| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |





From Neuro-Oncology Research,* Barrow Neurological Institute, Phoenix; and The Translational Genomics Research Institute,
Phoenix, Arizona
| Abstract |
|---|
|
|
|---|
The oncogene R-Ras, a member of the superfamily of small GTPases and one of the signaling mediators of Eph receptor, has been implicated in several cell functions such as cell adhesion, proliferation, and migration.10 Originally, R-Ras was identified and cloned through its homology to the well-known oncogene H-Ras; 55% of the bp are identical between R-Ras and H-Ras.11 Although, previous studies have shown that malignant gliomas might exhibit activity of three major types of RAS proteins: N-Ras, H-Ras, and K-Ras,12 little information is available regarding the expression of R-Ras in brain tumors.
We recently demonstrated that EphB2 receptor induces glioma cell migration in vitro and is associated with invasive glioma cells in vivo.13 Elevated EphB2 expression has also been observed in carcinomas of the colon, stomach, esophagus, lung, breast,14-17 neuroblastoma,18 and melanoma,19 however, its role in pathogenesis, especially in the process of invasion or metastasis has not been described and little is known about the intracellular signaling pathways of EphB2 receptor in cancer.
In this study, we report signaling pathways of R-Ras downstream EphB2 receptor pertaining to adhesion, proliferation, and invasion. We demonstrate that EphB2 decreases cell-extracellular matrix (ECM) adhesion through R-Ras signaling and reduces cell proliferation by inhibition of the mitogen-activated protein kinase (MAPK) kinase (MEK)/MAPK pathway also through R-Ras signaling. Additionally, EphB2 activation increases cell invasion in ex vivo via R-Ras activity. These results suggest phosphorylated R-Ras downstream of EphB2 appears to play significant roles in the malignant behavior of glioma.
| Materials and Methods |
|---|
|
|
|---|
Human astrocytoma cell lines U87, U251, T98G (American Type Culture Collection, Manassas, VA), and SF76720 were maintained in Dulbeccos modified Eagles medium supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere containing 5% CO2. Astrocytoma-derived ECM was prepared as described previously.20
Antibodies and Reagents
Anti-phosphotyrosine, anti-R-Ras, anti-phospho-p44/42 MAPK, anti-total-p44/42 MAPK antibody, and MEK 1 inhibitor (PD98059)21
were purchased from Cell Signaling Technology (Beverly, MA). Anti-EphB2 polyclonal antibody and ephrin-B1/Fc chimera were purchased from R&D Systems (Minneapolis, MN). Anti-
-tubulin monoclonal antibody was obtained from Oncogene Research (Boston, MA). Control Fc fragments of mouse IgG were purchased from Sigma (St. Louis, MO).
Expression Plasmids and Cell Transfection
The expression plasmid for EphB2 and kinase-inactive EphB2 (EphB2KR; which contains a K662
R mutation in the ATP binding site) were constructed as described previously.13,22
EphB2 or kinase inactive EphB2 cDNA cloned into pEAK, which contains a puromycin-resistant gene, were stably transfected into U251 cells by the calcium phosphate method. Six different clones of U251 were selected for each EphB2 and EphB2KR vector in the presence of 1.5 µg/ml puromycin (Sigma) as described previously.23
Clones were screened for transgene expression by immunoblot analysis. All clones expressed EphB2 or EphB2KR at similar levels. For the various experiments, at least three clones of U251 from each transfection were examined. Stable transfectants of U251 were maintained in culture in the presence of puromycin and were checked periodically (approximately every 4 weeks) for constant expression of EphB2 or EphB2KR. Transient transfection was performed into T98G by Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as recommended by the manufacturers protocol. Cells transfected with the empty plasmid vector were used as controls.
Immunoprecipitation and Immunoblot Analysis
For immunoprecipitation, monolayers of cells or glioma tissue specimens were lysed on ice for 10 minutes in a buffer containing 10 mmol/L Tris-HCl, pH 7.4, 0.5% Nonidet P-40, 150 mmol/L NaCl, 1 mmol/L phenylmethyl sulfonyl fluoride, 1 mmol/L ethylenediamine tetraacetic acid, 2 mmol/L sodium vanadate, 10 µg/ml aprotinin, and 10 µg/ml leupeptin (Sigma) as previously described.24 Protein concentrations were determined using the bicinchoninic acid assay procedure (Pierce Chemical Co., Rockford, IL), with bovine serum albumin as a standard. Equivalent amounts of protein (200 µg) were precleared and immunoprecipitated from the lysates, washed with lysis buffer followed by S1 buffer (10 mmol/L HEPES, pH 7.4, 0.15 mol/L NaCl, 2 mmol/L ethylenediamine tetraacetic acid, 1.5% Triton X-100, 0.5% deoxycholate, 0.2% sodium dodecyl sulfate). Samples were then resuspended in 2x sodium dodecyl sulfate-sample buffer (0.25 mol/L Tris-HCl, pH 6.8, 2% sodium dodecyl sulfate, 25% glycerol) and denatured with 2-mercaptoethanol (Sigma), separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred to nitrocellulose (Invitrogen) by electroblotting. The nitrocellulose membrane was blocked with 5% bovine serum albumin in Tris-buffered saline, pH 8.0, with 0.1% Tween-20 before addition of primary antibody. Membranes were washed and then incubated with horseradish peroxidase-conjugated secondary antibody. Bound secondary antibodies were detected using a chemiluminescence system (NEN, Boston, MA).
Immunohistochemistry and Immunofluorescent Microscopy
Paraffin-embedded tissue blocks were sectioned (6 µm thick) onto slides and then deparaffinized. Sections were quenched with 3% hydrogen peroxide in methanol for 15 minutes, microwaved 5 minutes in H2O, and blocked for 1 hour with Tris-buffered saline (0.05 mol/L Tris-HCl, pH 7.6, 0.25 mol/L NaCl) containing 3% goat serum and 0.1% Triton X-100. Slides were incubated in rabbit anti-R-Ras antisera or rabbit preimmune sera (1:100 dilution) overnight at 4°C. The secondary antibody (biotin-conjugated goat anti-rabbit IgG; Jackson Laboratories, Bar Harbor, ME) was applied at a 1:500 dilution in Tris-buffered saline containing 1% goat serum, followed by streptavidin-conjugated horseradish peroxidase (1:500 dilution; Amersham Biosciences, Piscataway, NJ). Sections were exposed to diaminobenzidine peroxidase substrate (Sigma) for 5 minutes and counterstained with Mayers hematoxylin.
For immunofluorescence, cells were fixed in 4% paraformaldehyde for 30 minutes and permeabilized for 5 minutes in 0.1% TX-100 phosphate-buffered saline (PBS) buffer. After washing with PBS, cells were blocked with 2% bovine serum albumin and 3% goat serum and incubated with anti-EphB2 antiserum (1:100 dilution), or anti-R-Ras antiserum (1:100 dilution) for 1 hour at 25°C. Negative controls were stained with a 1:50 dilution of preimmunization goat sera. Cells were incubated for 30 minutes with 1:100 dilution of Cy3-conjugated anti-goat antibody or fluorescein isothiocyanate-conjugated anti-rabbit antibody (Boehringer Mannheim, Indianapolis, IN). Fluorescence was monitored by inverted confocal laser microscopy (Carl Zeiss, New York, NY).
Silencing of Endogenous R-Ras with Small Interfering RNA (siRNA)
Purified, duplexed siRNAs for R-Ras and for control luciferase were purchased from Qiagen (Valencia, CA). The siRNA sequence targeting human R-Ras (GenBank accession number NM_006270) was from position 811 to 831 (GTCTCCCAGGACACATCACAT). The sequence was designed to be unique when compared with the sequence of other Ras members. Twenty nm of siRNA was transfected into U87 cells cultured in 60-mm diameter dishes using Lipofectamine 2000. siRNA was also transfected into U251 stably transfected with control or EphB2 plasmids and co-transfected into T98G with control or EphB2 plasmids. Transfected cells were cultured for an additional 48 hours before use.
Cell Adhesion Assay
Cell adhesion assay was performed as described previously.25 Briefly, 96-well plastic plates were precoated with astrocytoma-derived ECM. Control dishes were prepared by blocking with bovine serum albumin alone. Cells were then plated at 1 x 104 cells/well and allowed to adhere to the dishes for 2 hours at 37°C before staining with 1% crystal violet. After the plate was washed with PBS, total crystal violet bound to the cells was eluted with 10% acetic acid and measured by absorbance at 590 nm (Spectrafluor Plus; TECAN, Durham, NC).
Cell Proliferation Assay
The Alamar Blue assay (Biosource, Camarillo, CA) was used to assess proliferation as described previously.26 Briefly, 1000 cells of each population were seeded in quadruplicate wells of 96-well plastic plates in 200 µl of culture medium supplemented with 10% fetal bovine serum. The plates were incubated for 4 hours at 37°C and Alamar Blue was added in a volume of 20 µl (10% of total volume) to the cells and incubated for 3 hours. The plate was read on a fluorescence plate reader (excitation, 530 nm; emission, 590 nm) at 24, 48, 72, and 96 hours. Averages of the absorbance values were calculated and plotted. To investigate the influence of R-Ras/MEK/MAPK pathway on cell proliferation, U87 cells transfected with or without R-Ras siRNA, U251 and T98G cells transfected with pEAK or EphB2 with or without R-Ras siRNA transfection were seeded in the proliferation assay format and allowed to adhere. The medium was then exchanged for serum-free medium containing 50 µmol/L PD98059 and cell number was evaluated daily for 4 days. Additionally, cells were separately harvested at 24, 48, 72, and 96 hours and counted. Doubling time (TD) was calculated by the following formula: TD = (t t0) log2/(logN logN0) (t, t0, time when cells were counted; N, N0, cell numbers at t, t0).
Ex Vivo Invasion Assay on Rat Brain Slices
The ex vivo invasion assay on rat brain slices was performed as described previously.13 Briefly, 400-µm-thick sections were prepared from Wistar rat [Crl:(WI)BR; Charles River Lab, Wilmington, MA] brain cerebrum. Approximately 1 x 105 glioma cells stably expressing green fluorescence protein (GFP) were gently placed (0.5-µl transfer volume) on the putamen of the brain slice. Typically, six brain slices were used in the each experiment. Imaging of specimens was performed at x10 magnification using a macro-fluorescent imaging system (SZX12-RFL3; Olympus, Tempe, AZ) equipped with a GFP barrier filter (DP50, Olympus) at 12 hours, and 60 hours after seeding the cells. Images were processed using Adobe Photoshop. Glioma cell invasion into the rat brain slices was quantitated using a LSM 5 Pascal laser-scanning confocal microscope (Zeiss, Thornwood, NY) to observe GFP-labeled cells on the tissue insert with the micropore filter membrane. Serial sections were obtained every 10 µm downward from the surface plane to the bottom of the slice. The invasion rate was calculated as described previously.13 In brief, for each focal plane, the area of fluorescent cells was calculated and plotted as a function of the distance from the top surface. The extent of glioma cell invasion was calculated as the depth corresponding to half of the maximum area. After the ex vivo invasion assay, invading and noninvading cells of U251 and T98G cells transfected with EphB2, as well as U87 cells, were manually collected under the fluorescent microscope (SZX12-RFL3), followed by immunoprecipitation studies as described above.
Clinical Samples and Histology
Under an institutional review board-approved protocol, fresh human brain tumor tissues were obtained from 26 patients who underwent therapeutic removal of astrocytic brain tumors. Nonneoplastic control brain tissues were identified from the margins of the tumors when possible. Histological diagnosis was made by standard light-microscopic evaluation of the sections stained with hematoxylin and eosin. The classification of human brain tumors used in this study is based on the revised World Health Organization criteria for tumors of the central nervous system.27 The 26 astrocytic tumors consisted of 7 low-grade astrocytomas, 8 anaplastic astrocytomas, and 11 glioblastomas. All of the tumor tissues were obtained at primary resection, and none of the patients had been subjected to chemotherapy or radiation therapy before resection.
Laser Capture Microdissection
Cryopreserved glioblastoma specimens from eight patients were cut in serial 6- to 8-µm sections and mounted on uncoated slides treated with diethyl pyrocarbonate. Approximately 3000 individual cells were collected for quantitative reverse transcription-polymerase chain reaction (QRT-PCR) analysis as described previously.28
Laser capture microdissection was performed with a PixCell II Microscope (Arcturus Engineering, Inc., Mountain View, CA). Neoplastic astrocytes in the invasive rim
1 cm from the edge of the tumor core were identified according to the criteria of nuclear atypia (coarse chromatin, nuclear pleomorphism, multinucleation) and, whenever possible, according to nuclear and/or cytoplasmic similarity with the glioblastoma cells in the core. Reactive astrocytes were identified by morphology and were avoided.
Real-Time QRT-PCR
QRT-PCR was performed in a LightCycler (Roche Diagnostics, Indianapolis, IN) with SYBR green fluorescence signal detection after each cycle of amplification as described previously.28 PCR was performed with the following primers: R-Ras (NM_006270): sense, 5'-CAAGGACCGCGACGACTTC-3'; anti-sense, 5'-CACTGGGAGGGCTCGGTGGG-3' (amplicon size, 227 bp); histone H3.3 (NM_002107): sense, 5'-CCACTGAACTTCTGATTCGC-3'; anti-sense, 5'-GCGTGCTAGCTGGATGTCTT-3' (amplicon size, 215 bp). The nucleotide number and amplicon size for each primer are presented in parentheses. The quantification of mRNA was performed at least three times for each sample and the PCR data were analyzed with the LightCycler analysis software as described previously.28
Statistics
Statistical analyses were performed using the
2
test, the two-tailed Mann-Whitney U-test, and two-way analysis of variance. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Since EphB2 has previously been shown to signal downstream through R-Ras,29
we investigated the levels of R-Ras phosphorylation in three glioma cell lines. Immunoblot analysis of total cellular lysates for R-Ras protein showed differential expression of R-Ras protein levels among the three glioma cell lines examined (Figure 1)
. U87 glioma cells displayed the highest levels of R-Ras protein. To determine the endogenous levels of R-Ras phosphorylation in glioma cells, we immunoblotted the R-Ras immunoprecipitates with a specific monoclonal antibody recognizing the phosphorylated tyrosine residues. Tyrosine-phosphorylated R-Ras was detected only in U87 cells, a glioma cell line previously shown to express high endogenous levels of EphB2 and faster intrinsic migratory rate among the three cell lines examined.13
|
To determine whether tyrosine phosphorylation of R-Ras is dependent on EphB2 activation in glioma cells, we examined levels of R-Ras phosphorylation in U251 cells stably expressing EphB2 wild-type receptor or a kinase-deficient EphB2 receptor (EphB2KR). U251 cells expressing EphB2 wild-type protein showed high R-Ras tyrosine phosphorylation as compared to control mock-transfected cells (Figure 2A)
. However, overexpression of EphB2KR failed to activate R-Ras phosphorylation, suggesting that EphB2 signals downstream for R-Ras phosphorylation in glioma cells. Expression of either EphB2 wild-type receptor or EphB2KR did not change endogenous levels of R-Ras protein (Figure 2A)
. Moreover, immunoprecipitation analysis of R-Ras revealed co-precipitation of EphB2 wild-type receptor but not EphB2KR. Co-precipitation of R-Ras after immunoprecipitation of EphB2 was also verified (Figure 2C)
. Similar results were observed in T98G cells transiently transfected with the EphB2 wild-type receptor or EphB2KR (Figure 2, B and D)
, indicating that biological signaling by EphB2 through R-Ras in glioma cells is not cell line-specific. These results suggest that the interaction of EphB2 with R-Ras is specific and depends on the kinase activity or phosphorylation status of the EphB2 receptor.
|
To further confirm the association of R-Ras and EphB2, we performed immunolocalization studies to determine the localization of R-Ras and EphB2 in U251 cells stably transfected with EphB2. Both EphB2 and R-Ras were detected on the cell surface (Figure 3)
. Co-localization of R-Ras with EphB2 was observed at the cell surface in the lamellipodial formation (Figure 3
, arrows). These results further suggest that EphB2 forms stable complexes with R-Ras and that this complex is localized to lamellipodial formation.
|
We recently demonstrated that human glioblastoma tissue specimens have highly phosphorylated EphB2, consistent with U87 glioma.13
To make U251 and T98 glioma cells more physiologically relevant, EphB2 expression vector was transfected and used for several functional assays. Previously, we showed that overexpression of EphB2 in glioma cells decreases cell-ECM adhesion.13
To determine whether R-Ras plays a functional role in EphB2-mediated glioma cell-ECM adhesion, we used siRNA to specifically silent endogenous R-Ras levels. The level of mRNA inhibition of R-Ras was
93% and did not affect the expression levels of other Ras family members including H-Ras, K-Ras, M-Ras, and N-Ras (data not shown). Inhibition of R-Ras protein expression by R-Ras-directed siRNA was also verified in three glioma cell lines by Western blot analysis using antibodies specific to R-Ras, whereas control luciferase siRNA had no effect on R-Ras protein level (Figure 4
; A to C). Forced expression of EphB2 in U251 and T98G cells resulted in decreased cell-ECM attachment (Figure 4, E and F)
. However, it was recovered in the presence of siRNA for R-Ras but not for control luciferase (Figure 4, E and F)
. In addition, depletion of R-Ras by siRNA also increased the cell-ECM adhesion of the endogenously high EphB2/R-Ras-expressing U87 cells (Figure 4, A and D)
. These results suggest that signals transduced by EphB2 via R-Ras reduce glioma cellular adhesion to the ECM.
|
To examine functional effects of EphB2 in cell growth, we assessed the changes in cell number throughout time in EphB2-expressing glioma cells by the Alamar Blue assay and cell counting. In preliminary studies, cells transfected with EphB2 do not display any cytotoxic effects as determined by changes in 4',6'-diamidino-2-phenylindole hydrochloride staining, propidium iodide uptake, and immunostaining with anti-activated caspase 3 antibodies (data not shown). As shown in Figure 5
, overexpression of EphB2 in U251 and T98G cells resulted in decreased cell growth as compared to mock transfectants (Figure 5, B and C)
. Decreased cell growth was further observed in EphB2-expressing U251 and T98G cells in the presence of ephrinB1/Fc ligand. Likewise, activation of endogenous EphB2 in U87 cells by ephrinB1/Fc ligand also significantly reduced cell proliferation (Figure 5A)
. No significant change in growth was observed between EphB2-expressing cells with or without treatment with control Fc (data not shown). These data support a specific role of EphB2 signaling that retards cell proliferation.
|
EphB2 Increases Invasion via R-Ras in ex Vivo Rat Brain Slice
To evaluate effects of R-Ras on glioma cell invasion through physiologically and anatomically relevant tissue, we determined whether RNA interference-mediated depletion of R-Ras inhibits the invasion of GFP-expressing human glioma cells into vital rat brain slices, a well-established organotypic model for glioma invasion that we have modified recently.13
U87 cells treated with siRNA for R-Ras or luciferase were implanted in the putamen on contralateral sides of the same rat brain slice; images were taken at 12 and 60 hours after implantation. U87 treated with siRNA for R-Ras displayed lesser migration and invasion into the organotypic rat brain slice as compared with the invasive cells treated with control luciferase siRNA (Figure 6A)
. Invasion was quantified by confocal microscopy, as detailed in Materials and Methods. Depletion of R-Ras in U87 causes a decrease in cell invasion (182.3 ± 27.8 µm/60 hours) compared with the cells treated with siRNA for control luciferase (254.7 ± 44.5 µm/60 hours, P < 0.05) (Figure 6B)
. We recently showed that EphB2 induced U251 cell invasion in the rat brain slice model.13
As shown in Figure 6C
, depletion of R-Ras cancelled the increase of invasion in U251 or T98G cells transfected with EphB2. These data suggest that R-Ras downstream of EphB2 plays a role in glioblastoma cell invasion.
|
To confirm the functional role of R-Ras in invading cells, we examined the phosphorylation level of R-Ras by manually isolating invading cells and tumor core cells from U87 cells and U251 and T98G cells transfected with EphB2 after their placement in the ex vivo brain slice invasion assay. Immunoprecipitation analysis of R-Ras in these two subcellular populations showed an increase in phosphorylated R-Ras (twofold to sixfold) in invading glioma cells as compared to the tumor core cells (Figure 7)
. These data further support the notion that phosphorylation of R-Ras plays a role in glioma cell invasion.
|
To assess a role for R-Ras in the malignant behavior of human gliomas, expression of R-Ras in human normal brain and astrocytic brain tumor tissues was examined by QRT-PCR using histone H3.3 mRNA as an internal quantitative reference. Levels of the R-Ras mRNA (R-Ras mRNA:histone H3.3 mRNA ratios) were significantly higher in glioblastoma samples (mean ± SD, 0.380 ± 0.27; n = 11) than those in anaplastic astrocytoma tissues (0.172 ± 0.123; P < 0.05; n = 8), low-grade astrocytoma tissues (0.126 ± 0.042; P < 0.01; n = 7) and normal brain tissues (0.108 ± 0.023; P < 0.05; n = 3; Figure 8A
). To evaluate a potential association of R-Ras expression in the context of glioma invasion in vivo, we collected invading glioblastoma cells and glioma cells in the tumor core by laser capture microdissection of eight glioblastoma surgical specimens, then performed QRT-PCR of the isolated RNA. R-Ras was overexpressed in invading glioblastoma cells (1.5- to 26-fold) relative to the cells in the tumor core in all eight biopsy specimens (Figure 8B)
.
|
Cells expressing R-Ras in sections of normal brains and glioblastoma specimens were identified using immunohistochemistry. R-Ras was immunolocalized mainly in the neoplastic astrocytes in all of the glioblastoma cases (five of five cases; Figure 9, A and B
). Invading neoplastic cells also contained significant staining for R-Ras (Figure 9, A and C)
. Neoplastic astrocytes were identified by nuclear atypia in hematoxylin and eosin-stained sections and were confirmed by immunopositivity for glial fibrillary acidic protein staining (data not shown). Endothelial cells of blood vessels in the glioblastoma tissues and reactive astrocytes were occasionally immunostained positively for R-Ras. No staining was observed in the normal brains (Figure 9E)
or when preimmune serum was substituted for primary antibody (Figure 9D)
. These results are consistent with that of QRT-PCR findings.
|
By immunoprecipitation and Western blot, tyrosine-phosphorylated EphB2 and R-Ras were identified in tissue homogenates of glioblastoma samples (Figure 10A)
. Consistent with the QRT-PCR results, protein levels of R-Ras were increased in glioblastoma tissue relative to normal brain, low-grade astrocytoma, and anaplastic astrocytoma (Figure 10A)
. Immunoprecipitation of the normal brain or low-grade astrocytoma samples did not detect tyrosine-phosphorylated EphB2 and R-Ras. Phosphorylation ratios of R-Ras plotted against phosphorylation ratios of EphB2 in each glioblastoma case (n = 11) showed a direct correlation (r = 0.694, P < 0.05) (Figure 10B)
.
|
| Discussion |
|---|
|
|
|---|
In vivo examination of R-Ras in glioma biopsy specimens showed that the levels of R-Ras mRNA, protein, and tyrosine-phosphorylated form of the protein are significantly higher in glioblastoma tissue than normal brain, low-grade astrocytoma, or anaplastic astrocytoma. The increase in R-Ras mRNA and protein in tumor tissue is ascribed to astrocytic tumor cells because R-Ras immunolocalized predominantly to glioma cells. Based on the observation that invading cells in vivo overexpressed R-Ras, and that R-Ras protein was detected by immunohistochemistry in invading glioblastoma cells, it seems likely that the production level of R-Ras is up-regulated in the invading tumor cells. Confirmation of R-Ras phosphorylation in actively invading glioma cells in ex vivo rat brain slices, concomitant with our recent data showing overexpression and phosphorylation of EphB2 in invading glioblastoma cells,13 further support the biological role of R-Ras in glioma invasion. Thus, our results suggest that the EphB2/R-Ras signaling pathway may contribute to the malignant behavior of glioblastoma and may drive invasion of glioma cells into normal brain tissue.
Decreased adhesion is thought to promote tumor cell invasion.30 Our study shows that EphB2 signaling leads to phosphorylation of R-Ras and reduced cell-ECM adhesion, which are both recovered by R-Ras knockdown; this suggests that R-Ras is involved in the decrease of adhesion downstream of EphB2. Additionally, PD98059 did not affect cell adhesion by EphB2-expressing cells co-transfected with the R-Ras siRNA (data not shown), signifying that the MEK/MAPK pathway is not involved in cell-ECM adhesion. Similar results were obtained using 293T cells transiently transfected with EphB2, indicating EphB2 inhibits cell adhesion through tyrosine phosphorylation in the effector domain of R-Ras, which suppresses the ability of R-Ras to support integrin activity.29,31 R-Ras reportedly influences integrin activation by both direct mechanisms30 and indirect mechanisms.32 Our results contrast with a previous report that R-Ras promotes formation of focal adhesion through the phosphorylation of focal adhesion kinase (FAK) in HeLa cells or breast epithelial cells.33,34 Such a discrepancy could be cell type-dependent because blocking of R-Ras in U251 or T98G transfected with EphB2 did not affect the phosphorylation level of FAK (data not shown). Based on our results, we speculate that R-Ras plays a central role in the downstream signaling of EphB2 by modulating inside-out integrin signaling that mediates cell-ECM adhesion in invading glioma cells.
Collective evidence shows that the MEK/MAPK pathway plays an important role in regulating mitogenesis and is involved specifically in the proliferative behavior of glial tumors.35 We demonstrated that EphB2 signaling decreased cell growth coincident to dephosphorylation of MAPK. Decreased MAPK phosphorylation could be prevented by knockdown of R-Ras, suggesting EphB2/R-Ras signaling leads to retarded proliferative activity through inhibition of MEK/MAPK. Our results are consistent with previous findings that EphB2 receptors negatively regulate MAPK, resulting in a reduction of mitogenic signals in neuronal cells,36 and unlike other Ras proteins, R-Ras does not activate the MEK/MAPK pathway.37,38 Our previous studies showed that invasive cells show a lower proliferation rate compared with the dense core of glioblastoma both in vitro and in vivo.39
Overexpression of EphB2 increased invasion as previously shown with an ex vivo organotypic rat brain slice model.13 The present study shows that the increased invasion induced by EphB2 signaling is reversed by R-Ras knockdown. This suggests that R-Ras is involved in the increase of invasion downstream of EphB2. Similarly, R-Ras signals have been shown to promote invasion in breast epithelial cells40 and in a cervical carcinoma cell line.37 Separately, we found that the phosphatidylinositol 3-kinase/Akt pathway, which is an additional important signal transduction pathway in glioblastoma, participates in events leading to high migratory activity after EphB2 activation in an in vitro migration assay, independent of the involvement of R-Ras (data not shown). That may be a reason why knockout of R-Ras does not completely eliminate the effect of increased invasion by EphB2 in U251 and T98G cells. Taken together, R-Ras seems to be a key molecule in signaling networks that coordinately regulate cell-ECM adhesion, cell proliferation, and invasion downstream of EphB2.
We have recently reported overexpression and elevated phosphorylation of EphB2 receptor in invading glioma cells.13 Here we provide evidence that effects of R-Ras downstream of the EphB2 receptor are consistent with that of invading glioma cells. Because most conventional chemotherapeutic agents function to inhibit cell proliferation, it is possible that invading glioma cells are more chemoresistant due to the fact that EphB2/R-Ras signaling decreases cell proliferation by inhibition of the MEK/MAPK pathway. In addition, our previous data showed that invading glioma cells are resistant to cytotoxic therapy,41 which may be enhanced by EphB2/R-Ras signaling. Thus, the EphB2 receptor seems to trigger signaling networks that regulate invasion of glioma. Future work aimed at studying the complexity of the multicompartment Eph/ephrin signaling network may contribute to a better understanding of tumor progression mechanisms as they relate to the invasion and survival of glioblastoma multiforme.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by the National Institutes of Health (grant NS042262 to M.E.B.) and the American Brain Tumor Association (basic research fellowship award to M.N.).
Accepted for publication March 22, 2005.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Truitt, T. Freywald, J. DeCoteau, N. Sharfe, and A. Freywald The EphB6 Receptor Cooperates with c-Cbl to Regulate the Behavior of Breast Cancer Cells Cancer Res., February 1, 2010; 70(3): 1141 - 1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, S. R. Kumar, P. Zhou, V. Krasnoperov, S. J. Ryan, P. S. Gill, and D. R. Hinton Soluble EphB4 Inhibition of PDGF-Induced RPE Migration In Vitro Invest. Ophthalmol. Vis. Sci., January 1, 2010; 51(1): 543 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Annamalai, X. Liu, U. Gopal, and J. S. Isaacs Hsp90 Is an Essential Regulator of EphA2 Receptor Stability and Signaling: Implications for Cancer Cell Migration and Metastasis Mol. Cancer Res., July 1, 2009; 7(7): 1021 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wykosky and W. Debinski The EphA2 Receptor and EphrinA1 Ligand in Solid Tumors: Function and Therapeutic Targeting Mol. Cancer Res., December 1, 2008; 6(12): 1795 - 1806. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fukai, H. Yokote, R. Yamanaka, T. Arao, K. Nishio, and T. Itakura EphA4 promotes cell proliferation and migration through a novel EphA4-FGFR1 signaling pathway in the human glioma U251 cell line Mol. Cancer Ther., September 1, 2008; 7(9): 2768 - 2778. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lackmann and A. W. Boyd Eph, a Protein Family Coming of Age: More Confusion, Insight, or Complexity? Sci. Signal., April 15, 2008; 1(15): re2 - re2. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Chrencik, A. Brooun, M. I. Recht, G. Nicola, L. K. Davis, R. Abagyan, H. Widmer, E. B. Pasquale, and P. Kuhn Three-dimensional Structure of the EphB2 Receptor in Complex with an Antagonistic Peptide Reveals a Novel Mode of Inhibition J. Biol. Chem., December 14, 2007; 282(50): 36505 - 36513. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Hjelmeland, K. P. Lattimore, B. E. Fee, Q. Shi, S. Wickman, S. T. Keir, M. D. Hjelmeland, D. Batt, D. D. Bigner, H. S. Friedman, et al. The combination of novel low molecular weight inhibitors of RAF (LBT613) and target of rapamycin (RAD001) decreases glioma proliferation and invasion Mol. Cancer Ther., September 1, 2007; 6(9): 2449 - 2457. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Xia, L. W. Forman, and D. V. Faller Protein Kinase C{delta} Is Required for Survival of Cells Expressing Activated p21RAS J. Biol. Chem., May 4, 2007; 282(18): 13199 - 13210. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Noren and E. B. Pasquale Paradoxes of the EphB4 Receptor in Cancer Cancer Res., May 1, 2007; 67(9): 3994 - 3997. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takaya, T. Kamio, M. Masuda, N. Mochizuki, H. Sawa, M. Sato, K. Nagashima, A. Mizutani, A. Matsuno, E. Kiyokawa, et al. R-Ras Regulates Exocytosis by Rgl2/Rlf-mediated Activation of RalA on Endosomes Mol. Biol. Cell, May 1, 2007; 18(5): 1850 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Demuth, L. B. Reavie, J. L. Rennert, M. Nakada, S. Nakada, D. B. Hoelzinger, C. E. Beaudry, A. N. Henrichs, E. M. Anderson, and M. E. Berens MAP-ing glioma invasion: Mitogen-activated protein kinase kinase 3 and p38 drive glioma invasion and progression and predict patient survival Mol. Cancer Ther., April 1, 2007; 6(4): 1212 - 1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, J. Shen, T. Wu, Y. Wei, X. Chen, H. Zong, S. Zhang, M. Sun, J. Xie, X. Kong, et al. Down-regulation of {beta}1,4-galactosyltransferase V is a critical part of etoposide-induced apoptotic process and could be mediated by decreasing Sp1 levels in human glioma cells Glycobiology, November 1, 2006; 16(11): 1045 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakada, K. L. Drake, S. Nakada, J. A. Niska, and M. E. Berens Ephrin-B3 Ligand Promotes Glioma Invasion through Activation of Rac1. Cancer Res., September 1, 2006; 66(17): 8492 - 8500. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jiang, X. Chen, J. Shen, Y. Wei, T. Wu, Y. Yang, H. Wang, H. Zong, J. Yang, S. Zhang, et al. beta1,4-Galactosyltransferase V Functions as a Positive Growth Regulator in Glioma J. Biol. Chem., April 7, 2006; 281(14): 9482 - 9489. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |