| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |




From the Cutaneous Biology Research Center* and the Department of Pathology,
Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts; the Weatherall Institute of Molecular Medicine,
John Radcliffe Hospital, Headington, Oxford, United Kingdom; and the Institute of Pharmaceutical Sciences,
Swiss Federal Institute of Technology Zurich, Zurich, Switzerland
| Abstract |
|---|
|
|
|---|
The mucin-type transmembrane glycoprotein podoplanin is one of the most highly expressed lymphatic-specific genes in cultured human lymphatic endothelial cells (LECs),10 and we have previously shown that podoplanin is a target gene of the homeobox gene Prox1, a master gene that controls the development of lymphatic progenitors from embryonic veins.11 In vivo expression of podoplanin in lymphatic endothelium was first reported by Wetterwald and colleagues,12 who named it "E11 antigen." It was further characterized under the name "podoplanin," because of its low-level expression in kidney podocytes.13 However, podoplanin is homologous to T1alpha, which was found to encode an antigen that is expressed at the apical surface of alveolar type I cells in rat lung.14,15 Expression of podoplanin has also been detected in the choroid plexus in the rat brain and the ciliary epithelium in the rat eye.16 Other podoplanin homologs include OTS-8,17 RTI40,18 gp38,19 canine gp40,20 human gp36,21 and murine PA2.26.22 However, little is understood about the biological function of podoplanin. Recently, we found that mice deficient in podoplanin develop congenital lymphedema and that they have defects in lymphatic vessel, but not blood vessel, pattern formation.23 Moreover, our in vitro studies indicated that podoplanin is involved in mediating cell motility by promoting rearrangement of the actin cytoskeleton.23
In this study, we aimed to identify an anti-human podoplanin antibody suitable for immunostains of archival paraffin-embedded human tissues, and to comprehensively characterize the cell type-specific expression of podoplanin in normal tissues and its potential involvement in tumor progression. We show that the commercially available antibody D2-40, originally raised against an unidentified M2A protein derived from germ cell tumors,24 specifically recognizes human podoplanin and that it can be used for routine immunohistochemical studies of tumor lymphangiogenesis. Using normal human tissue arrays, we found that podoplanin is also expressed by bile duct cells of the liver, peritoneal mesothelial cells, osteocytes, glandular myoepithelial cells, ependyma cells, and by stromal reticular cells and follicular dendritic cells of lymphoid organs. These findings were confirmed in tissue arrays of normal mouse tissues. Importantly, podoplanin was also strongly expressed by granulosa cells in normal ovarian follicles and by dysgerminomas and granulosa cell tumors. Although podoplanin was primarily absent from normal human epidermis, its expression was strongly induced in 22 of 28 squamous cell carcinomas (SCCs) studied. These findings suggest a potential role of podoplanin in tumor progression, and they also identify the first commercially available antibody for the specific staining of a defined lymphatic marker in human archival tissue sections, thereby enabling more widespread studies of tumor lymphangiogenesis and its role in tumor progression.
| Materials and Methods |
|---|
|
|
|---|
Immunofluorescence stainings were performed on 6-µm cryostat sections of neonatal human foreskin or on 6-µm paraffin sections of human malignant melanoma as described previously,6,10 using the mouse monoclonal antibody D2-40 (Signet, Dedham, MA), rabbit polyclonal antibodies against the lymphatic markers LYVE-17 and Prox125 (kindly provided by Dr. K. Alitalo, University of Helsinki, Helsinki, Finland), CD34, CD31 (BD Pharmingen, San Diego, CA), and corresponding secondary antibodies labeled with Alexa Fluor 488 or Alexa Fluor 594 (Molecular Probes, Eugene, OR). Nuclei were counterstained with 20 µg/ml of Hoechst bisbenzimide (Molecular Probes). Additional immunohistochemical stains were performed on tissue arrays of normal mouse (MaxArray mouse tissue microarray slides; Zymed, San Francisco, CA) and human tissues (MaxArray human normal tissue microarray slides, Zymed), human skin tumors (IMH-323; Imgenex, San Diego, CA) and ovary tumors (IMH-347, Imgenex) as described previously.6 Briefly, the primary antibodies D2-40 or LYVE-1 were applied, followed by incubation with conjugated anti-mouse or anti-rabbit immunoglobulin using the 3-amino-9-ethylcabazole peroxidase kit (Vector Laboratories, Burlingame, CA). The D2-40 antibody only stains human tissues, but not mouse tissues. For mouse tissues, the hamster monoclonal antibody 8.1.1 (Developmental Studies Hybridoma Bank, University of Iowa, Ames, IA) was used. We have previously shown that this antibody, originally raised against a mouse gp38 antigen,19 specifically recognizes podoplanin expressed by lymphatic vessels in wild-type mice, but not in podoplanin-deficient mice.23 The 8.1.1 antibody does not recognize human podoplanin. Sections were examined by using a Nikon E-600 microscope (Nikon, Melville, NY) and images were captured with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI).
Cell Transfection
Immortalized rat L6 myoblasts26 were maintained in Dulbeccos modified Eagles medium that contained 10% fetal bovine serum, 2 mmol/L L-glutamine, and antibiotics (Life Science, Grand Island, NY). The human podoplanin coding sequence was cloned into the pCMV6-XL5 vector (Origene, Rockville, MD). Rat myoblasts were transfected either with the full-length human podoplanin cDNA or with the pCMV6-XL5 vector alone using the SuperFect transfection reagent (Qiagen, Chatsworth, CA). Specific binding of D2-40 antibody to human podoplanin was investigated by immunofluorescence staining of the transiently transfected cells after paraformaldehyde fixation (Fluka, Buchs, Germany).
Expression of Podoplanin as a Soluble IgFc Fusion Protein
For the amplification of full length human podoplanin, RNA was isolated from cultured human dermal microvascular endothelial cells (Promocell, Heidelberg, Germany) using a Qiagen RNeasy kit, according to the manufacturers instructions (Qiagen, Valencia, CA). First strand synthesis was performed by oligo-dT priming using 3 µg of total RNA. The podoplanin coding sequence was amplified from 2 µl of this product by polymerase chain reaction with the primers hPodo156FHindIII (GTCAGCAGGAAGCTTCCAGGAGAGCAACAACTCAAC) and hPodo570RBamHI (TCGGCTCCGGATCCACTGTTGACAAACCATCTTTCTC)using Pfu DNA polymerase (Stratagene, La Jolla, CA). After digestion with HindIII and BamHI, the product was cloned into the HindIII/BamHI-digested IgFc vector pCDM7Ig,27 to yield a construct encoding podoplanin fused at the COOH terminus to the Fc region of human IgG1.7 For expression and purification of the podoplanin-Fc fusion protein, the expression vector was transfected into human 293T cells using the calcium phosphate method. Transfectants were grown in serum-free UltraCHO medium (Bio-Whittaker, Walkersville, MD) for 3 days before harvesting culture supernatants. The fusion protein was purified by affinity chromatography on a column of 1 ml of protein A Sepharose (Sigma, St. Louis, MO). Fractions containing the fusion protein were neutralized and the purity was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Enzyme-Linked Immunosorbent Assay (ELISA)
Binding of the mouse monoclonal antibody D2-40 to immobilized podoplanin-Fc fusion protein was tested in 96-well ELISA plates (Nalge Nunc, Rochester, NY). Plates were coated with 5 µg of either human podoplanin-Fc or human LYVE-1-Fc.7 After overnight incubation, wells were washed and blocked using 1% bovine serum albumin (Sigma) and 0.05% Tween (Sigma). D2-40 antibody was applied at a series of dilutions from 1:50 to 1:50,000, each in triplicates and incubated for 1 hour. Unbound antibody was removed by washing with phosphate-buffered saline; bound antibody was detected by incubation with horseradish peroxidase-conjugated goat anti-mouse IgG (Pierce, Rockford, IL) followed by O-phenylenediamine substrate (Sigma), and the absorbance was measured at 490 nm in a microplate reader (Bio-Rad, Hercules, CA).
Cell Transfection with Human Podoplanin siRNAs and Western Blot Analyses
The following small inhibitory RNA (siRNA) oligonucleotides were synthesized by Dharmacon (Lafayette, CO): R1, 5'-GCGAAGACCGCUAUAAGUCdTdT-3' and R2, 5'-AAGAUGGUUUGUCAACAGUdTdT-3'.23 Primary human LECs10 were transfected or not with siRNA oligonucleotides (500 nmol) or with equimolar concentrations of control plasmid vector by using the Nucleofector kit (Amaxa, Cologne, Germany) according to the manufacturers instructions. Cells were harvested at 4 days after transfection. For Western analyses, cell lysates were obtained as described11 and 30 ng of protein per sample were immunoblotted with the D2-40 antibody. For detection of podoplanin-Fc fusion protein, 200 ng of human podoplanin-Fc and human LYVE-1-Fc7 as a control were electrophoresed on a polyacrylamide sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and were transferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Piscataway, NJ). The blots were incubated with D2-40 (0.5 µg/ml) and were developed by using a chemiluminescent detection kit (Pierce).
| Results |
|---|
|
|
|---|
Immunofluorescence staining of rat myoblasts that were transiently transfected with a human podoplanin overexpression vector, with the monoclonal antibody D2-40 revealed strong cytoplasmic labeling of podoplanin-transfected cells (Figure 1B)
whereas control vector-transfected cells were unstained (Figure 1A)
. The D2-40 antibody specifically detected a human podoplanin-Fc fusion protein, but not a LYVE-1 fusion protein, as assessed by Western blotting (Figure 1C)
. ELISAs further demonstrated specific binding of the D2-40 antibody to the immobilized human podoplanin-Fc fusion protein, whereas we only found low nonspecific binding to the human LYVE-1-Fc fusion protein (Figure 1D)
that also contains glycosylated sialoglycoproteins with O-linked carbohydrate structures. Because the D2-40 antibody recognizes human but not mouse podoplanin, its specificity could not be further tested in lymphatic cells obtained from podoplanin-deficient mice that we previously described.23
Therefore, we studied siRNA-mediated knock-down of podoplanin in human LECs. We found that siRNA-mediated podoplanin knockdown resulted in reduced podoplanin detection by D2-40, by 66% and 36% (Figure 1E)
, as compared with control LECs.
|
Immunofluorescence double stains of normal human skin with the D2-40 antibody and with antibodies against the lymphatic-specific hyaluronan receptor LYVE-17
or the lymphatic homeobox protein Prox128
revealed complete overlap of immunoreactivity, confirming specific podoplanin expression by lymphatics, but not by blood vessels (Figure 2; A to F)
. Double immunostains with D2-40 and with an antibody against the blood vascular-specific marker CD3410
further demonstrated mutually exclusive expression of podoplanin and CD34 by cutaneous lymphatic vessels and blood vessels, respectively (Figure 2; G to I)
. Occasionally, focal expression of podoplanin was also detected on basal epidermal keratinocytes (Figure 2A)
.
|
|
All organs examined, except for the central nervous system, showed strong labeling of LECs with the anti-podoplanin antibody 8.1.1 (Figure 4, A to L
; Table 1
), as confirmed by staining of serial sections for LYVE-1 (data not shown). Myoepithelial cells of the salivary glands and fibromyocytes of the testis (Figure 4, C and F)
also expressed podoplanin. In the central nervous system, podoplanin was expressed by ependymal cells lining the ventricles (Figure 4D)
, by choroid plexus cells (Figure 4D)
, and by meningeal cells (Figure 4I)
. In the peripheral nervous system, perineural cells expressed podoplanin, as detected in spinal nerve roots (Figure 4E)
and in peripheral nerves of the skin, the tongue, and the skeletal muscle (data not shown). In agreement with the findings in human tissues, stromal reticular cells and dendritic reticular cells of the follicular germinal centers in the spleen and in lymph nodes (Figure 4, G and H)
, as well as osteocytes (Figure 4I)
and alveolar type I cells (Figure 4J)
also expressed podoplanin. Remarkably, the germinal epithelium and granulosa cells of primary and secondary ovarian follicles showed strong podoplanin expression (Figure 4L)
, whereas podoplanin was only weakly expressed by tertiary follicles and was absent from corpora lutea (for summary of results obtained in human and murine tissues, see Table 1
). No major differences of staining patterns were observed between human and mouse tissues.
|
|
We next investigated whether the D2-40 anti-podoplanin antibody might reliably detect tumor-associated lymphatic vessels and whether tumor cells themselves might express podoplanin, using human tumor microarrays. Because of the observed occasional expression of podoplanin in epidermal keratinocytes of the skin, and in distinct cells of the ovary, we focused our study on SCCs and ovarian tumors. All tumor-associated lymphatic vessels expressed podoplanin, as confirmed by staining of serial sections for LYVE-1 (see below and data not shown). We also found strong podoplanin expression by tumor cells of dysgerminomas of the ovary (four of four tumors; Figure 5A
), whereas serial sections of those tumors revealed that LYVE-1 labeling was restricted to lymphatic vessels only (Figure 5B)
. One of three granulosa cell tumors also expressed podoplanin (Figure 5C)
, whereas podoplanin was absent from all other ovarian tumors studied, including adenocarcinomas (n = 5; Figure 5D
), thecomas (n = 5), and Sertoli-Leydig cell tumors (n = 2; data not shown). Importantly, podoplanin was expressed by the majority of primary SCCs of the skin studied (22 of 28 tumors). Moderately differentiated SCCs (n = 12) expressed podoplanin predominantly within the basal tumor cell layer (Figure 5E)
with enhanced membrane-staining pattern (Figure 5F)
, whereas less-differentiated SCCs (n = 3) showed additional podoplanin expression beyond the basal cell layer with frequent cytoplasmic staining (Figure 5G)
. In contrast, well-differentiated SCCs (n = 13) did not express podoplanin (Figure 5H)
. All recurrent SCCs (three of three tumors) showed high podoplanin expression levels (data not shown).
|
| Discussion |
|---|
|
|
|---|
Our study of the tissue distribution of podoplanin in normal human and murine tissues revealed that podoplanin is expressed by lymphatic vessels, but not by blood vessels, in all organs examined. Surprisingly, however, we found that podoplanin is also expressed by a number of nonendothelial cell types in normal tissues, in particular by several cell types that are exposed to a fluid interphase. Within the central nervous system, podoplanin is expressed by ciliated epithelial ependymal cells that line the ventricular system and the central canal, and by the cuboidal epithelial cells of the choroid plexus that represent a modified ependyma covering a highly vascular connective tissue core.30 This finding is in agreement with the reported expression of the lung type I alveolar cell marker T1alpha in epithelial cells of the choroid plexus16 because T1alpha and podoplanin are in fact identical proteins.23 It is of interest that we also found podoplanin expression in the epithelial cells of the hepatic bile ducts that are exposed to the alkaline bile. Together with the expression of podoplanin/T1alpha in alveolar type I cells (our data and Rishi et al15 ) and in glomerular podocytes of the kidney,13 these findings indicate that the extensively O-glycosylated mucin-type glycoprotein podoplanin with its high content of sialic acid and its negative charged structure might have a protective function toward these external and internal fluid compartments.
In a recent study, we found that podoplanin overexpression in cultured vascular endothelial cells promoted the formation of elongated cell extensions and significantly increased endothelial cell adhesion, migration, and tube formation, indicating an important role in cytoskeletal reorganization.23 This potential function of podoplanin is supported by our results that myofibroblasts of the prostate, myoepithelial cells of the mammary and salivary glands, fibromyocytes of the testis, and cells of the perineurium strongly express podoplanin. All these cell types are contractile with frequent changes of their cell shape mediated by myofilaments.31 Therefore, podoplanin might play an important role in mediating cellular contractile properties and cytoskeletal reorganization.
Surprisingly, we found podoplanin to be also expressed by granulosa cells, a stratified epithelium surrounding the oocyte, of developing ovarian follicles. Whereas primary and secondary follicles showed very strong podoplanin expression, its expression was reduced in developed follicles and was completely absent from the corpus luteum or corpus albicans stage. Thus, podoplanin might play a role in early granulosa cell differentiation, but its direct biological function in follicle maturation remains to be established. It is of interest that podoplanin was strongly expressed by all tumor cells of ovarian dysgerminomas and a fraction of granulosa cell tumors, but not by other ovarian neoplasias, indicating its potential use as a specific marker for these tumor entities.
In agreement with our previous study in mouse skin,23 we occasionally detected weak focal podoplanin expression in basal epidermal keratinocytes of normal human skin, although the majority of keratinocytes was podoplanin-negative. Importantly, however, we found that the majority of human SCCs of the skin strongly expressed podoplanin, with a particularly strong expression in recurrent SCCs. Moreover, we found that podoplanin expression was absent from well-differentiated SCCs, with increasing expression in moderately differentiated SCCs and with further enhanced expression in poorly differentiated SCCs that are characterized by enhanced propensity for tumor progression. Together with the observed up-regulation of the podoplanin homologue PA2.26 during murine epidermal carcinogenesis22 and with our previous findings that podoplanin overexpression promoted cell motility and migration,23 these results indicate a possible role for podoplanin in epithelial tumor progression, possibly by enhancing tumor cell spread via lymphatic vessels. We currently investigate whether enhanced podoplanin expression might also be involved in mediating the metastatic spread of experimental tumors.
Lymph node metastasis is a major determinant for the staging and clinical management of human cancers. In contrast to the extensive studies on tumor-associated angiogenesis, however, little is known about the mechanisms by which tumor cells gain entry into the lymphatic system. Recent studies in experimental tumor metastasis models have suggested an important role of tumor-associated lymphatic vessels in promoting cancer spread to lymph nodes,3,4,32,33 and an increasing number of clinicopathological studies have shown a direct correlation between tumor expression of the lymphangiogenesis factors VEGF-C or VEGF-D and metastatic tumor spread in many human cancers.34 Importantly, tumor lymphangiogenesis has been recently identified as a new prognostic parameter for the risk of lymph node metastasis of human cutaneous malignant melanomas and of head and neck cancers.6,35 Antibodies against the lymphatic hyaluronan receptor LYVE-1 have been used to visualize lymphatic vessels in these studies; however, the specificity of LYVE-1 for LECs has been questioned by some investigators36 and antibodies against LYVE-1 are not generally available. Our results reveal that podoplanin, detected by the D2-40 antibody, is a specific marker for human tumor-associated lymphatic vessels, as confirmed by co-expression of podoplanin, LYVE-1 and Prox1 in melanoma-associated peritumoral lymphatic vessels. Because podoplanin is also expressed by a variety of nonendothelial cell types, as demonstrated in this study, double stains for the pan-vascular marker CD31 and for podoplanin should be used to confirm the identity of lymphatic vessels. Taken together, the commercially available antibody D2-40, specifically detecting podoplanin in archival paraffin-embedded human tissues, represents a promising tool for more widespread studies of tumor lymphangiogenesis and its role in human cancer progression.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by the National Institutes of Health (National Cancer Institute grants CA69184, CA86410, and CA92644 to M.D. and Pathology Training grant 5T32CA09216 to S.S.D.), the Susan G. Komen Breast Cancer Foundation (to M.D.), the American Cancer Society (program project grant 99-23901 to M.D.), the Deutsche Forschungsgemeinschaft (to V.S.), and the Cutaneous Biology Research Center through the Massachusetts General Hospital/Shiseido Co. Ltd. Agreement (to M.D.).
Accepted for publication November 24, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Watanabe, T. Hamanaka, T. Takemura, and A. Murakami Involvement of Platelet Coagulation and Inflammation in the Endothelium of Schlemm's Canal Invest. Ophthalmol. Vis. Sci., January 1, 2010; 51(1): 277 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hirakawa, M. Detmar, D. Kerjaschki, S. Nagamatsu, K. Matsuo, A. Tanemura, N. Kamata, K. Higashikawa, H. Okazaki, K. Kameda, et al. Nodal Lymphangiogenesis and Metastasis: Role of Tumor-Induced Lymphatic Vessel Activation in Extramammary Paget's Disease Am. J. Pathol., November 1, 2009; 175(5): 2235 - 2248. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kambouchner and J.-F. Bernaudin Intralobular Pulmonary Lymphatic Distribution in Normal Human Lung Using D2-40 Antipodoplanin Immunostaining J. Histochem. Cytochem., July 1, 2009; 57(7): 643 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Peduto, S. Dulauroy, M. Lochner, G. F. Spath, M. A. Morales, A. Cumano, and G. Eberl Inflammation Recapitulates the Ontogeny of Lymphoid Stromal Cells J. Immunol., May 1, 2009; 182(9): 5789 - 5799. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Durchdewald, J. Guinea-Viniegra, D. Haag, A. Riehl, P. Lichter, M. Hahn, E. F. Wagner, P. Angel, and J. Hess Podoplanin Is a Novel Fos Target Gene in Skin Carcinogenesis Cancer Res., September 1, 2008; 68(17): 6877 - 6883. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Vanderbilt, L. Allen, R. F. Gonzalez, Z. Tigue, J. Edmondson, D. Ansaldi, A. M. Gillespie, and L. G. Dobbs Directed Expression of Transgenes to Alveolar Type I Cells in the Mouse Am. J. Respir. Cell Mol. Biol., September 1, 2008; 39(3): 253 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakazawa, S. Sato, M. Naito, Y. Kato, K. Mishima, H. Arai, T. Tsuruo, and N. Fujita Tetraspanin family member CD9 inhibits Aggrus/podoplanin-induced platelet aggregation and suppresses pulmonary metastasis Blood, September 1, 2008; 112(5): 1730 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Koop, M. Eikmans, M. Wehland, H. Baelde, D. Ijpelaar, R. Kreutz, H. Kawachi, D. Kerjaschki, E. de Heer, and J. A. Bruijn Selective Loss of Podoplanin Protein Expression Accompanies Proteinuria and Precedes Alterations in Podocyte Morphology in a Spontaneous Proteinuric Rat Model Am. J. Pathol., August 1, 2008; 173(2): 315 - 326. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Niakosari, H. J. Kahn, D. McCready, D. Ghazarian, L. E. Rotstein, A. Marks, A. Kiss, and L. From Lymphatic Invasion Identified by Monoclonal Antibody D2-40, Younger Age, and Ulceration: Predictors of Sentinel Lymph Node Involvement in Primary Cutaneous Melanoma Arch Dermatol, April 1, 2008; 144(4): 462 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Browning, D Bailey, and A Parker D2-40 is a sensitive and specific marker in differentiating primary adrenal cortical tumours from both metastatic clear cell renal cell carcinoma and phaeochromocytoma J. Clin. Pathol., March 1, 2008; 61(3): 293 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kajiya, R. Huggenberger, I. Drinnenberg, B. Ma, and M. Detmar Nitric oxide mediates lymphatic vessel activation via soluble guanylate cyclase {alpha}1{beta}1-impact on inflammation FASEB J, February 1, 2008; 22(2): 530 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kawaguchi, A. K. El-Naggar, V. Papadimitrakopoulou, H. Ren, Y.-H. Fan, L. Feng, J. J. Lee, E. Kim, W. K. Hong, S. M. Lippman, et al. Podoplanin: A Novel Marker for Oral Cancer Risk in Patients With Oral Premalignancy J. Clin. Oncol., January 20, 2008; 26(3): 354 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
B S M S Siriwardena, Y Kudo, I Ogawa, M N G P K Udagama, W M Tilakaratne, and T Takata VEGF-C is associated with lymphatic status and invasion in oral cancer J. Clin. Pathol., January 1, 2008; 61(1): 103 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Suzuki-Inoue, Y. Kato, O. Inoue, M. K. Kaneko, K. Mishima, Y. Yatomi, Y. Yamazaki, H. Narimatsu, and Y. Ozaki Involvement of the Snake Toxin Receptor CLEC-2, in Podoplanin-mediated Platelet Activation, by Cancer Cells J. Biol. Chem., September 7, 2007; 282(36): 25993 - 26001. [Abstract] [Full Text] [PDF] |
||||
![]() |
A B Soares, L Ponchio, P B Juliano, V C de Araujo, and A Altemani Lymphatic vascular density and lymphangiogenesis during tumour progression of carcinoma ex pleomorphic adenoma J. Clin. Pathol., September 1, 2007; 60(9): 995 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bock, J. Onderka, T. Dietrich, B. Bachmann, F. E. Kruse, M. Paschke, G. Zahn, and C. Cursiefen Bevacizumab as a Potent Inhibitor of Inflammatory Corneal Angiogenesis and Lymphangiogenesis Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2545 - 2552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Donoghue, F. L. Lederman, B. J. Susil, and P. A.W. Rogers Lymphangiogensis of normal endometrium and endometrial adenocarcinoma Hum. Reprod., June 1, 2007; 22(6): 1705 - 1713. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. McColl, K. Paavonen, T. Karnezis, N. C. Harris, N. Davydova, J. Rothacker, E. C. Nice, K. W. Harder, S. Roufail, M. L. Hibbs, et al. Proprotein convertases promote processing of VEGF-D, a critical step for binding the angiogenic receptor VEGFR-2 FASEB J, April 1, 2007; 21(4): 1088 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kunita, T. G. Kashima, Y. Morishita, M. Fukayama, Y. Kato, T. Tsuruo, and N. Fujita The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis Am. J. Pathol., April 1, 2007; 170(4): 1337 - 1347. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Heller, M. T. Lindenmeyer, C. D. Cohen, U. Brandt, D. Draganovici, M. Fischereder, M. Kretzler, H.-J. Anders, T. Sitter, I. Mosberger, et al. The Contribution of B Cells to Renal Interstitial Inflammation Am. J. Pathol., February 1, 2007; 170(2): 457 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Harrell, B. M. Iritani, and A. Ruddell Tumor-Induced Sentinel Lymph Node Lymphangiogenesis and Increased Lymph Flow Precede Melanoma Metastasis Am. J. Pathol., February 1, 2007; 170(2): 774 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kamo, K. Yasuchika, H. Fujii, T. Hoppo, T. Machimoto, T. Ishii, N. Fujita, T. Tsuruo, J. K. Yamashita, H. Kubo, et al. Two populations of Thy1-positive mesenchymal cells regulate in vitro maturation of hepatic progenitor cells Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G526 - G534. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Martin-Villar, D. Megias, S. Castel, M. M. Yurrita, S. Vilaro, and M. Quintanilla Podoplanin binds ERM proteins to activate RhoA and promote epithelial-mesenchymal transition J. Cell Sci., November 1, 2006; 119(21): 4541 - 4553. [Abstract] [Full Text] [PDF] |
||||
![]() |
K J Butnor My approach to the diagnosis of mesothelial lesions. J. Clin. Pathol., June 1, 2006; 59(6): 564 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Fiedler, S. Christian, S. Koidl, D. Kerjaschki, M. S. Emmett, D. O. Bates, G. Christofori, and H. G. Augustin The Sialomucin CD34 Is a Marker of Lymphatic Endothelial Cells in Human Tumors Am. J. Pathol., March 1, 2006; 168(3): 1045 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Gombos, X. Xu, C. S. Chu, P. J. Zhang, and G. Acs Peritumoral Lymphatic Vessel Density and Vascular Endothelial Growth Factor C Expression in Early-Stage Squamous Cell Carcinoma of the Uterine Cervix Clin. Cancer Res., December 1, 2005; 11(23): 8364 - 8371. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Renyi-Vamos, J. Tovari, J. Fillinger, J. Timar, S. Paku, I. Kenessey, G. Ostoros, L. Agocs, I. Soltesz, and B. Dome Lymphangiogenesis Correlates with Lymph Node Metastasis, Prognosis, and Angiogenic Phenotype in Human Non-Small Cell Lung Cancer Clin. Cancer Res., October 15, 2005; 11(20): 7344 - 7353. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |