| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |


From the Department of Medicine,* Shiga University of Medical Science, Otsu, Shiga; Marutamachi Hospital,
Kyoto; and the Second Department of Medicine,
Asahikawa Medical College, Asahikawa, Hokkaido, Japan
| Abstract |
|---|
|
|
|---|
Recent large clinical studies have indicated that the usefulness of estrogen is limited because of its harmful effects such as carcinogenesis of the mamma.11 Thus, selective estrogen receptor modulators (SERMs), which bind to the estrogen receptor and modulate estrogen receptor-mediated gene transcription, are clinically applied to treat all stages of hormone-responsive breast cancer. Raloxifene hydrochloride (RLX) is a SERM with a benzothiophene structure that has been approved for the prevention and treatment of osteoporosis in postmenopausal women.12 SERMs specifically behave in certain tissue not only as estrogen agonists but also as antiestrogens. In addition to the beneficial effect on bone, RLX has favorable effects on the cardiovascular system.13,14 Interestingly, it is also reported that RLX suppresses mesangial cell collagen synthesis in vitro,15 suggesting that RLX may be useful for the treatment of kidney diseases. Based on these observations, we performed the present study to clarify the separate effects of 17ß-estradiol and RLX on functional and histological alterations in the kidneys of db/db mice, a model of type 2 diabetes.
| Materials and Methods |
|---|
|
|
|---|
Female C57BLKsJ-db/db mice and their age-matched non-diabetic db/m littermates were purchased from Japan Clea (Tokyo, Japan). All animals were housed in box cages under standard conditions and had free access to water and standard chow. The Shiga University of Medical Science Animal Care Committee approved all experiments.
Experimental Protocol
In the first experiment, 10-week-old female db/db mice were randomly divided into the following three groups: sham-operated (Sham) (n = 10), ovariectomized (OVX) (n = 10), and OVX and estradiol treated (OVX+E) (n = 10). Bilateral ovariectomy or sham surgery via dorsal approach was performed, and estrogen or placebo treatment was started at 10 weeks of age. Sixty-day-release pellet (Innovative Research of America, Sarasota, FL), which releases 17ß-estradiol at the dose of 8.3 µg/day, was implanted in the OVX+E group. Placebo pellet was implanted in the Sham and OVX groups. All pellets were inserted subcutaneously via a small incision on the nape of the neck.
At 18 weeks of age, body weights and blood glucose levels were measured, and 24-hour urine samples were collected and stored frozen at 80°C until analysis. Blood pressure was measured with a tail cuff sphygmomanometer. Mice were deeply anesthetized by an intraperitoneal injection of 50 mg/kg pentobarbital sodium. After perfusion with ice-cold phosphate-buffered saline (0.1 mol/L, pH 7.4), the right kidney was fixed with 4% paraformaldehyde in phosphate-buffered saline. The kidneys were sectioned in a plane perpendicular to the long axis and were embedded in paraffin for morphometric and immunohistochemical analysis. Total RNA was extracted from the renal cortex of the left kidney. Urinary albumin excretion was measured with a mouse-specific sandwich enzyme-linked immunosorbent assay system (Albuwell; Exocell, Philadelphia, PA).
In the second experiment, 10-week-old female db/db mice were treated subcutaneously with either vehicle (sesame oil) or RLX (3 mg/kg/day) for 8 weeks (n = 10). Samples were collected and mice were sacrificed as described above.
Glucose Tolerance Test and Insulin Tolerance Test
Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs) were performed at the age of 14 weeks (n = 3). For GTTs, mice were fasted overnight for 14 hours followed by intraperitoneal glucose injection (1 g/kg body weight). Blood glucose was measured by using tail blood collected at 0, 15, 30, 60, and 120 minutes after the injection. For ITTs, mice were injected with human regular insulin (Novolin R; Novo Nordisk, Clayton, NC) at 0.75 U/kg of body weight intraperitoneally after a 6-hour fast, and blood glucose was measured at 0, 15, 30, and 60 minutes.
Morphological Investigations
For the morphometric analysis, sections were stained with periodic acid-Schiff (PAS) as previously described.16 From each animal of the experimental groups, 20 glomeruli cut at their vascular poles were used for the morphometric analysis. The extent of the mesangial matrix (defined as mesangial area) was determined by assessing the PAS-positive and nuclei-free area in the mesangium. The glomerular area was traced along the outline of the capillary loop using a computer-assisted color image analyzer (LUZEX F; Nikon, Tokyo, Japan).
Immunohistochemical staining was performed with fibronectin-specific polyclonal anti-mouse fibronectin antibody (A852/R5H; Biogenesis, Poole, United Kingdom). To evaluate the immunostaining for fibronectin, a total of 20 randomly chosen glomeruli per mouse were graded as follows: 0, staining absent to 5%; 1, 5 to 25%; 2, 25 to 50%; 3, 50 to 75%; and 4, >75%.17
Extraction of Total RNA and Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Real-time RT-PCR was used to quantify renal fibronectin transcript levels in experimental animals. Briefly, RNA was extracted with TRIzol (Invitrogen Co., Carlsbad, CA), and total RNA (4 µg) was reverse transcribed with Superscript II (Invitrogen). Real-time quantitative PCR was performed using fluorescence dye SYBR Green I (Roche Molecular Biochemicals, Mannheim, Germany) and LightCycler (Roche). The following PCR primers sets were designed: fibronectin forward, GCAAGCCAGTTTCCATCAAT, and fibronectin reverse, CATTTTTGGGAGTGGTGGTCA; and ß-actin forward, CTGAGAGGGAAA-TCGTGCGT, and ß-actin reverse, AGGGACTTCCTG-TAACCACT, for a two-step PCR protocol. In the first part, polymerase was activated for 10 minutes at 95°C. During the second part, the target region was amplified (45 cycles: 10 seconds, 95°C; 10 seconds, 55°C; and 5 seconds, 72°C). ß-actin was used as a house-keeping gene.
Cell Culture, Transfection, and Luciferase Assay
SV40-transformed murine mesangial cells (American Type Culture Collection, Rockville, MD) were grown in Dulbeccos modified Eagles medium containing 10% heat-inactivated fetal bovine serum and antibiotics. All experiments were performed in Dulbeccos modified Eagles medium containing 0.2% fatty-acid-free bovine serum albumin. Subconfluent mesangial cells on a six-well plate (Falcon, Franklin Lakes, NJ) were transfected with 0.8 µg of pGL2F1900 containing the 1908-bp 5' flanking region of the rat fibronectin gene fused to the luciferase reporter gene18 or the 3XAP-1 luciferase reporter construct (Stratagene, La Jolla, CA), using LipofectAMINE-2000 reagents (Gibco-BRL, Rockville, MD). The ß-galactosidase-containing pCMVß vector (Clontech, Palo Alto, CA) was used to control for transfection efficiency.
Twenty-four hours after transfection, the cells were preincubated for 1 hour in media containing RLX. The cells were then co-incubated with transforming growth factor-ß1 (TGF-ß1) (R&D System, Minneapolis, MN) for an additional 24 hours. The cells were harvested in 200 µl of a reporter lysis buffer (Promega, Madison, WI). Twenty-microliter aliquots of extracts were used to measure luciferase activity by Luciferase Assay System (Promega) and a luminometer (AutoLUMIcounter Nu1422ES; Nition, Tokyo, Japan). Luciferase activity was normalized to ß-galactosidase activity.
Statistical Analysis
Results are expressed as mean ± SE. Comparison among groups was performed by one-way analysis of variance, followed by Bonferronis test. P values of < 0.05 were defined as statistically significant.
| Results |
|---|
|
|
|---|
At the beginning of the study, there were no significant differences in body weight and blood glucose level among the Sham, OVX, and OVX+E groups (data not shown). In animals supplemented with 17ß-estradiol, the mean circulating concentration of 17ß-estradiol at the end of the experiment was 793.2 pmol/L. In the db/db mice in the Sham and OVX groups, the levels of 17ß-estradiol were 121.5 pmol/L and 125.8 pmol/L, respectively, whereas that in the db/m mice was 183.9 pmol/L.
As shown in Table 1
, body weight was increased in db/db mice as compared with non-diabetic, db/m mice at the age of 18 weeks. In the Sham and OVX groups, the weight gains at the end of the experiments were 37.4 and 29.7%, respectively, whereas in the OVX+E group, it was 12.5%. Blood glucose levels were significantly higher in the Sham (15.8 ± 0.97 mmol/L) and OVX (22.0 ± 1.95 mmol/L) groups than in the db/m mice (7.0 ± 0.23 mmol/L), whereas hyperglycemia was normalized in the OVX+E group (6.9 ± 0.39 mmol/L). Food intake was reduced in the OVX+E group (3.4 ± 0.13 g/day) compared with those in the Sham (4.4 ± 0.39 g/day) and OVX (5.5 ± 0.23 g/day) groups. To gain insights into the mechanism of action of 17ß-estradiol, we examined GTTs and ITTs. The area under the curve for blood glucose from 0 to 60 minutes after glucose administration was decreased in the OVX+E group (13,347.5 ± 1946.3 mg/dl/min) compared with the Sham (31,942.5 ± 1781.7 mg/dl/min) and OVX (27,862.5 ± 2471.1 mg/dl/min) groups (P < 0.01, Sham or OVX versus OVX+E). The decreases of blood glucose levels at 60 minutes after insulin challenge in the Sham, OVX, and OVX+E groups were 78.9 ± 1.7%, 78.5 ± 3.7%, and 24.1 ± 2.3% of the initial values, respectively (P < 0.01, Sham or OVX versus OVX+E). Kidney weight was greater in the db/db mice than in the db/m mice, and there were no significant differences among the Sham, OVX, and OVX+E groups. Mean blood pressure in db/db mice was elevated compared with that in db/m mice, and it was not affected by 17ß-estradiol treatment.
|
|
The mesangial areas in the Sham (562.7 ± 21.9 µm2) and OVX (546.9 ± 21.3 µm2) groups were larger than in the db/m mice (148.2 ± 19.6 µm2), but the mesangial expansion in db/db mice was significantly ameliorated by the 17ß-estradiol treatment (368.5 ± 16.8 µm2) (Figure 2)
. There was no significant change in glomerular surface area in the Sham, OVX, and OVX+E groups (data not shown). Immunohistochemical staining revealed an increase in fibronectin deposition in the glomeruli of mice in the Sham and OVX groups compared with that in the db/m mice, but the intense fibronectin staining was attenuated by 17ß-estradiol treatment (Figure 3, A and B)
. Renal expression of fibronectin mRNA in the OVX+E group was significantly decreased compared with the Sham or OVX group (Figure 3C)
.
|
|
We next examined whether RLX affects metabolic control and renal damage in db/db mice. There was no significant difference in body weight, blood glucose level, or kidney weight between the vehicle and RLX groups (Table 2)
. Food intake in the RLX group was similar to that in the vehicle control. Mean blood pressure measured at the age of 18 weeks was not affected by RLX treatment. Urinary albumin excretion was somewhat decreased in the RLX group (172.0 ± 36.8 µg/24 hours) compared with the vehicle control group (217.2 ± 45.5 µg/24 hours), but the difference was not significant.
|
PAS staining of the renal tissue revealed that the mesangial area was smaller in the RLX group (314.4 ± 20.5 µm2) than in the vehicle control group (476.2 ± 35.9 µm2) (Figure 4)
. Immunohistochemical staining of fibronectin in glomeruli also revealed less deposition in the former group (Figure 5, A and B)
. Renal expression of fibronectin mRNA in the RLX group was significantly decreased compared with the vehicle group (Figure 5C)
.
|
|
To explore the molecular mechanism by which RLX inhibits fibronectin expression, we examined fibronectin promoter activity in cultured mesangial cells. TGF-ß1 stimulated the activity in the mesangial cells. RLX significantly inhibited the TGF-ß1-induced fibronectin promoter activity in a dose-dependent manner (Figure 6A)
. In addition, RLX suppressed TGF-ß1-stimulated AP-1 activity in mesangial cells (Figure 6B)
, indicating that RLX inhibited fibronectin expression via an AP-1-dependent mechanism.
|
| Discussion |
|---|
|
|
|---|
In corroboration of our findings, several in vitro studies have confirmed an antifibrotic effect of estrogen in renal cells. 17ß-Estradiol inhibits the proliferation of mesangial cells, suppresses the synthesis of collagen types I and IV,7,20
and increases the production of matrix metalloproteinases-2 and -9.21,22
TGF-ß plays a key role in the development of diabetic nephropathy, especially by stimulating extracellular matrix proteins.23
Interestingly, crosstalk between TGF-ß and estrogen has recently been reported: 17ß-estradiol has been shown to reverse TGF-ß1-induced collagen type IV expression in mesangial cells,24
and moreover TGF-ß1-induced glomerulopathy is prevented by 17ß-estradiol in vivo.25
These findings demonstrate that estrogen may inhibit the expression of extracellular matrix by interfering with TGF-ß action. However, inhibition of the TGF-ß pathway may not be sufficient for preventing all renal abnormalities in diabetic nephropathy. Although the treatment with anti-TGF-ß antibody ameliorated renal insufficiency and glomerulosclerosis, it failed to reverse albuminuria in db/db mice.26
In contrast, in this study, we provide evidence that 17ß-estradiol does ameliorate albuminuria, in addition to its beneficial effects on histological alteration, in db/db mice. The discrepancy suggests potential mechanisms involving estrogen other than anti-TGF-ß action. Consistent with our findings, 17ß-estradiol has been shown to cause significant reductions in albuminuria as well as glomerulosclerosis and tubulointerstitial damage in uninephrectomized SHRsp rats. Kang et al27
recently examined macro- and microvascular changes in five of six remnant kidney models in both male and female rats and found that female rats showed less proteinuria and prominent vascular remodeling associated with increased expression of vascular endothelial growth factor. Furthermore, mice lacking estrogen receptor-
exhibit proteinuria and progression of glomerulonephritis, suggesting that estrogen exerts its essential role in maintaining a healthy renal vasculature through estrogen receptor-
.28
However, the effect of estrogen on diabetic nephropathy remains controversial. Rosenmann et al8 showed that the incidence of glomerulosclerosis was increased in ovariectomized Cohen diabetic rats treated with estrogen. Furthermore, estrogen has been shown to contribute to the development of glomerulosclerosis in Otsuka Long-Evans Tokushima Fatty rats.10 The discrepancy between these results and ours may be explained by variable susceptibilities to estrogen in the different experimental animal strains. In fact, it has been shown that the responsiveness to estrogen could be controlled by genetic traits related to those that determine the susceptibility to glomerular scarring.29,30
17ß-Estradiol suppressed hyperglycemia, obesity, and food consumption in db/db mice. Estrogen has been shown to suppress or delay the development of diabetes31 and to affect insulin sensitivity.32 We cannot exclude the possibility that normalization of metabolic conditions by 17ß-estradiol contributed to the amelioration of renal damage. We therefore examined the effect of RLX, one of the selective estrogen receptor modulators, to further clarify the effect of estrogen on renal damage, because it is known that RLX does not affect insulin sensitivity or glycemic control in postmenopausal women with type 2 diabetes.33 RLX prevented the progression of mesangial expansion and fibronectin accumulation in db/db mice without affecting hyperglycemia and obesity, but it failed to reduce urinary albumin excretion. Therefore, we conclude that RLX has a beneficial effect on diabetic kidney disease independent of glycemic control and that 17ß-estradiol may have additional actions through improving metabolic conditions.
Our in vitro results demonstrated that RLX suppressed TGFß1-induced fibronectin promoter activity as well as AP-1 activation in cultured mesangial cells. Because, as we previously reported, AP-1 is responsible for TGF-ß1-induced fibronectin expression in mesangial cells,34 these results suggest that RLX suppresses TGF-ß1-stimulated fibronectin expression possibly in part by inhibiting AP-1 activity. In contrast, it has been shown that RLX may stimulate AP-1 activity with estrogen receptors.35 Thus, further studies are necessary to elucidate the mechanism by which RLX inhibits TGF-ß1-induced fibronectin expression.
To our knowledge, this is the first study to demonstrate that RLX has a beneficial effect on the kidney in vivo. Because RLX does not have the harmful effects of estrogen, such as carcinogenesis in the breasts and uterus,36 but has presumably preserved beneficial effects on the vascular system, RLX may be more useful than estrogen as a clinical therapy for diabetic nephropathy.
| Footnotes |
|---|
Accepted for publication March 11, 2005.
| References |
|---|
|
|
|---|
ligands inhibit TGF-ß1-induced fibronectin expression in glomerular mesangial cells. Diabetes 2004, 53:200-208
and ERß at AP1 sites. Science 1997, 277:1508-1510This article has been cited by other articles:
![]() |
C. Maric Sex, diabetes and the kidney Am J Physiol Renal Physiol, April 1, 2009; 296(4): F680 - F688. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Davis, J. Mao, B. Naz, J. A Kohl, and C. S Rosenfeld Comparative effects of estradiol, methyl-piperidino-pyrazole, raloxifene, and ICI 182 780 on gene expression in the murine uterus J. Mol. Endocrinol., October 1, 2008; 41(4): 205 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Xu, C. C. Wells, J. H. Garman, L. Asico, C. S. Escano, and C. Maric Imbalance in Sex Hormone Levels Exacerbates Diabetic Renal Disease Hypertension, April 1, 2008; 51(4): 1218 - 1224. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dixon and C. Maric 17beta-Estradiol attenuates diabetic kidney disease by regulating extracellular matrix and transforming growth factor-beta protein expression and signaling Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1678 - F1690. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kume, T. Uzu, S.-i. Araki, T. Sugimoto, K. Isshiki, M. Chin-Kanasaki, M. Sakaguchi, N. Kubota, Y. Terauchi, T. Kadowaki, et al. Role of Altered Renal Lipid Metabolism in the Development of Renal Injury Induced by a High-Fat Diet J. Am. Soc. Nephrol., October 1, 2007; 18(10): 2715 - 2723. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Mankhey, C. C. Wells, F. Bhatti, and C. Maric 17beta-Estradiol supplementation reduces tubulointerstitial fibrosis by increasing MMP activity in the diabetic kidney Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2007; 292(2): R769 - R777. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Karl, M. Berho, J. Pignac-Kobinger, G. E. Striker, and S. J. Elliot Differential Effects of Continuous and Intermittent 17{beta}-Estradiol Replacement and Tamoxifen Therapy on the Prevention of Glomerulosclerosis: Modulation of the Mesangial Cell Phenotype in Vivo Am. J. Pathol., August 1, 2006; 169(2): 351 - 361. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kosugi, Y. Yuzawa, W. Sato, H. Kawai, S. Matsuo, Y. Takei, T. Muramatsu, and K. Kadomatsu Growth Factor Midkine Is Involved in the Pathogenesis of Diabetic Nephropathy Am. J. Pathol., January 1, 2006; 168(1): 9 - 19. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |