| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Department of Ophthalmology,* Ocular Surface Center, Baylor College of Medicine, Houston, Texas; and the Department of Ophthalmology, University of Miami School of Medicine, Miami, Florida
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
We hypothesize that MMP-9 plays an important role in the disruption of corneal epithelial barrier function in dry eye. We previously reported an experimental murine model of dry eye that disrupts corneal epithelial barrier function similar to human dry eye disease.13 The purpose of this study was to compare the effects of experimentally induced dry eye (EIDE) on corneal epithelial morphology and barrier function in MMP-9 knockout mice and their wild-type (WT) littermates.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This research protocol was approved by the Baylor College of Medicine Center for Comparative Medicine and it conformed to the standards in the Association for Research in Vision and Ophthalmology (ARVO) Statement for the use of animals in ophthalmic and vision research. MMP-9 (gelatinase B) knockout mice (referred to as BKO mice) were created on a 129SvEv/CD-1 mixed background as previously reported.14 WT (GelB +/+) littermates were used as controls.
Mouse genotypes were verified throughout the study by polymerase chain reaction (PCR) performed on tail genomic DNA. Genomic DNA was isolated from tails of 1-month-old mice using a Genomic DNA Isolation kit (Sigma, St. Louis, MO) according to the manufacturer’s instructions. A specific primer pair including a sense primer (GCATACTTGTACCGCTATGGT) and an anti-sense primer (TGTGATGTTATGATGGTCCC) was designed from the sequence of MMP-9 gene exon 2 (accession no. X72794), which was knocked out and replaced in BKO mice by a cassette containing the neomycin phosphotransferase cDNA (neo') driven by the phosphoglycerate kinase (PGK) promoter.15 PCR amplification was performed in a 96-well GeneAmp PCR System 9700 using a GeneAmp PCR kit (Applied Biosystems, Foster City, CA) in a 50-µl volume containing 1 µg of genomic DNA, dNTPs, Taq polymerase, and the specific primers.
Creation of Dry Eye
EIDE was created by subcutaneous injection of 0.5 mg/0.2 ml scopolamine hydrobromide four times a day (8:00 a.m., 12:00 p.m., 2:00 p.m., and 5:00 p.m.), alternating between the left and right flanks of 4- to 6-week-old WT and BKO mice as previously described.16 Up to five mice were placed in a cage with a perforated plastic screen on one side to allow airflow from a fan (Cafrano, Wiarton, Ontario, Canada) placed 6 inches in front of it for 16 hours per day. Tear production was measured with phenol-red impregnated cotton threads (Zone-Quick; Oasis, Glendora, CA) placed into the tear meniscus of the lateral canthus for 30 seconds. Tear fluorescein clearance (the residual concentration of fluorescein dye in the tear fluid 15 minutes after instillation) was measured as previously reported.13
Gelatin Zymography
The relative amount of MMP-9 in tear washings was measured by gelatin zymography. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis gelatin zymography was performed using a previously reported method.17 Tear fluid was collected using 1.0-µl polished glass capillary pipettes (Drummond, Broomhall, PA) immediately after a 1.0-µl drop of Brij buffer was placed on the ocular surface. Pooled tear samples from treated or untreated WT and BKO mouse were fractionated in an 8% polyacrylamide gel containing gelatin (0.5 mg/ml). The gels were soaked in 0.25% Triton X-100 for 30 minutes at room temperature, and incubated in a digestion buffer containing 5 mmol/L phenylmethyl sulfonyl fluoride at 37°C overnight. They were stained with 0.25% Coomassie brilliant blue R-250 in 40% isopropanol for 2 hours, and destained overnight in 7% acetic acid. Gelatinolytic activities appeared as clear bands of digested gelatin against a dark blue background of stained gelatin.
RNA Isolation and Semiquantitative Reverse Transcriptase (RT)-PCR
MMP-9 RNA expression in the cornea epithelium was measured by RT-PCR. Total RNA was isolated from corneal epithelia (six eyes per group) of WT or BKO mice with or without EIDE by acid guanidium thiocyanate-phenol-chloroform extraction method. The 371 bp of the mouse MMP-9 gene was amplified by semiquantitative RT-PCR using the sense primer TGTACCGCTATGGTTACACCCG and anti-sense primer CGCGACACCAAACTGGATGAC, which was specifically designed to amplify a segment from exon 2 to exon 3 of the mouse MMP-9 sequence (accession no. NM_013599 and X72794), of which the part of exon 2 and all of intron 2 were replaced in BKO mouse. The housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was amplified as an internal control using the primer pair, GCCAAGGTCATCCATGACAAC and GTCCACCACCCTGTTGCTGTA, which was specifically designed from exon 7 and exon 9 of the mouse GAPDH sequence (accession no. M32599).
Corneal Epithelial Permeability
Corneal epithelial permeability to three different molecules [carboxyfluorescein, Alexa-Fluor-dextran (AFD), and horseradish peroxidase (HRP)] was assessed in six eyes of control mice and mice with EIDE for 2 weeks. One µl of 0.3% carboxyfluorescein (Holles Laboratory, Cohasset, MA) or AFD (Molecular Probes, Eugene, OR) (10 kd molecular weight) was placed on the ocular surface 15 minutes before euthanasia. Corneas were excised, rinsed four times in phosphate-buffered saline (PBS), and placed in wells of a 96-well plate (Costar-Corning, Corning, NY) containing 100 µl of PBS, covered, wrapped in aluminum foil, and placed on a shaker for 60 minutes. Carboxyfluorescein and AFD concentrations were measured with a Cytofluor II fluorometer (Perseptive Biosystems, Framingham, MA) as previously reported.13 HRP uptake by the cornea was measured by placing 1 µl of a 1 U/ml HRP solution on the ocular surface 15 minutes before euthanasia. HRP was detected in excised corneas using an Amplex Red detection system (Molecular Probes) and measuring absorbance using a 530-nm absorbance and 590-nm emission filters at 10, 20, and 30 minutes.
To assess the affects of topical application of MMP-9 on corneal epithelial permeability in BKO mice, 1 µl of a 1 µg/ml solution of active MMP-9 (Oncogene Research Products, Boston, MA) prepared in PBS was administered topically every 2 hours for 10 hours a day for 2 days to mice with and without EIDE. Control mice received 1 µl of PBS every 2 hours or no drops. Three eyes of three animals were evaluated in each treatment group.
Histology
Eyes from WT and BKO mice with and without EIDE were surgically excised, fixed in 10% formalin, and embedded in paraffin. Six-µm sections were stained with hematoxylin and eosin or periodic acid-Schiff (PAS) reagent. Sections from three different eyes in each group were examined and photographed with a Nikon Eclipse E400 (Garden City, NY) microscope equipped with a Nikon DXM 1200 digital camera.
Transmission Electron Microscopy
After fixation, the corneal samples from WT and BKO mice with and without EIDE (n = 2) were rinsed in buffer and postfixed in PIPES-buffered osmium tetroxide (pH 7.2) for 1 hour at room temperature, then rinsed in several changes of distilled water, and dehydrated through a graded series of ethanol. The dehydrated tissues were incubated in two 45-minute changes of propylene oxide followed by a 1:1 mixture of propylene oxide and Spurr’s resin for 1 hour and 30 minutes. The tissue pieces were then incubated in pure resin for 1 hour and 30 minutes, after which they were transferred to fresh resin in block molds and allowed to cure at 60°C overnight. Thick sections (1 µm) cut from the hardened blocks were mounted on glass slides, stained with an alcoholic solution of toluidine blue and basic fuchsin, and examined under the light microscope. Areas of interest were trimmed and 60-nm sections were cut and mounted on copper grids (300 mesh). The grids were stained with uranyl acetate and lead citrate and photographed with a Zeiss EM-900 transmission electron microscope (Peabody, MA). Photographs were taken with Kodak 4489 electron microscope film (Rochester, NY).
Confocal Microscopy
Whole freshly harvested murine corneas from WT and BKO mice with and without EIDE (n = 3) were fixed in cold methanol for 10 minutes at –20°C. After fixation, they were permeabilized with PBS containing 0.1% Triton X for 10 minutes. The tissues were blocked with 20% goat serum in PBS for 1 hour at room temperature to reduce nonspecific labeling. The tissues were then incubated with polyclonal rabbit anti-occludin (1:25 dilution; Zymed, San Francisco, CA) diluted in 5% goat serum and PBS, overnight at 4°C. Tissues without primary antibody were used as negative controls. After extensive washing with PBS, Alexa Fluor-488-conjugated goat anti-rabbit antibody (1:300, Molecular Probes) was applied for 1 hour at room temperature. Tissues were rinsed and counterstained with propidium iodide (1 µg/ml in PBS) for 30 minutes. After washing with PBS, corneal tissues were flattened on microscope slides, mounted with anti-fade Gel/Mount (Fisher, Atlanta, GA) and coverslips were applied.
Digital confocal images (512 x 512 pixels) were captured with a laser-scanning confocal microscope (LSM 510, Zeiss with krypton-argon and He-Ne laser; Zeiss, Thornwood, NY) with 488-excitation and 543-nm emission filters, LP505 and LP560, respectively. They were acquired with a 40/1.3x oil-immersion objective. Samples from treated and untreated animals were captured by using identical photomultiplier tube gain settings and processed using Zeiss LSM-PC software and Adobe Photoshop 6.0. The number of desquamating superficial epithelial cells was counted in three microscopic fields per cornea in paraffin-embedded histological sections from three corneas obtained from each of four groups of mice: control WT, control BKO, WT with EIDE, and BKO with EIDE.
Corneal Epithelial Explant Cultures
Primary human corneal epithelial cells were grown from limbal explants taken from corneoscleral tissues provided by the Lions Eye Bank of Texas (Houston, TX) using a previously described method.18
Explants were grown in six-well culture plates for 
20 days until they were near confluence. Groups of three wells were exposed to MMP-9 (0.5 and 1 µg/ml) for 8 and 24 hours, and another group of three wells served as a media control. The morphology of these cells was observed and photographed before and after MMP-9 treatment by phase and fluorescent microscopy after staining with calcein AM dye (10 µg/ml, Molecular Probes) for 30 minutes. Immunostaining for occludin was performed as described above.
Western Blot
To make soluble and insoluble pools, mouse corneal epithelial cells obtained by scraping were lysed in a buffer containing 1% Triton X-100, 100 mmol/L NaCl, 10 mmol/L HEPES, 2 mmol/L ethylenediaminetetraacetic acid (EDTA) and a EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, Indianapolis, IN), then centrifuged at 15,000 x g for 30 minutes at 4°C. This supernatant was considered the Triton-soluble pool. The pellet was solubilized in 1% SDS and referred to as the Triton-insoluble pool. The total protein concentrations of the cell extracts were measured by a Micro BCA protein assay kit (Pierce, Rockford, IL). The protein samples (50 µg) were mixed with 6x SDS-reducing sample buffer and boiled for 5 minutes before loading. Proteins were separated by SDS-polyacrylamide gel electrophoresis (4 to 15% Tris-HCl, gradient gels; Bio-Rad, Hercules, CA), and transferred electronically to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with 5% nonfat milk in TTBS (50 mmol/L Tris, pH 7.5, 0.9% NaCl, and 0.1% Tween-20) for 1 hour at room temperature, and then incubated 2 hours at room temperature with a 1:160 dilution (1.56 µg/ml) of rabbit anti-occludin antibody (Zymed) with 5% nonfat milk in TTBS. After three washings with TTBS, the membranes were incubated for 1 hour at room temperature with HRP-conjugated secondary antibody donkey anti-rabbit IgG (1:10,000 dilution; Promega, Madison, WI), or goat anti-rat IgG (1:5000 dilution; Pierce, Rockford, IL). After washing the membranes for four times, the signals were detected with an ECL advance chemiluminescence reagent (Amersham, Piscataway, NJ) and the images were acquired and analyzed by a Kodak image station 2000R (Eastman-Kodak, New Haven, CT). Band intensities from three different experiments were averaged. Lysates from control and MMP-9-treated human corneal epithelial cell cultures were also analyzed in a similar manner.
Immunprecipitation
The corneal epithelia of untreated WT mice were lysed in 150 µl of RIPA buffer containing 50 mmol/L Tris-HCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.2% SDS, 150 mmol/L NaCl, 10 mmol/L HEPES, pH 7.3, 2 mmol/L EDTA, 20 mmol/L sodium fluoride, and a EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, Indianapolis, IN). The cell extracts were centrifuged at 15,000 x g for 30 minutes at 4°C and the supernatants were incubated with 20 µl of polyclonal anti-occludin antibody (Zymed) followed by rotation at 4°C overnight. Subsequently, 15 µL of protein A agarose (Sigma, St. Louis, MO) and 100 µl of ImmunoPure IgG-binding buffer (Pierce) were added with further incubation for 2 hours at 4°C. The immunoprecipitates were collected by centrifugation at 3000 x g, washed three times in wash buffer I (20 mmol/L Tris-HCl, pH 8.0, 400 mmol/L KCl, 0.5 mmol/L EDTA, 10% glycerol, and 0.25% Nonidet P-40) and one time in wash buffer II (20 mmol/L Tris-HCl, pH 8.0, 100 mmol/L KCl, 0.5 mmol/L EDTA, 10% glycerol, and 0.25% Nonidet P-40). Bound protein was eluted in 6x SDS-reducing sample buffer and boiled for 5 minutes for immunoblot analysis. Immunoblot were probed with 1:625 dilution (0.8 µg/ml) of monoclonal anti-occludin antibody (Zymed). Cell lysates from control and MMP-9-treated human corneal epithelial cell cultures were immunoprecipitated in a similar manner.
Statistics
The Student’s t-test or the Mann-Whitney test were used where appropriate for between group statistical comparisons. Analysis of variance with Turkey posthoc analysis was used for the MMP-9 reconstitution experiment and comparison of corneal epithelial desquamation.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Genotyping was performed with PCR to confirm that BKO mice lacked a full-length MMP-9 gene. Using a primer pair spanning a sequence of MMP-9 gene exon 2 that was knocked out in BKO mice, a 225-bp fragment was generated from WT animals, but not from BKO mice (Figure 1)
.
|
EIDE with scopolamine injections and a fan resulted in a significant decrease in tear production (Figure 2A)
and worsening of tear fluorescein clearance (Figure 2B)
within 4 days that was sustained throughout the treatment period in both groups. There was no difference in tear production between groups at any time point; however, clearance of fluorescein from the tear film was significantly more delayed in the BKO group at day 14 (P < 0.0001, Figure 2B
).
|
MMP-9 could not be detected in pooled tear fluid washings of untreated (week 0) WT or BKO mice by gelatin zymography (Figure 3A)
. Distinct MMP-9 bands were noted in the tear fluid of WT mice after 2 weeks of EIDE, but not in BKO mice with EIDE. Mouse MMP-9 has been reported to have a higher molecular weight (107 kd) than human MMP-9 (92 kd).15
Western blot of tear MMP-9 could not be performed because of the low protein concentration in the pooled tear washings.
|
. Disruption of the Corneal Epithelial Permeability Barrier Is Significantly Less in Dry Eye BKO Mice
A hallmark of human keratoconjunctivitis sicca is increased corneal epithelial permeability to the diagnostic dye sodium fluorescein. Corneal epithelial permeability to molecules of three different sized molecules (carboxyfluorescein, molecular weight 750 kd; AFD, molecular weight, 10 kd; and HRP, molecular weight, 44 kd) was assessed in control and EIDE mice. Compared to baseline, permeability to all three molecules was significantly increased in WT mice, but not in BKO mice after 2 weeks of EIDE (Figure 4)
.
|
. Treatment with MMP-9 was not continued beyond 2 days because MMP-9-treated mice with EIDE began to develop frank corneal epithelial sloughing.
|
To determine the mechanism by which MMP-9 increases corneal epithelial permeability in dry eye, corneal histology and ultrastructure were compared in WT and BKO mice. Compared to corneas from untreated control animals without EIDE, detaching superficial corneal epithelial cells were observed only in WT mice (mean, 4.2 ± 0.8 per 100-µm segments) in paraffin sections stained with PAS, but not in the corneas of BKO mice (n = 3, Figure 6
).
|
, arrow). The superficial corneas of BKO mice with EIDE had a similar appearance to untreated eyes (Figure 7B
, arrow). In contrast, detaching apical epithelial cells were observed in response to EIDE in WT mice (Figure 7C
, arrow). Taken together, these results indicate there is greater desquamation of apical epithelial cells in response to EIDE in WT mice than in BKO mice.
|
Barrier function is maintained in the normal cornea by tight junctions (zonula occludins) in the differentiated apical corneal epithelial cells. Certain protein constituents of the tight junction complex, such as occludin are substrates of MMPs, including MMP-9.19,20
To determine whether disruption of corneal epithelial tight junctions may be a cause for the accelerated desquamation and altered barrier function in dry eye, the expression of the tight junction protein occludin was evaluated by laser-scanning confocal microscopy and Western blot. In control WT and BKO mice, strong occludin staining in the intercellular junctions and faint staining in the cytoplasm was observed in the apical corneal epithelial layers (Figure 8A)
. Detaching apical epithelial cells were occasionally observed in the central corneas of both WT and BKO mice, although with a greater frequency in the WT (means, 5.6 ± 1.5 and 2.2 ± 1.3 in nine microscopic fields, respectively; P < 0.01). After 1 week of EIDE, numerous detached apical epithelial cells (11.6 ± 1.9) were observed in every field examined in WT corneas (Figure 8B
, top; P < 0.001 versus control). A large area of the central corneal epithelial sloughing was noted in one of the three WT EIDE corneas examined (Figure 8B
, middle). The corneas of BKO mice had fewer detached apical corneal epithelial cells in response to EIDE (3.0 ± 0.7; Figure 8B
, bottom) than the WT corneas (P < 0.001).
|
. There was a predominance of the 65-kd occludin species in the Triton-soluble fraction of control untreated WT and BKO corneas (Figure 9, A and B)
. An increase in the 50-kd occludin band was observed in both Triton-soluble and -insoluble fractions in the corneal epithelium of WT mice in response to EIDE (Figure 9, A and B)
. In contrast, the ratio between the 50-kd and 65-kd bands decreased in the corneal epithelia of BKO mice with EIDE (Figure 9, A and B)
. The identity of these two occludin bands was confirmed by immunoprecipitation of mouse corneal epithelial lysates using a polyclonal occludin antisera, followed by immunoblotting with a monoclonal occludin antibody (Figure 9C)
.
|
. These MMP-9-induced changes were observed in all three sets of treated cultures. These changes in immunoreactivity were accompanied by a decrease in the density of the 65-kd occludin band and an increase in the 50-kd band in MMP-9-treated cells, compared to media controls (Figure 11)
. The identity of these two occludin bands was confirmed by immunoprecipitation of human corneal epithelial lysates (Figure 11C)
.
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Increased concentration and activity of MMP-9 has been observed in the tear fluid of human dry eye patients.10-12 The tear fluid concentration of MMP-9 was observed to increase as tear clearance decreased.11 Consistent with this finding is the observation that tear MMP-9 concentration increases in the nocturnal closed eye.21 We previously observed that among dry eye patients, the highest tear MMP-9 concentrations were in patients with Sjögren’s syndrome, the most severe dry eye condition in which the ability to reflex tear is lost, similar to the scopolamine-treated mice in this study.10 Among these eyes, the highest MMP-9 concentrations were observed in patients who developed corneal epithelial defects and sterile stromal ulceration.10 The source of the increased MMP-9 in dry eye tear fluid has not been established. Possible sources include activated ocular surface epithelial cells and leukocytes that infiltrate the ocular surface.22,23 The current study indicates that increased expression of MMP-9 by the corneal epithelium is certainly one source. In experimental corneal epithelial wounds, increased MMP-9 production has been observed in the basal corneal epithelial cells.24,25 In contrast, increased MMP-9 has been observed in all layers of the corneal epithelium, including the superficial cells in inflammatory conditions, such as herpetic keratitis.26 Therefore, MMP-9 may affect the superficial corneal epithelium either by direct production by these cells, or by paracellular diffusion from deeper epithelial layers, a process that can be enhanced by the epithelial stress of dry eye.
Our studies indicate that MMP-9 disrupts tight junctions in the superficial layers of the corneal epithelium, promoting cell detachment and exposure of the less differentiated underlying wing epithelial cells. MMP-9 has numerous substrates, including the tight junction protein occludin.19,20,27 The increase in lower sized (50 kd) occludin in the corneal epithelia of WT mice with EIDE may be because of proteolytic cleavage of occludin by MMP-9, or it may represent incompletely processed occludin in the less differentiated wing epithelial cells that represent a larger percentage of the corneal epithelial population after the well-differentiated apical epithelia detach. Stimulation of protease production by cultured human umbilical vein endothelial cells with protein tyrosine phosphate inhibitors was previously found to increase 50-kd occludin, which was reported to be an occludin degradation product because this shift was blocked by the MMP inhibitor 1,10-phenanthroline.19
These findings indicate that MMP-9 may play a physiological role in normal corneal desquamation. Vitamin A deficiency has been reported to decrease MMP-9 production by the corneal epithelium and it is associated with reduced desquamation of the apical corneal epithelium, leading to increased corneal epithelial thickness.28,29 The effects of MMP-9 on cultured human corneal epithelial cells in the current study further support this concept. MMP-9 treatment was observed to promote epithelial detachment and loss of the honeycomb occludin staining pattern found in stratified differentiated cells. This was accompanied by an increase in 50-kd occludin in MMP-9-treated cultures.
The findings of our study suggest that targeting MMP-9 in human keratitis sicca may lessen the severity of clinical disease. There is currently no approved therapy that inhibits MMP-9 production, release, or activation. Corticosteroids and doxycycline, two agents that have been observed to decrease the severity of human keratitis sicca30-32 have been reported to decrease the level of MMP-9 in conditioned media from primary human cornea epithelial cultures.22,33 It is likely that other more specific inhibitors of MMP-9 will become available in the future.
|
Footnotes |
|---|
Supported by the National Eye Institute Grant EY11915, an unrestricted grant from Research to Prevent Blindness, The Oshman Foundation, and the William Stamps Farish Fund (to S.C.P.) and R01 EY1265, P30 EY14801, and the Walter G. Ross Foundation (E.M.F.).
Accepted for publication September 28, 2004.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  K. Kimura, S. Teranishi, K. Fukuda, K. Kawamoto, and T. Nishida Delayed Disruption of Barrier Function in Cultured Human Corneal Epithelial Cells Induced by Tumor Necrosis Factor-{alpha} in a Manner Dependent on NF-{kappa}B Invest. Ophthalmol. Vis. Sci., February 1, 2008; 49(2): 565 - 571. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. De Paiva, A. L. Villarreal, R. M. Corrales, H. T. Rahman, V. Y. Chang, W. J. Farley, M. E. Stern, J. Y. Niederkorn, D.-Q. Li, and S. C. Pflugfelder Dry Eye-Induced Conjunctival Epithelial Squamous Metaplasia Is Modulated by Interferon-{gamma} Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2553 - 2560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-C. Yoon, C. S. De Paiva, H. Qi, Z. Chen, W. J. Farley, D.-Q. Li, and S. C. Pflugfelder Expression of Th-1 Chemokines and Chemokine Receptors on the Ocular Surface of C57BL/6 Mice: Effects of Desiccating Stress Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2561 - 2569. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Reijerkerk, G. Kooij, S. M. A. van der Pol, S. Khazen, C. D. Dijkstra, and H. E. de Vries Diapedesis of monocytes is associated with MMP-mediated occludin disappearance in brain endothelial cells FASEB J, December 1, 2006; 20(14): 2550 - 2552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Garg, M. Rojas, A. Ravi, K. Bockbrader, S. Epstein, M. Vijay-Kumar, A. T. Gewirtz, D. Merlin, and S. V. Sitaraman Selective Ablation of Matrix Metalloproteinase-2 Exacerbates Experimental Colitis: Contrasting Role of Gelatinases in the Pathogenesis of Colitis J. Immunol., September 15, 2006; 177(6): 4103 - 4112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Corrales, M. E. Stern, C. S. De Paiva, J. Welch, D.-Q. Li, and S. C. Pflugfelder Desiccating stress stimulates expression of matrix metalloproteinases by the corneal epithelium. Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3293 - 3302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. De Paiva, R. M. Corrales, A. L. Villarreal, W. Farley, D.-Q. Li, M. E. Stern, and S. C. Pflugfelder Apical corneal barrier disruption in experimental murine dry eye is abrogated by methylprednisolone and doxycycline. Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 2847 - 2856. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
