help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, X.
Right arrow Articles by Fouty, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, X.
Right arrow Articles by Fouty, B.
(American Journal of Pathology. 2004;165:1613-1620.)
© 2004 American Society for Investigative Pathology

Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Can Induce Apoptosis in Subsets of Premalignant Cells

Xiaojun Lu*{dagger}, Jack L. Arbiser{ddagger}, James West*{dagger}, Marloes Hoedt-Miller*{dagger}, Alison Sheridan*{dagger}, Baskaran Govindarajan{ddagger}, Julie Wright Harral*{dagger}, David M. Rodman*{dagger}§ and Brian Fouty

From the Division of Pulmonary Sciences and Critical Care Medicine,* the Center for Genetic Lung Diseases,{dagger} and the Division of Physiology and Biophysics,§ University of Colorado Health Sciences Center, Denver, Colorado; the Department of Dermatology,{ddagger} Emory University School of Medicine, Atlanta, Georgia; and the Center for Lung Biology and Division of Pulmonary Medicine, University of South Alabama School of Medicine, Mobile, Alabama


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
During the transformation from a normal to a malignant cell, several mutations are required to bypass the pathways responsible for controlling proliferation. Premalignant cells have acquired some, but not all of these mutations and consequently have not yet attained a malignant phenotype characterized by tumor formation in vivo. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) can induce apoptosis in malignant cells while sparing normal ones and is currently being considered as adjuvant therapy for various human malignancies. Whether TRAIL is effective in inducing apoptosis in premalignant cells is unclear, however. We studied the effect of TRAIL on two human premalignant cell lines the SV7tert and HA1E cells. Both cell lines had been immortalized by the addition of simian virus 40 large T antigen and the telomerase subunit hTERT, but had not been transformed into malignant cells. TRAIL initiated apoptosis by activating both the mitochondrial-independent and -dependent apoptotic pathways in both cell lines at relatively low doses whereas it had no effect on normal human pulmonary artery smooth muscle cells even at high doses. These results suggest that TRAIL can induce apoptosis in premalignant cells and suggests a novel therapy for the treatment of premalignant lesions in vivo.

The transition from a normal to a malignant cell occurs through different stages many of which can be identified histologically. The colorectal tumorigenesis model encompassing a range of lesions including adenomas, carcinoma in situ, and invasive carcinoma is a well studied example of the progression from a normal to a malignant phenotype.1,2 Similarly, in smokers, lesions ranging from squamous metaplasia to carcinoma in situ to frank invasive carcinoma demonstrate the presence of premalignant conditions that can be identified in at-risk patients.3-5 Although surgical excision of premalignant lesions is possible in some instances this would only be useful for treating identifiable lesions and would likely be limited in practice by excessive morbidity. Chemotherapy would have the theoretical advantage of treating both seen and unseen lesions, but its effectiveness has not been studied in premalignant lesions and systemic toxicity poses a barrier to widespread use.

The progression from a normal to a tumor cell requires that cells first become immortal.6,7 This requires an escape from the replicative senescence intrinsic to mammalian cells. In experimental models7,8 immortalization can be achieved by inactivating both the retinoblastoma and p53 pathways followed by the expression of the catalytic subunit of telomerase (human telomerase reverse transcriptase or hTERT), the enzyme that elongates telomeres.9 Together these strategies allow cells to bypass replicative senescence and be passaged indefinitely. The process of immortalization can be achieved in vitro by the introduction of the simian virus 40 (SV40) large T antigen (which inactivates both the retinoblastoma and p53 pathways) and the ectopic expression of hTERT, which usually has low or no expression in human somatic cells.7,8,10 Transformation into tumor cells (that is the ability of cells to form tumors in immunodeficient mice in vivo) requires at least two additional steps: the introduction of oncogenic (constitutively active) Ras and the ability to inhibit protein phosphatase 2A. In experimental models these five mutations can transform a normal human epithelial cell into a malignant one.7,10

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the tumor necrosis factor family that includes Fas ligand and tumor necrosis factor. Like tumor necrosis factor and Fas ligand, TRAIL induces apoptosis in a variety of tumor cells through binding to its two death receptors DR4 and DR5.11,12 Death receptors are characterized by the presence of a cytoplasmic death domain that can bind adaptor proteins (such as Fas-associated with death domain or FADD) to cleave procaspase 8 to its active form. This initiates programmed cell death through two distinct caspase 8-mediated signaling pathways: mitochondrial-independent activation of caspase 3 and mitochondrial-dependent apoptosis because of the cleavage of BID (Bcl-2 inhibitory BH3 domain-containing protein).11 Severe toxicity associated with systemic administration of tumor necrosis factor-{alpha} and Fas ligand has limited their use in cancer treatment.11,13,14 In contrast, TRAIL can selectively induce apoptosis in malignant cells while sparing normal ones in vitro12 and had no toxic effects when administered systemically in mice and monkeys.11 It is unclear whether TRAIL is effective in inducing apoptosis in premalignant cells, however.

We studied the effect of TRAIL on a cell line derived from a human angiomyolipoma—a nonmalignant tumor that can cause renal failure through local invasion and hemorrhage. This cell line known as the SV7tert was immortalized by the addition of the SV40 large T antigen and hTERT.15 We also studied a cell line derived from a normal human renal epithelial cell (HA1E) that was also immortalized by the addition of SV40 large and small T antigen and hTERT.16 Neither of these cell lines was transformed and therefore are considered premalignant cells. TRAIL rapidly induced apoptosis in these cells at relatively low doses whereas it had no effect on normal human pulmonary artery smooth muscle cells (PA SMCs) even at very high doses. TRAIL initiated apoptosis by activating both the mitochondrial-independent and -dependent apoptotic pathways. Inhibiting new protein synthesis by the addition of cycloheximide increased apoptosis in TRAIL-treated cells. These results suggest that TRAIL can induce apoptosis in premalignant cells and raise the possibility that it may have chemopreventive activity against premalignant lesions such as squamous metaplasia and carcinoma in situ that are not amenable to surgical therapy.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Materials

Dulbecco’s modified Eagle’s medium was obtained from CellGro (Mediatech, Herndon, VA). Trypsin-ethylenediaminetetraacetic acid, L-glutamine from Life Technologies, Inc. (Grand Island, NY), fetal bovine serum from Gemini (Woodland, CA), polyvinylidene difluoride membrane, ECL-plus from Amersham (Buckinghamshire, UK). Cycloheximide (Sigma, St. Louis, MO) was dissolved in ethanol. TRAIL was obtained from R&D Systems (Minneapolis, MN) and dissolved in phosphate-buffered saline (PBS) with 0.1% bovine serum albumin. Mouse anti-human caspase 8 monoclonal antibody (mAb), rabbit polyclonal anti-PARP, and rabbit polyclonal anti-Bak were obtained from Upstate Biotechnology (Lake Placid, NY). Polyclonal rabbit anti-BID, polyclonal anti-human cleaved caspase 3, polyclonal rabbit anti-Smac/DIABLO, and anti-human cleaved caspase 9 were from Cell Signaling Technology (Beverly, MA). Rabbit polyclonal anti-cFLIP was obtained from Affinity Bioreagents Inc. (Golden, CO). Mouse anti-human Bcl-XL (mAb) and mouse anti-Bax (mAb) were obtained from BD Pharmingen (San Diego, CA). Mouse anti-human ß-actin was obtained from Sigma. Secondary horseradish peroxidase-conjugated antibodies: donkey anti-mouse and -rabbit were obtained from Jackson Labs (West Grove, PA).

Cell Culture and TRAIL Treatment

Human PA SMCs were obtained from Clonetics (Walkersville, MD) and grown in SMGM2 media that contains 5% fetal bovine serum. SV7tert (American Type Culture Collection, Rockville, MD) is a cell line derived from a human angiomyolipoma through the sequential introduction of SV40 large T antigen and hTERT into primary human angiomyolipoma cells15 and grown in Dulbecco’s modified Eagle’s medium supplemented with 100 U/ml penicillin, 0.1 mg/ml streptomycin, 2 mmol/L L-glutamine, and 10% fetal bovine serum. HA1E is a cell line derived from normal human renal epithelium through the introduction of SV40 large and small T antigen and hTERT.16 Cells were grown in humidified Forma Scientific incubators (Midland, MA) at 37°C in 5% CO2, 16% O2, balance nitrogen. Smooth muscle cell identity was verified for the human PA SMCs by positive staining for smooth muscle {alpha}-actin (mouse monoclonal anti-body, Sigma). Cells were seeded at 1 x 106 cells per 60-mm cell culture plate and incubated for 24 hours before recombinant human TRAIL was added. TRAIL was dissolved in sterile PBS plus 0.1% bovine serum albumin and diluted in fresh tissue culture medium before being added to cells.

Flow Cytometry Apoptosis Assay

After a 6-hour incubation with various concentrations of TRAIL cells were trypsin-ethylenediaminetetraacetic acid-digested from culture plates and the trypsin inactivated by addition of Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum. Cells were collected by low centrifugation, washed with PBS, and recollected by centrifugation. After the final wash cells were incubated for 15 minutes in annexin V and propidium iodide using the Vybrant apoptosis assay kit (catalog no. 13242; Molecular Probes, Eugene, OR). Cells were analyzed within 60 minutes at the University of Colorado Cancer Center Flow Cytometry Core.

Determination of Caspase Activation by Flow Cytometry

This method utilizes flow cytometry to quantitate the amount of activated caspase 3, Bcl-2, and cleaved PARP in whole cell lysates. Three bead populations with distinct fluorescence intensities have been coated with capture antibodies specific for cleaved PARP (C-PARP), Bcl-2, and activated caspase 3 (human apoptosis kit, catalog no. 557816; Becton-Dickinson, Mountain View, CA). After a 6-hour incubation with either control or TRAIL at 100 ng/ml, whole cell lysates were harvested as described in the manual and incubated with these beads. The beads were then analyzed in the University of Colorado Cancer Center Flow Cytometry Core. The y axis indicates the distinct bead identification number based on increasing red fluorescence intensity whereas the x axis indicates the fluorescence intensity of the phycoerythrin-conjugated detection reagent.

DNA Fragmentation Assay

After a 24-hour incubation in 100 ng/ml of TRAIL, cells were collected for DNA isolation using TACS DNA laddering kit from R&D Systems. Isolated DNA was separated on a 2% agarose gel stained with ethidium bromide.

Quantitative Reverse Transcriptase-Polymerase Chain Reaction

Quantitative reverse transcriptase-polymerase chain reaction assays were performed using the ABI 5700 real-time system with SYBR green fluorescence with normalization to ß-actin, as previously described.17 RNA was prepared using an Rneasy kit (Qiagen, Valencia, CA). Primers were designed using the GenBank sequence for the human DR4 death receptor and ß-actin (DNA Technologies, Coralville, IA). These included the human DR4 primers: AGCATGTCAGTGCAAACCAGG, TCCAGGGCGTACAATCCTTG; human DR5 primers: TGCATCTCCTGCAAATATGGAC, TGCAGGGACTTAGCTCCACTTC; human ß-actin primers: GTCTTCCCCTCCATCGTG, GGATGCCTCTCTTGCTCTG.

Western Blot

At the scheduled time points, cells were washed with cold PBS, lysed in radioimmunoprecipitation (RIPA) buffer [PBS, 1% ipegal, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, phenylmethyl sulfonyl fluoride (10 mg/ml), aprotinin (30 µl/ml), and sodium orthovanadate (1 mmol/L)], pelleted at 14,000 x g, and the protein concentration of the supernatant determined by Bradford assay (Bio-Rad, Hercules, CA). Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions (1% ß-mercaptoethanol) using 8 to 16% gradient gels. The proteins were then transferred to polyvinylidene difluoride membrane in 20% methanol. Membrane was blocked in 5% nonfat milk and 0.1% Tween-20, probed with appropriate antibodies (see Materials), detected with appropriate secondary antibodies conjugated to horseradish peroxidase at 1:10,000 dilution and detected using ECL-plus. Protein expression was quantified using NIH image 1.63 and expressed as arbitrary density units relative to control.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
TRAIL Selectively Induces Apoptosis in SV7tert Cells

To determine whether TRAIL could induce apoptosis in SV7tert cells (derived from a human angiomyolipoma) we exposed them to increasing concentrations of TRAIL. Human PA SMCs were used as a control. After a 6-hour incubation with TRAIL at 100 ng/ml, apoptotic morphological changes including cell rounding, shrinkage, and detachment could be seen under light microscopy in SV7tert (Figure 1A) , but not control cells (data not shown). The human PA SMCs did not exhibit any morphological changes even after 48 hours of treatment (data not shown). Flow cytometry analysis demonstrated apoptosis in TRAIL-treated SV7tert cells after 6 hours at concentrations as low as 10 ng/ml. TRAIL did not cause apoptosis in human PA SMCs even at 800 ng/ml (Figure 1B) . Intranucleosomal fragmentation (DNA laddering) 24 hours after treatment with TRAIL confirmed that cell death occurred by apoptosis (Figure 1C) . mRNA for the TRAIL R1/DR4 and R2/DR5 receptors was present in both cell types in approximately equivalent amounts as determined by quantitative reverse transcriptase-polymerase chain reaction. This indicated that the inability of TRAIL to induce apoptosis in the control PA SMCs was not because of the lack of TRAIL receptors.



View larger version (69K):
[in this window]
[in a new window]
  		Figure 1. TRAIL induces apoptosis in SV7tert cells but not in human PA SMCs. A: Light microscopy of SV7tert cells exposed to TRAIL (0 or 100 ng/ml) for 6 hours. Human PA SMCs showed no changes (not shown). B: Effect of increasing doses of TRAIL at 6 hours on apoptosis in human PA SMCs and SV7tert cells as determined by flow cytometry. Data are mean ± SEM, n = 3 separate experiments; *, P < 0.05 versus human PA SMCs. C: Ethidium bromide-stained agarose gel of DNA harvested from human PA SMCs and SV7tert cells 24 hours after exposure to 100 ng/ml of TRAIL. DNA laddering was seen only in the SV7tert cells.

 
TRAIL Initiates Apoptosis in SV7tert Cells through Activation of Caspase 8

TRAIL initiates apoptosis through binding to its death receptors TRAIL-R1/DR4 and TRAIL-R2/DR5. The trimerization of TRAIL receptors recruits the adaptor protein, FADD, to form the death-inducing signal complex (DISC). This complex recruits procaspase 8 and induces its proteolytic cleavage to the active (cleaved) form thereby initiating the subsequent downstream activation of effector caspases.11 TRAIL can also cause cell necrosis through a caspase 8-independent pathway, however.12,18 To determine whether TRAIL activated caspase 8 in the SV7tert cells we added increasing doses of TRAIL and harvested cell lysates for protein analysis. Figure 2A indicates that cleaved (activated) caspase 8 can be detected after stimulation with TRAIL in a dose-dependent manner. A time course indicates that cleaved caspase 8 is detectable within 30 minutes of TRAIL treatment and becomes prominent by 1.5 hours (Figure 2B) .



View larger version (69K):
[in this window]
[in a new window]
  		Figure 2. TRAIL activates caspase 8 in angiomyolipoma cells. A: Western blot of SV7tert cell lysates harvested 30 minutes after exposure to increasing doses of TRAIL. B: Western blot showing the time course of caspase 8 activation in SV7tert cells treated with 100 ng/ml of TRAIL. Representative blot from three separate experiments.

 
TRAIL Activates Both the Mitochondrial-Dependent and -Independent Apoptotic Pathways in SV7tert Cells

TRAIL can induce apoptosis in certain cell types (such as B- and T-cell lymphoma cell lines) solely through direct activation of the caspase pathway. In other cells TRAIL also requires activation of the mitochondrial pathway with the release of cytochrome c and Smac/DIABLO (which leads to the activation of caspase 9) to cause apoptosis. We demonstrated above that TRAIL-stimulated SV7tert cells activated caspase 8. Next we wanted to confirm that the principal downstream effector caspase, caspase 3, was also activated. Protein from SV7tert cells was harvested after treatment with TRAIL (100 ng/ml) and cell lysates were analyzed for evidence of active caspases by Western blotting. Figure 3A indicates that caspase 3 is cleaved and active in TRAIL-treated SV7tert cells. Activated caspase 3 is the main executor of apoptosis in cells and results in the cleavage of multiple cytoplasmic and nuclear proteins. One of it targets is the nuclear enzyme poly (ADP-ribose) polymerase (PARP). Cleavage of PARP confirms complete activation of the apoptotic pathway by TRAIL (Figure 3A) .



View larger version (85K):
[in this window]
[in a new window]
  		Figure 3. TRAIL activates both the mitochondrial-independent and -dependent apoptotic pathways in angiomyolipoma cells. A: Western blot of SV7tert cell lysates harvested 6 hours after exposure to 100 ng/ml of TRAIL shows cleavage (and activation) of caspase 3. Cleavage of the nuclear protein PARP confirmed complete activation of the caspase pathway. B: TRAIL cleaves BID to its truncated form indicating activation of the mitochondrial-dependent apoptotic pathway. The presence of Smac/Diablo and cleaved caspase 9 confirm this observation. Representative blot from three separate experiments. Truncated BID shown at 2.5 hours; Smac/DIABLO and cleaved caspase 9 are shown at 6 hours.

 
To demonstrate that TRAIL also activated the mitochondrial-dependent apoptotic pathway we show that the proapoptotic protein, BID, is cleaved by caspase 8 into truncated BID (Figure 3B) . Truncated BID binds the mitochondrial membrane causing membrane depolarization and this leads to the release of Smac/DIABLO into the cytosol.11 Figure 3B demonstrates the increase in Smac/DIABLO after TRAIL stimulation and demonstrates that caspase 9 is cleaved and activated. These results indicate that TRAIL activates both the mitochondrial-independent and -dependent pathways in SV7tert cells.

Inhibiting Protein Synthesis Significantly Enhances TRAIL-Induced Apoptosis in SV7tert Cells

TRAIL resistance has been demonstrated in some cell lines and the mechanism of resistance can vary depending on cell type.19-21 In addition, TRAIL can modulate its own apoptotic effect through the up-regulation of anti-apoptotic proteins. We had already shown that the SV7tert cells were sensitive to TRAIL. Next we wanted to determine whether modulators of apoptosis were induced by TRAIL. Inhibiting new protein synthesis by the addition of cycloheximide significantly increased apoptosis in TRAIL-treated SV7tert cells (Figure 4A) . Consistent with this the caspase cascade was activated to a greater degree in the presence of cycloheximide (caspase 8, caspase 9, and PARP as shown in Figure 4B ; caspase 3 not shown).



View larger version (46K):
[in this window]
[in a new window]
  		Figure 4. Inhibiting protein synthesis with cycloheximide (CHX) amplifies TRAIL-induced apoptosis in angiomyolipoma cells. A: Effect of TRAIL alone and in combination with CHX (25 µmol/L) on apoptosis of SV7tert cells as determined by flow cytometry. Data are mean ± SEM, n = 3 separate experiments; *, P < 0.05 versus TRAIL (100 ng/ml) alone. B: Western blot of SV7tert cell lysates harvested 6 hours after TRAIL exposure demonstrating increased activation of caspases 8 and 9 along with an increase in cleaved PARP in the presence of CHX. Representative blot from three separate experiments.

 
TRAIL Causes Apoptosis in HA1E Cells

To determine whether TRAIL could induce apoptosis in another immortalized, premalignant cell line we examined its effect on HA1E cells. This is a cell line derived from normal human renal epithelial cells immortalized by the addition of the SV40 large T antigen and hTERT.16 To first determine whether SV7tert and HA1E cell lines had acquired secondary mutations capable of transforming them into a malignant phenotype, we assessed their ability to grow in soft agar. The ability of cells to grow on soft agar is an indicator of malignant potential although it is less reliable as a marker of malignant transformation than in vivo tumorigenesis.22 HA1E cells did not form colonies in soft agar (0.5 colonies at 2 weeks) whereas SV7tert cells were able to form some colonies (120 ± 13 colonies at 2 weeks). In contrast, a transformed endothelial cell line (the SVR line) that has been demonstrated to induce tumors in vivo22 generated 2039 colonies in soft agar. We had previously demonstrated that unlike SVR cells, SV7tert cells could not generate tumors when injected into nude mice.15 Therefore the weak ability of SV7tert (relative to SVR) cells to grow some colonies in soft agar suggests that although they may have more malignant potential than HA1E cells, they have not yet attained a malignant phenotype.

TRAIL induced apoptosis in HA1E cells throughout a similar dose range as that seen in SV7tert cells (Figure 5) . To determine whether TRAIL also activated the caspase system we used a new technology that utilizes flow cytometry to assess activation of multiple parts of the apoptotic pathway at one time. We exposed human PA SMCs, SV7tert, and HA1E cells to TRAIL for 6 hours and then harvested protein from cell lysates. Cell lysates were then incubated with beads specific for either activated caspase 3, Bcl-2, or cleaved PARP and analyzed by flow cytometry. Figure 6 demonstrates the type of data produced by this method (lower band is activated caspase 3, middle band is Bcl-2, and the upper band represents cleaved PARP); the graphs on the right demonstrate the statistical analysis of repeated experiments. Activated caspase 3 and cleaved PARP is present in SV7tert and HA1E cells, but not in human PA SMCs exposed to TRAIL. Expression of the anti-apoptotic protein, Bcl-2, does not change in TRAIL-treated cells.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 5. TRAIL induces apoptosis in HA1E cells. Effect of increasing doses of TRAIL at 6 hours on apoptosis in human PA SMCs, SV7tert, and HA1E cells as determined by flow cytometry. Data are mean ± SEM, n = 4 separate experiments; *, P < 0.05 for both SV7tert and HA1E cells versus human PA SMCs. These apoptosis experiments were done simultaneously in all three cell lines and represent different experiments from those shown in Figure 1B .

 


View larger version (32K):
[in this window]
[in a new window]
  		Figure 6. TRAIL activates caspase 3 and cleaves PARP in HA1E and SV7tert cells, but not human PA SMCs. Three bead populations with distinct fluorescence intensities have been coated with capture antibodies specific for cleaved PARP (C-PARP), Bcl-2, and activated caspase 3 (human apoptosis kit from Becton-Dickinson, see Materials and Methods). Six hours after exposure to control or TRAIL (100 ng/ml) whole cell lysate protein from human PA SMCs (A), HA1E cells (B), and SV7tert cells (C) was harvested, normalized, and then incubated with these beads. The beads were then analyzed by flow cytometry. The y axis indicates the distinct bead identification number based on increasing red fluorescence intensity (bead ID FI). The top band (most intense) represents C-PARP, the middle band represents Bcl-2, and the bottom band (least intense) represents activated caspase 3. The x axis indicates the fluorescence intensity of the phycoerythrin-conjugated detection reagent (FI of PE). The figures on the left demonstrate data obtained from a single experiment; the bar graphs on the right indicate the statistical analysis of four separate experiments. *, P value < 0.05. Each experiment was compared to its (untreated) control and changes denoted by fold-change over baseline. Note that after incubation with TRAIL the fluorescence intensity of activated caspase 3 and cleaved PARP increases (ie, shifts to the right) in HA1E and SV7tert cells, but not in human PA SMCs. Bcl-2 is unchanged in any of the three cell types after TRAIL exposure.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
Early detection and treatment of malignant lesions is critical to controlling the devastating effects of cancer. The histological and molecular changes associated with the transformation from a normal to a malignant cell are well described in numerous cancers including colon,1,2 lung,23,24 and cervical.25 Therapy currently consists primarily of surgical or endoscopic excision of offending cells. Unfortunately surgical intervention is effective only on specific, identifiable lesions and even then it carries significant morbidity. In addition, surgery is frequently not a therapeutic option in patients with advanced pulmonary disease who are at highest risk for developing premalignant lesions such as squamous metaplasia and carcinoma in situ that can ultimately lead to the development of bronchogenic carcinoma. Clinical investigators using fluorescent (LIFE) bronchoscopes and targeted endobronchial biopsies (performed both before and after chemotherapy) have noticed a decrease in premalignant lesions (squamous metaplasia, carcinoma in situ) in patients after chemotherapy for surgically unresectable lung cancer (B. Keith, Y. Miller, personal communication). This suggests that chemotherapy might be useful in targeting these premalignant lesions if less toxic agents were identified.

In vitro cell models designed to study the progression from normal to malignant cells have been described.8,10,26,27 The transition from a normal to a malignant phenotype in vitro first requires the cell to become immortalized. Mutating (bypassing) the retinoblastoma and p53 pathways through the introduction of the SV40 large T antigen coupled with the introduction of the telomerase catalytic subunit hTERT is sufficient to immortalize human epithelial cells and render them resistant to replicative senescence.8 These immortalized cells are not considered transformed or malignant however because they are unable to form tumors when injected into immunodeficient mice. The addition of oncogenic (constitutively active) ras along with the addition of the SV40 small T antigen (which inactivates protein phosphatase 2A) is required to fully transform cells. Therefore, introducing the SV40 early region elements (containing both the large and small T antigen), hTERT, and oncogenic ras is sufficient to completely transform a normal human epithelial cell into a malignant one in vitro.8,10

The relevance of this in vitro cell model to premalignant and malignant lesions in vivo is not clear. The somatic and germline mutations that affect the cell genome and contribute to the development of cancer can range from point mutations to changes in chromosome number; advanced, aggressively growing tumor cells frequently have highly mutated genomes. The common finding of alterations in karyotype and changes in gene number (aneuploidy) in both naturally occurring tumors in humans and experimentally induced ones in animals suggests that the development of aneuploidy with the resulting disruption of a large array of normal genes is required for tumorigenesis. Others have suggested that only specific mutations are required to transform cells and the genetic instability seen in advanced malignancies is nothing more than an effective means of rapidly generating the required number of mutant allelles required for neoplastic growth. In this case selectively mutating the required pathways should be sufficient to transform a normal cell into a malignant cell even in the absence of the genetic instability that leads to aneuploidy. Zimonjic and colleagues10 have demonstrated this to be true. By the introduction of the SV40 early region elements together with a ras oncogene and hTERT they were able to generate tumorigenic cells without widespread genetic instability.

These cell models with well-defined mutations, but absent the genetic chaos commonly seen in naturally or experimentally induced tumors, can provide information about cell behavior at different points along the road to malignancy; more importantly they can provide information about cell susceptibility to chemotherapeutic agents at these different stages. The minimum number of mutations required to induce TRAIL sensitivity is not known. Using this model we tested whether premalignant cells that had been immortalized, but not yet transformed, were sensitive to TRAIL. We demonstrated that TRAIL could induce apoptosis in both SV7tert and HA1E cells. TRAIL activated both the mitochondrial-dependent and mitochondrial-independent apoptotic pathways in these cells establishing that premalignant cells are sensitive to TRAIL. In contrast normal human PA SMCs that had not been immortalized remained resistant to TRAIL even at high doses for prolonged duration. No toxic effects of TRAIL were seen in the normal (nonimmortalized) human PA SMCs.

The ability of SV7tert cells to form some colonies in soft agar may indicate that they have a greater malignant potential or are closer to a malignant phenotype than the HA1E cells. Another possibility is that the different origins of the cell lines (a normal renal epithelial cell in the case of HA1E compared to a human renal angiomyolipoma in the case of SV7tert cells) may be responsible for this growth difference. The hallmark of malignant transformation, however, is the ability to generate tumors when injected in vivo and SV7tert cells are unable to do this.15 In contrast, a truly transformed cell line such as the SVR cell that can form tumors in vivo22 , developed in excess of 2000 colonies in soft agar (compared to 120 for the SV7tert cells) under similar conditions. We interpret these results to indicate that SV7tert cells still represent a premalignant phenotype despite a more aggressive growth pattern than HA1E cells.

These results demonstrate that the initial step toward malignant transformation, the immortalization of a cell, renders it sensitive to a chemotherapeutic agent, TRAIL, which has no effect on normal cells. Whether this observation is applicable to all premalignant cells is uncertain because we examined only two cell lines both of renal origin. Additional studies to determine TRAIL’s effectiveness in other premalignant cells will be needed. These results do raise the possibility, however, that TRAIL might be effective in treating premalignant lesions in vivo with minimal toxic effects.


   Footnotes
 
Address reprint requests to Brian Fouty, MSB 3340, Center for Lung Biology, Division of Pulmonary Sciences and Critical Care Medicine, University of South Alabama School of Medicine, Mobile, AL 36688. E-mail: bfouty{at}jaguar1.usouthal.edu

Supported by the United States Army Medical Research and Material Command (postdoctoral traineeship award to X.L.); the National Institutes of Health/National Heart, Lung, and Blood Institute (grants RO1 HL57282-03, HL48038-09, and PO1 HL 14985-29 to D.M.R.; and K08 award to B.F.); and the Lymphangio-Leiomyomatosis (LAM) Foundation (to B.F.).

Accepted for publication July 14, 2004.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bossi P, Viale G, Lee AK, Alfano R, Coggi G, Bosari S: Angiogenesis in colorectal tumors: microvessel quantitation in adenomas and carcinomas with clinicopathological correlations. Cancer Res 1995, 55:5049-5053[Abstract/Free Full Text]
  2. Wong MP, Cheung N, Yuen ST, Leung SY, Chung LP: Vascular endothelial growth factor is up-regulated in the early pre-malignant stage of colorectal tumour progression. Int J Cancer 1999, 81:845-850[Medline]
  3. Romeo MS, Sokolova IA, Morrison LE, Zeng C, Baron AE, Hirsch FR, Miller YE, Franklin WA, Varella-Garcia M, Prindiville SA, Dempsey EC, Murphy JR, Bunn PA, Jr, Kennedy TC: Chromosomal abnormalities in non-small cell lung carcinomas and in bronchial epithelia of high-risk smokers detected by multi-target interphase fluorescence in situ hybridization: fluorescence versus white-light bronchoscopy for detection of preneoplastic lesions: a randomized study. J Mol Diagn 2003, 5:103-112[Abstract/Free Full Text]
  4. Hirsch FR, Scagliotti GV, Langer CJ, Varella-Garcia M, Franklin WA: Epidermal growth factor family of receptors in preneoplasia and lung cancer: perspectives for targeted therapies. Lung Cancer 2003, 41:S29-S42
  5. Romeo MS, Sokolova IA, Morrison LE, Zeng C, Baron AE, Hirsch FR, Miller YE, Franklin WA, Varella-Garcia M: Chromosomal abnormalities in non-small cell lung carcinomas and in bronchial epithelia of high-risk smokers detected by multi-target interphase fluorescence in situ hybridization. J Mol Diagn 2003, 5:103-112
  6. Lundberg AS, Hahn WC, Gupta P, Weinberg RA: Genes involved in senescence and immortalization. Curr Opin Cell Biol 2000, 12:705-709[Medline]
  7. Lundberg AS, Randell SH, Stewart SA, Elenbaas B, Hartwell KA, Brooks MW, Fleming MD, Olsen JC, Miller SW, Weinberg RA, Hahn WC: Immortalization and transformation of primary human airway epithelial cells by gene transfer. Oncogene 2002, 21:4577-4586[Medline]
  8. Hahn WC, Dessain SK, Brooks MW, King JE, Elenbaas B, Sabatini DM, DeCaprio JA, Weinberg RA: Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 2002, 22:2111-2123[Abstract/Free Full Text]
  9. Greider CW: Telomere length regulation. Annu Rev Biochem 1996, 65:337-365[Medline]
  10. Zimonjic D, Brooks MW, Popescu N, Weinberg RA, Hahn WC: Derivation of human tumor cells in vitro without widespread genomic instability. Cancer Res 2001, 61:8838-8844[Abstract/Free Full Text]
  11. Srivastava RK: TRAIL/Apo-2L: mechanisms and clinical applications in cancer. Neoplasia 2001, 3:535-546[Medline]
  12. Hersey P, Zhang XD: How melanoma cells evade trail-induced apoptosis. Nat Rev Cancer 2001, 1:142-150[Medline]
  13. Daniel PT, Wieder T, Sturm I, Schulze-Osthoff K: The kiss of death: promises and failures of death receptors and ligands in cancer therapy. Leukemia 2001, 15:1022-1032[Medline]
  14. de Jong S, Timmer T, Heijenbrok FJ, de Vries EG: Death receptor ligands, in particular TRAIL, to overcome drug resistance. Cancer Metastasis Rev 2001, 20:51-56[Medline]
  15. Arbiser JL, Yeung R, Weiss SW, Arbiser ZK, Amin MB, Cohen C, Frank D, Mahajan S, Herron GS, Yang J, Onda H, Zhang HB, Bai X, Uhlmann E, Loehr A, Northrup H, Au P, Davis I, Fisher DE, Gutmann DH: The generation and characterization of a cell line derived from a sporadic renal angiomyolipoma: use of telomerase to obtain stable populations of cells from benign neoplasms. Am J Pathol 2001, 159:483-491[Abstract/Free Full Text]
  16. Counter CM, Hahn WC, Wei W, Caddle SD, Beijersbergen RL, Lansdorp PM, Sedivy JM, Weinberg RA: Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc Natl Acad Sci USA 1998, 95:14723-14728[Abstract/Free Full Text]
  17. Calvo R, West J, Franklin W, Erickson P, Bemis L, Li E, Helfrich B, Bunn P, Roche J, Brambilla E, Rosell R, Gemmill RM, Drabkin HA: Altered HOX and WNT7A expression in human lung cancer. Proc Natl Acad Sci USA 2000, 97:12776-12781[Abstract/Free Full Text]
  18. Bodmer JL, Holler N, Reynard S, Vinciguerra P, Schneider P, Juo P, Blenis J, Tschopp J: TRAIL receptor-2 signals apoptosis through FADD and caspase-8. Nat Cell Biol 2000, 2:241-243[Medline]
  19. Bullani RR, Huard B, Viard-Leveugle I, Byers HR, Irmler M, Saurat JH, Tschopp J, French LE: Selective expression of FLIP in malignant melanocytic skin lesions. J Invest Dermatol 2001, 117:360-364[Medline]
  20. Chen X, Thakkar H, Tyan F, Gim S, Robinson H, Lee C, Pandey SK, Nwokorie C, Onwudiwe N, Srivastava RK: Constitutively active Akt is an important regulator of TRAIL sensitivity in prostate cancer. Oncogene 2001, 20:6073-6083[Medline]
  21. Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, Bodmer JL, Schroter M, Burns K, Mattmann C, Rimoldi D, French LE, Tschopp J: Inhibition of death receptor signals by cellular FLIP. Nature 1997, 388:190-195[Medline]
  22. LaMontagne KR, Jr, Moses MA, Wiederschain D, Mahajan S, Holden J, Ghazizadeh H, Frank DA, Arbiser JL: Inhibition of MAP kinase kinase causes morphological reversion and dissociation between soft agar growth and in vivo tumorigenesis in angiosarcoma cells. Am J Pathol 2000, 157:1937-1945[Abstract/Free Full Text]
  23. Wong MP, Chan SY, Fu KH, Leung SY, Cheung N, Yuen ST, Chung LP: The angiopoietins, tie2 and vascular endothelial growth factor are differentially expressed in the transformation of normal lung to non-small cell lung carcinomas. Lung Cancer 2000, 29:11-22[Medline]
  24. Franklin WA, Carbone DP: Molecular staging and pharmacogenomics. Clinical implications: from lab to patients and back. Lung Cancer 2003, 41:S147-S154
  25. Kyo S, Takakura M, Tanaka M, Kanaya T, Inoue M: Telomerase activity in cervical cancer is quantitatively distinct from that in its precursor lesions. Int J Cancer 1998, 79:66-70[Medline]
  26. Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW, Weinberg RA: Creation of human tumour cells with defined genetic elements. Nature 1999, 400:464-468[Medline]
  27. Hahn WC, Stewart SA, Brooks MW, York SG, Eaton E, Kurachi A, Beijersbergen RL, Knoll JH, Meyerson M, Weinberg RA: Inhibition of telomerase limits the growth of human cancer cells. Nat Med 1999, 5:1164-1170[Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
A. M. Gillenwater, M. Zhong, and R. Lotan
Histone deacetylase inhibitor suberoylanilide hydroxamic acid induces apoptosis through both mitochondrial and Fas (Cd95) signaling in head and neck squamous carcinoma cells
Mol. Cancer Ther., November 1, 2007; 6(11): 2967 - 2975.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
M. Jalving, S. de Jong, J. J. Koornstra, W. Boersma-van Ek, N. Zwart, J. Wesseling, E. G.E. de Vries, and J. H. Kleibeuker
TRAIL Induces Apoptosis in Human Colorectal Adenoma Cell Lines and Human Colorectal Adenomas.
Clin. Cancer Res., July 15, 2006; 12(14): 4350 - 4356.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, X.
Right arrow Articles by Fouty, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, X.
Right arrow Articles by Fouty, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS