bromide-stained 1.6% agarose gels. Images were acquired with a Kodak Digital Science Image Station 440CF (Eastman-Kodak, Rochester, NY) and analyzed using Kodak 1D Image Analysis software. PCR product identities were confirmed by Southern blotting following standard protocols and hybridized using digoxigenin-labeled gene-specific probes.32
Internal probe sequences for the
E/ß7 RT-PCR products were as follows;
E; AEE (sense), AGTGCCTTTAATGAGCACGGTT; ß7; B7E (sense), ACTGGAAGCAGGACAACAAT. Primers and internal complementary probes were designed using RawPrimer (The Virtual Genome Center, http://alces.med.umn.edu/rawprimer.html).
| Results |
|---|
|
|
|---|
Intraepithelial IgE+ve Cells
mMCP-1 remains highly soluble and diffuses in frozen sections resulting in poor immunocytochemical labeling (data not shown). To address this problem and to confirm previous studies that identified MMCs on the basis of IgE staining,33,34
jejunal epithelial whole mounts from T. spiralis-infected (day 14) BALB/c mice (n = 4) were probed with mMCP-1- and IgE-specific antibodies. The distribution of mMCP-1 and IgE staining within the jejunal epithelium confirmed that cell surface-bound IgE is exclusively restricted to mMCP-1+ve MMCs (Figure 1, A to D
; and Table 1
). Although this method of sample preparation and fixation preserved the antigenicity of IgE and mMCP-1 (Figure 1; A to D)
it was incompatible with integrin immunocytochemistry (data not shown). Subsequent analysis of MMC integrin-
Eß7 expression was performed on 20°C methanol-fixed, snap-frozen sections of jejunum.
|
|
IgE+ve cells were enumerated in frozen sections of jejunum from T. spiralis-infected (day 14) BALB/c mice and uninfected controls. Although the majority of IgE+ve cells within the jejunal mucosa of infected mice were located intraepithelially, substantial numbers of cells exhibiting IgE surface labeling were detected within the lamina propria (Table 2)
. To confirm that these cells were also mast cells, IgE staining was performed in conjunction with tryptase localization. Anti-equine tryptase26
resulted in strong intragranular staining (Figure 1F)
within >80% of IgE+ve lamina propria cells and >60% of intraepithelial IgE+ve cells (Table 2)
. Western blot analysis of lysates from mBMMCs11
showed that this antibody recognizes a band of
35 kd (Figure 2)
consistent with the molecular weight (MW) of glycosylated mouse tryptases (mMCP-6 and -7).35
The relative frequencies of tryptase single-positive, IgE single-positive, and tryptase/IgE double-positive cells present in the epithelium and lamina propria were determined using integrin-
6-specific labeling to delineate the epithelium.
|
|
95% degree of confidence. This is consistent with previous observations in rats and mice in which different fixation and staining techniques were used to show that IgE-bearing cells in the mucosa were mast cells and not plasma cells, macrophages, or lymphocytes.33,34
The Integrin-
E Subunit Is Preferentially Expressed on Intraepithelial IgE+ve Cells
Frozen sections of jejunum from T. spiralis-infected (day 14) BALB/c mice and uninfected controls (n = 4) were labeled with integrin-
E- or -ß7-specific antibodies together with IgE- and integrin-
6-specific Fab fragment complexes. Using integrin-
6 to differentiate the epithelium and lamina propria, the relative frequencies of IgE single-positive cells and IgE/integrin double-positive cells present in each location were determined and stereology was used to calculate IgE+ve cells mm2 (Figure 3)
. Although integrin-
E- and -ß7-positive cells were present, IgE+ve cells were not found in sections from uninfected mice (data not shown). Infection with T. spiralis was associated with a substantial IgE+ve cell recruitment, with the majority (79.1 ± 1.5%) of IgE+ve cells located within the epithelium (Figure 3A)
. Nearly all of the IgE+ve cells present within the jejunal mucosa expressed integrin-ß7, regardless of their location (Figure 3B)
. Integrin-
E was expressed by 17.1 ± 1.3% of lamina propria IgE+ve cells and was detected on a significantly (P < 0.01; unpaired Students t-test with Welch correction) higher proportion (54.5 ± 2.9%) of intraepithelial IgE+ve cells (Figure 3B)
.
|
E Expression by IgE+ve Cells and Inhibits Their Recruitment into the Jejunal Epithelium
Frozen sections of jejunum (n = 3) from T. spiralis-infected (day 13) and uninfected control S129 ß6+/+ and S129 ß6/ mice (n = 4, frozen material from one of the S129 ß6/ mice was damaged during processing) were labeled with integrin-
E- or -ß7-specific antibodies together with IgE- and integrin-
6-specific Fab fragment complexes (Figure 4)
. IgE+ve cells were not detected in sections from uninfected mice (Figure 4, A to D)
. Jejunum from uninfected S129 ß6+/+ mice contained abundant intraepithelial integrin-
E+ve (Figure 4C)
and integrin-ß7+ve cells (Figure 4A)
. Integrin-ß7+ve cells were also present in large numbers in the jejunum of uninfected S129 ß6/ mice but were predominantly restricted to the lamina propria (Figure 4B)
. Integrin-
E+ve cells were extremely rare in samples from uninfected S129 ß6/ mice and expressed substantially lower levels of integrin-
E (Figure 4D)
.
|
|
E expression in S129 ß6+/+ mice was similar to that observed in BALB/c mice (Figure 3B)
E staining (Figure 5C)
E-positive cells were rare in sections from S129 ß6/ mice and were typically IgEve (Figure 4H)
E staining in S129 ß6/ mice (Figure 5C)
Deletion of the Integrin-ß6 Gene Is Associated with Reduced Levels of Integrin-
E Transcripts and Aberrant Mast Cell Distribution in the Murine Jejunum
Levels of integrin-
E and integrin-ß7 transcripts were assessed by RT-PCR in jejunal RNA from T. spiralis-infected (day 13) and uninfected control S129 ß6+/+ and S129 ß6/ mice (n = 4). Although there was no evidence for a reduction in the levels of integrin-ß7 or GAPDH control transcripts in S129 ß6/ mice, integrin-
E transcripts appeared to be less abundant in S129 ß6/ RNA than in wild-type samples (Figure 6A)
, confirming the protein expression data described earlier. Densitometry confirmed that there was a significant (P < 0.05, unpaired Students t-test with Welch correction) reduction in the net intensity of integrin-
E-specific RT-PCR products from S129 ß6/ samples (Figure 6B)
.
|
|
| Discussion |
|---|
|
|
|---|
Eß7, that these are predominantly intraepithelial mast cells, and that their intraepithelial location is highly dependent on the integrin-
Vß6. A major difference between this and our previous study, showing a general reduction in mast cell recruitment in integrin-ß6/ mice when compared with controls infected with rat-adapted N. brasiliensis,24
is that with T. spiralis there was substantially enhanced recruitment of mast cells in the ß6/ mice compared with ß6+/+ controls. The intestinal nematode T. spiralis induces a particularly potent MMC response36
when compared with N. brasiliensis24
and this is strikingly evident from the present study.
Because we were unable to co-localize mMCP-1 and integrin-
E in frozen sections or in whole mounts of exfoliated epithelium, we used surface-bound IgE to identify MMCs, as described by others (Figure 1
and Tables 1 and 2
).33,34
Our preliminary co-localization of mMCP-1 and IgE in exfoliated epithelium and of IgE and tryptase in lamina propria mast cells is in agreement with previous studies in which Carnoys fixation and toluidine blue staining showing that virtually all IgE-bearing cells are mast cells in parasitized rodent intestines.33,34
Using surface IgE as a marker, we have established that the
E- and ß7-integrin subunits are expressed on the surface of MMCs in vivo (Figure 4)
. Furthermore, our data suggest that integrin-
E expression is up-regulated on intraepithelial MMCs, compared to lamina propria MMCs (Figures 3B and 5C)
.
The addition of TGF-ß1 to mBMMCs induces the expression of integrin-
Eß716
and mMCP-1.13
In our previous study of N. brasiliensis-infected ß6/ mice,24
we established that there was little or no mMCP-1 expression in the few MMCs that were recruited to the gut. We hypothesized that the absence of integrin-
Vß6, which is known to activate latent TGF-ß1-latency-associated protein,22
would result in an absence of activated TGF-ß1 within the epithelium and, hence, lack of expression of mMCP-1.24
The present results, in which there is a virtual absence of integrin-
E-expressing MMCs and a markedly reduced level of transcription of
E integrin, is consistent with the hypothesis that integrin-
Vß6 plays a significant role in the activation of TGF-ß1 within the epithelial compartment. In addition to integrin-
vß6,22
plasmin, thrombospondin-1, reactive oxygen species, matrix metalloproteinases, and various other integrin heterodimers have also been implicated in latent TGF-ß activation.37
Although the low-level expression of integrin-
E observed in ß6/ mice may be accounted for by one or more of these additional mechanisms, it would seem that, as is the case in lung,22,23
integrin-
vß6 is the predominant factor in regulating TGF-ß1 activity in the murine intestinal epithelium.
Mast cells derive from hematopoietic progenitor cells of, as yet, an incompletely defined phenotype.38,39
Despite the massive mast cell hyperplasia induced by intestinal nematode infection, there is little evidence of mast cell progenitor (MCp) proliferation in the bone marrow or circulation, with the main site of proliferation and differentiation occurring in the jejunum.40-42
Differentiation of MCps into mature mast cells occurs after the cells leave the blood stream and is regulated by factors in their local tissue microenvironment.38
MCp homing to the small intestine has been shown to be dependent on expression of integrin-
4ß7.43
Intraepithelial MCps can be readily isolated from normal intestinal epithelium and the numbers increase within 4 days of infection with T. spiralis.40
The microenvironment that permits the intraepithelial expansion of MMCs includes expression of stem cell factor44
and TGF-ß145
by epithelial cells and of IL-3 by intraepithelial T cells.46
There are also reports that IL-9-expressing cells can be located within allergic airway epithelium,47
suggesting that enteric epithelium could, similarly, support the presence of IL-9-secreting lymphocytes. These observations support the hypothesis that the conditions for MMC differentiation and proliferation exist within the jejunal epithelium.
There was striking difference between infection with T. spiralis, in which mast cells were very abundant in the lamina propria of ß6/ mice, and the result of a comparable experiment with the rat-adapted strain of N. brasiliensis, in which very few MMCs were recruited.24
It is, however, recognized that T. spiralis promotes a particularly potent MMC response48
and the stimulus is presumably strong enough to overcome the apparent inhibitory effect on MMC recruitment of a lack of
vß6 integrin.24
The reason why there were more MMCs in the ß6/ mice than in ß6+/+ controls is less obvious. It could be that the slightly larger worm burden on day 13 (Table 3)
provides a more potent stimulus. The preliminary analysis on day 13 using PCNA (Table 3)
suggests that MMCs were proliferating at the same rate in both groups. An alternative explanation is that the failure of the cells to enter the epithelium and the probable lack of expression of mMCP-1, as described for infection with N. brasiliensis,24
might result in greater retention of MMCs in ß6/ mice. This is analogous to the augmented accumulation of MMCs in mMCP-1/ mice.1
It is possible, for example, that some intraepithelial MMCs can migrate directly into the gut lumen as a consequence of the proteolysis of tight junctions by secreted mMCP-1.7
Alternatively, the presence of mMCP-1 in the extracellular space may promote cleavage of epithelial stem cell factor and subsequent apoptosis of MMCs49
as they are carried up into the villus. Any loss of autoregulatory function because of the absence, or to very low levels, of mMCP-1, may disturb the rate of apoptosis and/or luminal shedding of MMCs. This is further compounded by the fact that the MMCs were unable to migrate into the epithelium.
Because the most likely defect associated with the absence of the ß6-integrin gene is a lack of activated TGF-ß1 on the basolateral membranes of enterocytes, it is possible that the reduction in intraepithelial MMCs in ß6/ mice occurs primarily because MCps fail to express
E, do not bind to epithelially expressed E-cadherin, and thus have a reduced ability to remain intraepithelial. If the MCps enter the lamina propria of ß6/ mice and expand and differentiate in the relative absence of TGF-ß1, then not only would numbers in the lamina propria be increased, but the phenotype of the differentiated MMC population would also differ from that described in ß6+/+ controls. As mentioned above, in our study with N. brasiliensis, the few MMCs that were recruited did not express mMCP-1,24
and this is consistent with an altered MMC phenotype.
Studies using integrin-deficient mice and, more specifically, antibody neutralization of integrin-
E in T spiralis-infected mice18
suggest that integrin-
Eß7 is not only required for the retention of MCp and MMCs within the intestinal epithelium but may also be essential for the recruitment of MCps to the gut mucosa because treated mice lacked MMCs both in epithelium and lamina propria. The present results suggest that the reduced expression of integrin-
E, as a consequence of defective processing of extracellular TGF-ß1 latency-associated protein is associated with reduced recruitment of intraepithelial MMCs but, paradoxically, results in a threefold expansion of the lamina propria MMCs.
This report is the first to demonstrate, unequivocally, that MMCs express integrin-
Eß7. Furthermore, the absence of epithelially expressed integrin-
vß6 is associated with depletion of intraepithelial MMCs, substantial down-regulation of
Eß7 expression, and a paradoxical increase in the frequency of lamina propria MMCs.
| Acknowledgements |
|---|
E and -ß7 monoclonal antibodies, and Dr. Kairbaan Hodivala-Dilke (St. Thomas Hospital) for providing breeding pairs of integrin-ß6-null S129 mice. | Footnotes |
|---|
Supported by the Wellcome Trust (grant no. 060312).
Accepted for publication March 12, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A Di Sabatino, K M Pickard, D Rampton, L Kruidenier, L Rovedatti, N A B Leakey, G R Corazza, G Monteleone, and T T MacDonald Blockade of transforming growth factor {beta} upregulates T-box transcription factor T-bet, and increases T helper cell type 1 cytokine and matrix metalloproteinase-3 production in the human gut mucosa Gut, May 1, 2008; 57(5): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Knight, J. K. Brown, S. H. Wright, E. M. Thornton, J. A. Pate, and H. R.P. Miller Aberrant Mucosal Mast Cell Protease Expression in the Enteric Epithelium of Nematode-Infected Mice Lacking the Integrin {alpha}v{beta}6, a Transforming Growth Factor-{beta}1 Activator Am. J. Pathol., October 1, 2007; 171(4): 1237 - 1248. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sheppard Transforming Growth Factor {beta}: A Central Modulator of Pulmonary and Airway Inflammation and Fibrosis. Proceedings of the ATS, July 1, 2006; 3(5): 413 - 417. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Brown, S. M. McAleese, E. M. Thornton, J. A. Pate, A. Schock, A. I. Macrae, P. R. Scott, H. R.P. Miller, and D. D.S. Collie Integrin-{alpha}v{beta}6, a Putative Receptor for Foot-and-Mouth Disease Virus, Is Constitutively Expressed in Ruminant Airways J. Histochem. Cytochem., July 1, 2006; 54(7): 807 - 816. [Abstract] [Full Text] [PDF] |
||||