This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bonder, C. S. Articles by Kubes, P. Search for Related Content PubMed PubMed Citation Articles by Bonder, C. S. Articles by Kubes, P.

(American Journal of Pathology. 2005;167:1647-1660.)
© 2005 American Society for Investigative Pathology

P-Selectin Can Support Both Th1 and Th2 Lymphocyte Rolling in the Intestinal Microvasculature

Claudine S. Bonder^*, M. Ursula Norman^*, Tara MacRae^*, Paul R. Mangan, Casey T. Weaver, Daniel C. Bullard, Donna-Marie McCafferty^¶ and Paul Kubes^*

From the Immunology^* and Gastrointestinal Research^¶ Groups, Department of Physiology and Biophysics, Faculty of Medicine, University of Calgary, Alberta, Canada; the Hanson Institute, Institute of Medical and Veterinary Science, Adelaide, Australia; and the Departments of Genomics and Pathobiology and Pathology, University of Alabama at Birmingham, Birmingham, Alabama

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Lymphocyte localization to inflammatory sites is paramount for developing and maintaining an immune response. Rolling is the first step in recruitment, but our knowledge of its mechanisms in Th1 and Th2 CD4⁺ lymphocytes is incomplete. Whereas initial studies suggested that Th1 but not Th2 lymphocytes used P-selectin for recruitment, more recent studies have proposed that both subtypes bind selectins. We used intravital microscopy to demonstrate in vivo that polarized Th1 and Th2 lymphocytes both use P-selectin to roll and adhere to cytokine [tumor necrosis factor (TNF)- or interleukin (IL)-4]-activated intestinal microvasculature. The majority of Th1 lymphocyte flux in TNF-- and IL-4-treated animals was P-selectin-dependent. Th1 lymphocytes also interacted with E-selectin to control rolling velocity after TNF- stimulation. Th2 lymphocytes, which make IL-4 but not interferon-, bound P-selectin ex vivo, with more than 95% rolling on P-selectin in vivo. Both Th1 and Th2 lymphocytes regulated rolling velocity by interacting with ₄-integrin. Furthermore, in a model of spontaneous intestinal inflammation (ie, IL-10-deficient mice), both Th1 and Th2 lymphocytes rolled, adhered, and ultimately emigrated into the local microenvironment. These results suggest that both Th1 and Th2 lymphocytes use P-selectin in the initial rolling step in vivo in response to a global activator of the vasculature (TNF), a subtle inducer of P-selectin (IL-4), and pathological inflammation (IL-10-deficient mice).

The current paradigm of general leukocyte recruitment suggests that cells are recruited via a series of interdependent and closely regulated adhesive interactions between the circulating leukocytes and the vascular endothelium. Circulating leukocytes first tether to and roll along the endothelium via selectins (eg, P-selectin and E-selectin).^7,8 Although more recently, a number of additional molecules including ₄-integrin, CD44, and VAP-1 have also been demonstrated to induce rolling. If appropriate signals (chemokines) are encountered, leukocytes then firmly adhere to the vessel wall via integrins before transmigrating into the surrounding tissue.^9-11 Clearly, the initial tethering and rolling events will regulate which cell type is recruited to the endothelial interface to encounter chemokines. Alternatively, if all leukocytes bind selectins then their selection into tissues may be regulated further downstream, presumably by chemokines. It is also possible that there is no real selection process at any of these levels and both cell types enter the tissue.

The importance of selectins for the initial tethering and rolling for Th1 and Th2 lymphocytes in vivo remains somewhat controversial because our knowledge of the process is not complete. For example, initial in vitro studies suggested that Th1 but not Th2 lymphocytes used P-selectin for recruitment. For example, Austrup and colleagues, and others^12-15 have reported that Th1-polarized cells infiltrate skin and joints via P-selectin. By contrast, Th2-polarized cells lacked adequate expression of P-selectin ligand/s and must therefore use some other molecule(s) to infiltrate sites of inflammation.¹³ More recently however, isolation from lymphoid tissues of already polarized T cells revealed that Th1 and Th2 lymphocytes expressed similar levels of P-selectin ligands as assessed by flow cytometric binding of P-selectin IgM fusion protein.^16,17 However, a demonstration that the Th2 cells actually used P-selectin was not shown. The limitation seems to be related to the fact that in vitro, Th2 cells do not express P-selectin whereas in vivo simply adding P-selectin antibody to an animal does not necessarily reveal what cell-type is the target of P-selectin inhibition. What is needed is an ability to produce P-selectin-expressing Th2 cells in vitro to assess the importance of P-selectin-dependent recruitment in vivo.

In this study we have successfully polarized CD4⁺ T cells toward either cells that produced IFN- and not IL-4 (Th1) or cells that produced IL-4 but not IFN- (Th2) but have the ability to bind P-selectin. We then used intravital microscopy to investigate two key issues in Th1/Th2 trafficking in the microvasculature. Firstly, we examined whether the number of Th1 and Th2 lymphocyte-endothelial interactions differ in intestinal microvasculature in response to a potent global stimulus such as TNF- that induces P-selectin, E-selectin, and other adhesion molecules or a more subtle stimulus IL-4 known to primarily induce P-selectin but not E-selectin. To stimulate the intestinal vasculature the cytokines had to be administered intravascularly which induces rolling, adhesion, but not emigration. Therefore, in a second series of experiments, we determined what mechanisms were used by Th1 and Th2 lymphocytes to roll in the vasculature of a well-described mouse model of irritable bowel disease (IBD), the IL-10-deficient mouse, and whether both cell types would actually emigrate into the tissues.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Reagents and Mice

RB40.34 (anti-P-selectin), R1–2 (anti-₄-integrin), GAME-46 (anti-ß₂-integrin), 11B11 (anti-IL-4), XMG1.2 (anti-IFN-), JES5–16E3 (anti-IL-10), and isotype control antibodies were purchased from BD Biosciences (Mississauga, Canada). RME-1 (anti-E-selectin) was a kind gift from Dr. A. Issekutz (Halifax, Canada). TNF- and IL-4 were purchased from R&D Systems (Minneapolis, MN). BALB/c (Charles River Laboratories, Montreal, Canada), DO11.10 (gift from Dr. C. Weaver, Birmingham, AL), 129svev and IL-10-deficient mice (bred in house) were maintained in the viral antigen-free double-barrier unit at the University of Calgary. BALB/c and DO11.10 mice were used once they weighed between 20 and 25 g and were between 6 to 10 weeks of age, and the 129svev and IL-10-deficient mice were used between 10 to 13 weeks of age. All experimental procedures were approved by the Animal Care Committee of the University of Calgary and conform to the guidelines established by the Canadian Council for Animal Care.

Lymphocyte Purification and Characterization of OVA-Specific Th1 and Th2 Cells

CD4⁺ T cells were isolated from pooled spleens of DO11.10 mice using mouse CD4 (L3T4) Dynabeads per the manufacturer’s protocol (Dynal Biotech Inc., Brown Deer, WI). The resulting CD4⁺-enriched cells were stained with fluorescein isothiocyanate-conjugated KJ1-26 (anti-DO11.10 TCR)¹⁸ and phycoerythrin (PE)-conjugated anti-CD4 and analyzed by flow cytometry to determine purity of the population. Total events (n = 10,000) were acquired on a Becton Dickinson FACScan (Mountain View, CA), gating on cells with forward and side scatter properties of lymphocytes, and were analyzed using CELLQuest software. Isolations routinely resulted in greater than 90% purity of CD4⁺ cells.

Th1 and Th2 cells were generated in vitro from antigen-naive CD4⁺ T cells as described previously.¹⁹ Briefly, purified CD4⁺ T cells were cultured at a ratio of 1:5 (for Th1) and 1:25 (for Th2) with irradiated BALB/c splenocytes and 5 µg/ml OVA peptide 323-339. The addition of 50 U/ml of IL-12 (R&D Systems) and 10 µg/ml of anti-IL-4 (11B11)²⁰ was used to generate Th1 cells, whereas 1000 U/ml of IL-4 (R&D Systems) and 10 µg/ml of anti-IL-12 (C17.8)²¹ were used to generate Th2 cells.²² To ensure that the majority of ex vivo polarized cells were of a Th2 phenotype that bound P-selectin, the cells went through a second 7-day period of culture, as above. Recovered cells were washed and transferred on day 7 (for Th1) and day 14 (for Th2) at 10⁷ cells/recipient mouse. Although initially, we also compared Th1 cells after two cycles of cytokines and Th2 cells after a single cycle of cytokines and observed similar trends to those described in the results, ultimately we settled on the above-described protocol as it generated the best polarized P-selectin-expressing Th1 and Th2 cells (see companion paper by Mangan and colleagues²³ in this issue). A separate aliquot of 5 x 10⁶ cells was restimulated for 6 hours with phorbol 12-myristate 13-acetate (PMA) (50 ng/ml; Sigma Chemical Co., St. Louis, MO) and ionomycin (750 ng/ml; Sigma Chemical Co.) for analysis of cytokine expression. Intracellular cytokine staining was used to assess cytokine expression with the Cytofix/Cytoperm Plus with GolgiPlug Kit (BD BioSciences) following the manufacturer’s instructions. Permeabilized cells were incubated with PE-conjugated anti-IL-4 (11B11, BD BioSciences), anti-IL-10 (JES5-16E3, BD BioSciences), or anti-IFN- (XMG1.2, BD BioSciences) and analyzed with a BD Biosciences FACScan. Unstimulated cells and a PE-labeled control monoclonal antibody (mAb) of the same isotype were used as controls in all experiments.

Functional P-selectin and E-selectin ligand expression was determined by P- and E-selectin binding using a murine P- or E-selectin/human IgM chimeric Ab (a gift from J. Lowe, University of Michigan, Ann Arbor, MI), followed by staining with biotin-goat anti-human IgM (1:100 dilution, Sigma Chemical Co.) and streptavidin-PE (1:50 dilution, BD Biosciences). Parallel staining with selectin-Ig in the presence of ethylenediamine tetraacetic acid served as controls.

For real-time polymerase chain reaction (PCR) quantitation of FucTIV and FucTVII cDNA, primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA), and had the following sequences: FucTIV: forward primer GCTGGTACTACGCGTGTTCGA, reverse primer CTACGGTCTCCA-GGGCTTTG, and TaqMan probe ACCAGGAGGGAG-CAGTGACGCTAACTG (5'FAM, 3'TAMRA); FucTVII: forward primer TGAACCTACAGTTCAAGGGTACCA, reverse primer AAACCAAATTACCATGAATGTTGCT, and TaqMan probe CACCAGGAGGCTGCGGGCC (5'FAM, 3'TAMRA). All oligos were synthesized by Sigma Genosys, probes were purified by high performance liquid chromatography.

RNA Extraction and cDNA Synthesis

Total RNA was extracted from 1 x 10⁷ stimulated T cells using the RNeasy mini kit with on-column DNase digestion (Qiagen, Valencia, CA). RNA was quantified by absorption at 260 nm with a Biomate 3 spectrophotometer (ThermoSpectronic, Burlington, ON, Canada). Total RNA (1.5 µg) was reverse transcribed using the Re-vertAid H minus first strand cDNA synthesis kit (Fer-mantas, Burlington, ON, Canada) as detailed in the manufacturer’s guidelines.

TaqMan Real-Time PCR Assay

Real-time PCR was performed on the ABI Prism 7000 sequence detection system (Applied Biosystems). TaqMan PCR was performed in a total volume of 25 µl containing 1x TaqMan Universal Master Mix (Applied Biosystems), 900 nmol/L each primer, 100 nmol/L probe, and 75 ng cDNA. Default thermocycler conditions were used: stage 1, 50°C for 2 minutes for one cycle; stage 2, 95°C for 10 minutes for one cycle; and stage 3, 95°C for 15 seconds and 60°C for 1 minute for 40 cycles. Each PCR was performed in duplicate, and each sample was analyzed in parallel for FucTIV, FucTVII, as well as GAPDH to normalize for inefficiencies in cDNA synthesis and RNA input amounts. Controls were included for all PCRs to exclude PCR amplification of contaminating genomic DNA and to ensure that amplification was not due to contamination of other components within the PCR mix. Gene expression assays were validated by analysis of a standard curve to demonstrate that PCR efficiency was within 10% for all primer-probe sets. Gene expression data were subsequently calculated by the delta Ct method using the following formula: dCT = Ct target gene – Ct housekeeping gene, where Ct is the cycle number at which PCR amplification crosses threshold.

Quantification of P-Selectin Expression

Expression of P-selectin was determined as a measure of endothelial activation using a modified dual-radiolabeled Ab technique.^24,25 The Abs RB40.34 (against P-selectin) and A110-1 (a rat IgG₁, isotype control) were labeled with either ¹²⁵I (RB40.34) or ¹³¹I (A110-1) using the Iodogen method as previously described.^24,25 A110-1 was used to control for nonspecific binding in the murine system.

To determine quantitative P-selectin expression, animals were injected intravenously with a mixture of 10 µg of ¹²⁵I-RB40.34, and a variable dose of ¹³¹I-A110-1 calculated to achieve a total injected ¹³¹I activity of 400,000 to 600,000 cpm (total volume, 200 µl). The Abs were allowed to circulate for 5 minutes, then the animals were treated with heparin. A blood sample was obtained from the carotid artery catheter, and the mice were exsanguinated. The lungs, heart, liver, mesentery, small intestine, large intestine, muscle, skin, and stomach were harvested and weighed. ¹³¹I and ¹²⁵I were measured in plasma and tissue samples. P-selectin expression was calculated per g of tissue, by subtracting the accumulated activity of the nonspecific Ab (¹³¹I-A110-1) from the accumulated activity of the P-selectin Ab (¹²⁵I-RB40.34). P-selectin data were represented as the percentage of the injected dose of Ab per g of tissue. It has been previously demonstrated that this approach provides reliable quantitative values of adhesion molecule expression, and that radiolabeled binding Ab can be displaced specifically with sufficient amounts of unlabeled Ab. The technique is sufficiently sensitive that basal levels of P-selectin can be detected in wild-type mice relative to P-selectin-deficient mice.^24-26

Intravital Microscopy in the Intestine

Mice were prepared for surgery using isofluorane as an inhalation anesthetic as previously described.²⁷ For intravital microscopy briefly, the jugular vein was cannulated for the administration of fluorescently labeled cells and antibodies. A segment of the small intestine is exteriorized through an abdominal incision and draped over a viewing pedestal and the exposed tissue is suffused with bicarbonate-buffered saline (pH 7.4, temperature 37°C) to avoid temperature changes and drying out. Mice are allowed to stabilize for 15 minutes after surgery. The intestinal microcirculation is visualized by autofluorescence before experiments for identification of postcapillary venules. Endogenous leukocytes were visualized by intravenous injection of rhodamine 6G. In a separate series of experiments prelabeled subsets of T lymphocytes were injected into the jugular vein and their rolling and adhesion were visualized in the intestine. Lymphocytes were labeled with rhodamine 6G (25 µg/10⁷ cells, Sigma Chemical Co.) for 5 minutes at room temperature before extensive washing and intravenous injection. This permits visualization of lymphocytes in the vascular bed but does not affect leukocyte-endothelial cell interactions in a nonspecific way. Rhodamine 6G-associated fluorescence is visualized by epi-illumination at 510 to 560 nm, using a 590-nm emission filter. A microscope (Optiphot-2; Nikon Inc., Mississauga, Canada) with x25 lens (water immersion, Leitz Wetzlar L25/0.35) and a x10 eyepiece was used. A silicon-intensified fluorescence camera (model C-2400-08; Hamamatsu Photonics, Hamamatsu City, Japan) mounted on the microscope projects the image onto a monitor. The image was recorded using a video camera (Panasonic-Digital 5100) and a video recorder (Panasonic NV8950) as previously described by our laboratory.^26,28 The microcirculation of the lamina propria can be assessed from the serosal side in the closed part of the intestine by changing the depth of focus of the microscope.²⁹

Five randomly selected postcapillary venules with a diameter between 20 and 30 µm were observed throughout the 30- to 45-minute time span during each experiment to obtain a true representation of an overall response. All experiments were recorded for later analysis and scored in a blinded manner. Rolling leukocytes were defined as those cells moving at a velocity less than that of erythrocytes within a given vessel. Leukocytes were considered adherent if they remained stationary for 30 seconds or longer.

Experimental Protocol

TNF- (25 µg/kg) or IL-4 (100 ng/mouse) was administered intraperitoneally to BALB/c mice before analysis.^25,30 This is a model we have used previously to determine the molecular mechanisms underlying rolling of leukocytes on endothelium in vivo in any organ microcirculation. It should however be noted that no leukocyte emigration takes place and no pathology occurs. Antibodies to the following adhesion molecules P-selectin (20 µg), E-selectin (100 µg), ₄-integrin (70 µg), or ß₂-integrin (30 µg) in a final volume of 200 µl of sterile saline were administered intravenously. Preliminary experiments and previous studies have shown that 5 minutes is required for optimal inhibition of rolling by P- and E-selectin, 20 minutes is required for optimal inhibition of rolling by ₄- and ß₂-integrin, and that isotype-matched Ab has no effect on leukocyte recruitment.^8,31 For experiments requiring pretreatment, antibodies were administered at the same concentrations and pretreatment times as described above.

Isolation of Intestine-Infiltrating Lymphocytes

The isolation of intestine-infiltrating lymphocytes was modified from that previously described.³² Briefly, IL-10-deficient mice were anesthetized and injected intravenously with 5 x 10⁷ carboxy-fluorescein succinmidylester (CFSE)-labeled (5 µmol/L for 10 minutes at room temperature; Molecular Probes, Invitrogen Canada Inc., Burlington, Canada) Th1 or Th2 cells. After 24 hours the mice were again anesthetized and perfused via the left ventricle after clipping the right atrium. The perfused small and large bowel were obtained from the mice and minced in digestive medium containing 0.05% collagenase and 0.002% DNase I. After gentle agitation at 37°C for 60 minutes, the digest was passed through a 40-µm nylon mesh and then washed twice with phosphate-buffered saline (PBS). Cells were then subjected to density gradient centrifugation on Lympholyte-M (Cedarlane Laboratories, Hornby, Canada) to isolate the lymphocyte population. Intestinal lymphocytes were resuspended in PBS, and viability was determined by trypan blue exclusion. CD4⁺ T cells were isolated from the intestines using mouse CD4 (L3T4) Dynabeads per the manufacturer’s protocol (Dynal Biotech). The resulting CD4⁺-enriched cells were analyzed by flow cytometry to determine CFSE-T-cell infiltration into the intestinal interstitium. No less than 25,000 total events were acquired on a Becton Dickinson FACScan, gating on cells with forward and side scatter properties of lymphocytes, and were analyzed using CELLQuest software.

Statistical Analysis

All results are expressed as mean ± SE (SEM). An unpaired Student’s t-test was used for comparisons between 2 means with a Welch’s correction where necessary, and analysis of variance followed by Newman-Keul posthoc test was used for comparisons between more than 2 means. Statistical significance was set at P < 0.05.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Characterization of Th1 and Th2 Lymphocytes

To confirm the polarization of the CD4⁺ splenocytes into Th1 and Th2 lymphocytes we assessed their production of cytokines after ionomycin and PMA stimulation. By intracellular cytokine staining we observed that 75 ± 6% of the activated Th1 lymphocytes produced the Th1 cytokine IFN- and less than 1% of these cells produced the Th2 (IL-4 and IL-10) cytokines. By contrast, the majority of the stimulated Th2 lymphocytes produced IL-4 and less than 1% produced IFN- (Figure 1) . These observations were identical to those presented in more detail by Mangan and colleagues.²³

View larger version (12K): [in this window] [in a new window]   Figure 1. Cytokine production by PMA/ionomycin-treated Th1 and Th2 cells. CD4+ lymphocytes were polarized to a Th1 or Th2 phenotype and subsequently treated with PMA and ionomycin to investigate their cytokine profile. Intracellular staining of IFN- or IL-4 production was assessed by flow cytometric analysis. Data are expressed as the arithmetic mean ± SEM of five separate polarizations.

Induction of Vascular Inflammation after TNF- and IL-4 Treatment

To directly examine the activation of the intestinal endothelium, we investigated the expression of P-selectin in response to TNF- and IL-4. As shown in Figure 2 , only very low levels of P-selectin were detected in the small intestine of control mice. After 5 hours of TNF- treatment (25 µg/kg, i.p.) we observed a profound increase in P-selectin expression by intestinal endothelium. In the IL-4-treated mice (100 ng/mouse, i.p.), P-selectin expression was also significantly increased when compared to control values. It should be noted that, TNF- induced a 10-fold increase in P-selectin expression over that observed by IL-4 (Figure 2) .

View larger version (12K): [in this window] [in a new window]   Figure 2. Increased P-selectin expression in the small intestine of TNF-- and IL-4-treated mice. Radiolabeled P-selectin antibody was administered to untreated animals (control) and animals treated with TNF- or IL-4. Data are expressed as the arithmetic mean ± SEM of four animals per group. *P < 0.05 relative to control; #P < 0.05 relative to TNF- treatment group.

Th1 Lymphocyte Rolling and Adhesion Is Increased in the Intestine of TNF-- and IL-4-Treated Mice

We used intravital microscopy to observe in vivo naïve lymphocyte endothelial interactions in the intestine of untreated and TNF-- or IL-4-treated mice. Without polarization to either Th1 or Th2, antigen-naïve CD4⁺ lymphocytes do not roll along the endothelium of control or cytokine-treated mice (data not shown). As shown in Figure 3 , polarized Th1 cells will roll on the endothelium of untreated mice and within 5 hours of TNF- or IL-4 administration this rolling flux increased significantly. In the postcapillary venules of TNF--treated mice we observed more than a twofold increase in Th1 lymphocytes rolling per minute compared to controls and a threefold increase in the IL-4-treated mice (Figure 3A) . We next determined the velocity with which these cells rolled. Figure 3B shows that Th1 lymphocytes in the intestinal vasculature of TNF--treated mice rolled significantly slower than that in control mice. The velocity of the Th1 lymphocytes in the intestine of IL-4-treated mice was equivalent to that observed in controls. A reduction in rolling velocity allows for leukocytes to accumulate within the intestinal microvessels. We calculated the number of rolling cells per 100-µm length (flux/rolling velocity) and as shown in Figure 3C , we observed 1.3 ± 0.5 rolling Th1 cells per 100 µm in the control mice. By contrast, we observed a more than threefold and twofold increase in rolling Th1 cells per 100 µm in the TNF-- and IL-4-treated mice, respectively. In the control animals we observed very few cells adhering to the postcapillary venules and a tenfold and fivefold increase in adhesion for the TNF-- and IL-4-treated mice, respectively (Figure 3D) .

View larger version (14K): [in this window] [in a new window]   Figure 3. Effect of TNF- and IL-4 treatment on Th1 lymphocyte trafficking in the small intestine. Animals were treated with saline (control), TNF-, or IL-4 for 5 hours before Th1 cell injection. Th1 rolling flux (A), Th1 rolling velocity (B), the number of Th1 cells rolling per 100 µm (C), and Th1 adhesion (D) in postcapillary venules of the small intestine were determined by intravital microscopy. Data are expressed as the arithmetic mean ± SEM of at least five animals per group. *P < 0.05 relative to control group; #P < 0.05 relative to TNF- treatment group.

Th2 Lymphocyte Rolling and Adhesion Is Increased in the Intestines of TNF-- and IL-4-Treated Mice

We next investigated the Th2 lymphocyte endothelial interactions in the postcapillary venules of the intestine of control, TNF--treated, and IL-4 treated mice. Compared to the control group, in the TNF-- and IL-4-treated mice we observed a 30% and 50% increase in Th2 lymphocytes rolling flux (Figure 4A) . Figure 4B shows that Th2 lymphocytes in the intestinal vasculature of unstimulated mice rolled at a velocity of 57 ± 8 µm/second. In TNF-- as well as IL-4-treated mice Th2 cells rolled 35% slower than that of the control group (Figure 4B) . From these data we calculated the number of rolling cells per 100-µm length (flux/rolling velocity). As shown in Figure 4C , we observed 1.6 ± 0.5 rolling Th2 cells per 100 µm in the control mice. By contrast, we observed a more than twofold increase in rolling Th2 cells per 100 µm in both the TNF-- and IL-4-treated mice. In the intestinal vasculature of unstimulated mice we observed very minimal adhesion of Th2 cells with a 10-fold increase in adhesion of Th2 cells in TNF--treated mice and a fivefold increase in IL-4-treated mice (Figure 4D) . Taken together these results suggest that Th2 lymphocytes can roll in the intestinal vasculature when an inflammatory response is induced by either TNF- or IL-4. Interestingly, these results also suggest that Th2 cells interact to a greater degree with TNF--activated intestinal endothelium as opposed to IL-4-activated endothelium, which closely correlated with increased P-selectin expression.

View larger version (14K): [in this window] [in a new window]   Figure 4. Effect of TNF- and IL-4 treatment on Th2 lymphocyte trafficking in the small intestine. Animals were treated with saline (control), TNF-, or IL-4 for 5 hours before Th1 cell injection. Th2 rolling flux (A), Th2 rolling velocity (B), the number of Th2 cells rolling per 100 µm (C), and Th2 adhesion (D) in postcapillary venules of the small intestine were determined by intravital microscopy. Data are expressed as the arithmetic mean ± SEM of at least five animals per group. *P < 0.05 relative to control group; #P < 0.05 relative to TNF- treatment group.

A Dominant Role for P-Selectin in Th1 Lymphocyte Rolling on the Intestines of TNF-- and IL-4-Treated Mice

To determine the mechanisms by which Th1 lymphocytes roll in the intestinal microvasculature of TNF-- and IL-4-treated mice, intravital microscopy was used to directly observe the effects of adhesion molecule blockade on Th1 cell recruitment. Because many in vitro studies implicate P-selectin, E-selectin, and ₄-integrin as possible mediators of leukocyte recruitment we proceeded to examine their role in vivo.^7,33,34 After baseline rolling was determined in the TNF-- and IL-4-treated mice, antibodies to P-selectin, E-selectin, or ₄-integrin were administered intravenously and lymphocyte rolling was observed 5 to 20 minutes later. As shown in Figure 5A , with the addition of a blocking antibody to P-selectin Th1 cell rolling in TNF--treated mice was completely abolished. With the addition of blocking antibodies to either E-selectin or ₄-integrin no change in rolling flux was observed (Figure 5A) . By contrast, both E-selectin and ₄-integrin play a role in controlling the velocity of Th1 cells in TNF--treated mice (Figure 5B) . Notably, the velocity with which the Th1 cells rolled after administration of Ab to either E-selectin or ₄-integrin increased to a level observed in the control mice (Figure 5B) . The addition of an isotype control antibody did not alter Th1 rolling flux or velocity (Figure 5, A and B) .

View larger version (25K): [in this window] [in a new window]   Figure 5. Effects of adhesion molecule blockade on Th1 rolling in TNF-- and IL-4-treated mice. Animals were treated with TNF- or IL-4 and after Th1 injection and basal levels of rolling recorded, blocking antibodies to P-selectin, E-selectin, 4-integrin, and isotype controls were administered. A and C: Effect of antibody administration on Th1 rolling flux. B and D: Effect of antibody administration on Th1 rolling velocity. Data are expressed as the arithmetic mean ± SEM of at least four animals per group. *P < 0.05 relative to TNF- or IL-4 treatment alone; ND, not determined.

P-Selectin and ₄-Integrin Mediate Th2 Lymphocyte Rolling along the Intestinal Microvasculature of TNF-- and IL-4-Treated Mice

We next investigated the mechanisms by which Th2 cells rolled in the intestinal vasculature of TNF-- and IL-4-treated mice. As shown in Figure 6A , blocking P-selectin completely abolished all Th2 lymphocyte rolling in the intestine of TNF--treated mice. The administration of antibodies to either E-selectin or ₄-integrin did not reduce Th2 rolling flux in these mice (Figure 6A) . Blocking E-selectin had no effect on the velocity of Th2 cells in TNF--treated mice (Figure 6B) . By contrast, blocking ₄-integrin significantly increased Th2 rolling velocity to control levels (Figure 6B) . The administration of isotype control antibodies did not alter Th2 rolling flux or velocity (Figure 6, A and B) .

View larger version (25K): [in this window] [in a new window]   Figure 6. Effects of adhesion molecule blockade on Th2 rolling in TNF-- and IL-4-treated mice. Animals were treated with TNF- or IL-4 and after Th2 injection and basal levels of rolling recorded, blocking antibodies to P-selectin, E-selectin, 4-integrin, and isotype controls were administered. A and C: Effect of antibody administration on Th2 rolling flux. B and D: Effect of antibody administration on Th2 rolling velocity. Data are expressed as the arithmetic mean ± SEM of at least four animals per group. *P < 0.05 relative to TNF--treatment alone; ND, not determined.

P-Selectin Binds Both Th1 and Th2 Lymphocytes Whereas E-Selectin Only Binds Th1 Cells

To confirm the expression of functional ligands to P- and E-selectin on our Th1 and Th2 lymphocytes we used chimeric fusion proteins and flow cytometric analysis. Although a more comprehensive listing of these results can be found in the companion paper by Mangan and colleagues,²³ Table 1 shows that both Th1 and Th2 lymphocytes bound to the P-selectin fusion protein. These observations were confirmed by real-time PCR investigation of fucosyltransferase mRNA levels. As shown in Table 1 , comparable levels of FucTIV and FucTVII were present in both Th1- as well as Th2-polarized cells. Interestingly, there was a clear difference in the ability of Th1 and Th2 lymphocytes to bind to an E-selectin fusion protein suggesting minimal expression of an E-selectin ligand by the Th2 cells (Table 1) . Using flow cytometry, we confirmed that on stimulation Th1 and Th2 cells that produced IFN- and IL-4 also bound P-selectin, respectively (Table 1) .²³

ß₂-Integrin Mediates Th1 and Th2 Lymphocyte Adhesion in TNF-- and IL-4-Treated Mice

Integrins mediate firm adhesion.⁷ In this study, pretreatment of Th1 and Th2 cells with ₄-integrin antibodies did not abrogate adhesion in either microenvironment (data not shown). Because recent literature suggests an important role for CD18 (ß₂-integrin)^35,36 we investigated it in Th1 and Th2 lymphocyte adhesion to the intestine of TNF-- and IL-4-treated mice using intravital microscopy and blocking antibodies. As shown in Figure 7 (bars 1 and 2), the addition of a blocking ß₂-integrin antibody before the addition of Th1 lymphocytes to TNF--treated mice significantly reduced the adhesion of cells by 95%. Similarly, blocking ß₂-integrin inhibited Th1 cell adhesion in IL-4-treated mice by 95% (Figure 7 , bars 3 and 4). We also observed a significant reduction in Th2 cell adhesion. Figure 7 (bars 5 and 6) illustrates that Th2 cell adhesion in TNF--treated mice was reduced by nearly 100% with the addition of an antibody to ß₂-integrin as was Th2 adhesion in IL-4-treated mice (Figure 7 , bars 7 and 8). These results suggest that ß₂-integrin plays a key role in Th1 and Th2 lymphocyte adhesion in the intestinal vasculature of TNF-- and IL-4-treated mice. The addition of an isotype control antibody did not alter Th1 or Th2 cell adhesion (data not shown).

View larger version (14K): [in this window] [in a new window]   Figure 7. Effect of ß2-integrin blockade on Th1 and Th2 adhesion in TNF-- and IL-4-treated mice. Animals were treated with TNF- or IL-4 and before Th1 or Th2 injection a blocking antibody to ß2-integrin was administered. Data are expressed as the arithmetic mean ± SEM of at least four animals per group. *P < 0.05 relative to TNF- or IL-4-treatment alone.

P-Selectin and ₄-Integrin Mediate Th1 and Th2 Cell Rolling in IL-10-Deficient Mice

Using intravital microscopy to examine endogenous leukocyte trafficking in the small intestine we observed a significant increase in rolling and adherent leukocytes within the IL-10-deficient mice when compared to their controls (Table 2) . Notably, this doubling in leukocyte rolling is unlikely to be due to the slight increase in circulating cells observed by us and others in the IL-10-deficient mice (data not shown).³⁶ To see how Th1 and Th2 cells rolled in the vasculature subjected to chronic inflammation, we examined lymphocyte rolling in the IL-10-deficient mice.³⁷ Using intravital microscopy we observed that, compared to controls, there was significant fourfold increase in Th1 cell rolling flux and a twofold increase in Th2 cell rolling flux (Figure 8A) . As observed in the cytokine-treated mice, we found a significant reduction in Th1, but not Th2 cell rolling velocity (Figure 8B) and an increase in Th1 as well as Th2 cell adhesion (Figure 8C) .

View larger version (11K): [in this window] [in a new window]   Figure 8. Th1 and Th2 cell trafficking in IL-10-deficient mice. Th1 and Th2 cells were injected into control (129svev, open bars) or IL-10-deficient mice (IL-10KO, filled bars) and rolling flux (A), velocity (B), and adhesion (C) visualized in postcapillary venules of the small intestine by intravital microscopy. Data are expressed as the arithmetic mean ± SEM of at least four animals per group. *P < 0.05 relative to control group.

View larger version (13K): [in this window] [in a new window]   Figure 9. Effects of adhesion molecule blockade on Th1 and Th2 rolling in IL-10-deficient mice. After Th1 or Th2 injection and baseline levels of rolling recorded, blocking antibodies to P-selectin, 4-integrin, and isotype controls were administered. A: Effect of antibody administration on Th1 rolling flux. B: Effect of antibody administration on Th2 rolling flux. Data are expressed as the arithmetic mean ± SEM of at least four animals per group. *P < 0.05 relative to isotype controls.

View larger version (15K): [in this window] [in a new window]   Figure 10. Flow cytometric analysis of Th1 and Th2 emigration from the intestinal vasculature of IL-10-deficient mice. CFSE-labeled T cells were injected intravenously into IL-10-deficient mice and after 24 hours CD4+ T-cell isolation from the intestine was performed on perfused mice. Mice were either not injected with CFSE-labeled T cells (top) or injected with CFSE-labeled Th1 (middle) or Th2 (bottom) cells. The presence of Th1 or Th2 cells was visualized using flow cytometric analysis. Data are representative of two experiments.

	Discussion

Top Abstract Materials and Methods Results Discussion References

Endothelial cell expression of adhesion molecules in response to stimulatory cytokines is critical for tissues to recruit lymphocytes during inflammation.³⁸ Lymphocytes flow untethered through the venules at high shear rates³⁹ so that their initial interactions with the blood vessel wall requires these specialized adhesive mechanisms permitting rapid association with vascular ligands. Previous studies have suggested that TNF- and IL-4 differentially regulate the expression of adhesion molecules on endothelial cells. Within 5 hours of administration, TNF- induces high expression of adhesion molecules such as P-selectin, E-selectin, VCAM-1, and ICAM-1 on intestinal endothelial cells both in vitro and in vivo.^40,41 From in vitro data we know that human intestinal endothelial cells, human umbilical endothelial cells, and porcine aortic endothelial cells stimulated with IL-4 up-regulate P-selectin and VCAM-1 expression.^40,42,43 There is also a small number of studies that suggest that IL-4 can induce ICAM-1 expression on endothelial cells, albeit to a lesser extent than TNF-.^40,44,45 Our study suggests that P-selectin expression is indeed induced by both TNF- and IL-4, and that P-selectin can mediate lymphocyte rolling in these simple in vivo systems. Similarly, we demonstrated that P-selectin could also support lymphocyte rolling in the chronically inflamed intestine, namely that of IL-10-deficient mice. Interestingly, these observations may be specific for the intestinal vasculature as we have previously demonstrated that IL-4 does not up-regulate P-selectin in the cremaster muscle.²⁵

Our findings with Th1 cells and P-selectin support the recently described work by Haddad and colleagues¹⁴ who demonstrated that P-selectin mediates Th1 cell recruitment in an adoptive transfer model of intestinal inflammation. Our suggestion that P-selectin also regulates Th2 cell rolling in vivo is novel but in line with recent in vivo studies demonstrating that P-selectin ligand is found on CD4⁺ lymphocytes with a Th2 phenotype.¹⁷ Our work extends these observations to demonstrate that the Th2 P-selectin ligands interact in a functional manner with endothelial P-selectin in vivo in this study and predominantly via PSGL-1 in vitro in the companion paper.²³ Earlier studies reported differential expression of PSGL-1 on Th1 and Th2 cells and that only Th1 cells could efficiently enter inflamed sites in Th1-dominated models, such as sensitized skin or arthritic joints in a selectin-dependent manner.^13,46 This varied expression of a P-selectin ligand on Th1 and Th2 cells is suggested to be due to the differential production of 1,3-fucosyltransferase (FucT-VII),^47,48 with Th2 cells expressing less FucT VII than Th1 cells⁴⁹ presumably due to a direct inhibitory effect on P-selectin ligand expression by IL-4. However, it appears from our study that with more prolonged exposure of T cells (14 days) to IL-4 and anti-IL-12, functional P-selectin ligand could be induced on IL-4/IL-10-producing T cells. Although it could be argued that our use of selectin chimeras containing IgM rather than the IgG (used by others) may have increased sensitivity for selectin ligand expression, we detected similar amounts of FucTIV and FucTVII mRNA as well as P-selectin ligand on both Th1 and Th2 cells and both cell types rolled abundantly on P-selectin. Clearly, this is not related to sensitivity.

Our observation of E-selectin mediating only Th1 rolling velocity in only TNF--treated animals follows the demonstration by us and others that Th1, but not Th2, cells express a functional ligand for E-selectin (Table 1) ;^13,49 and TNF-, but not IL-4, induces E-selectin expression on intestinal endothelial cells.^40,41 However, once again it could be argued that much like the P-selectin discrepancy, the lack of E-selectin ligands on Th2 cells is related to in vitro cell culture. Indeed, Akdis and colleagues⁵⁰ have reported that IL-4 is an excellent suppressor of E-selectin ligand expression while IL-12 can induce E-selectin ligand expression in both Th1 as well as Th2 cells. Indeed, in vivo Teraki and Picker⁵¹ demonstrated that both Th1 and Th2 lymphocytes could express the E-selectin ligand CLA and both cell types could infiltrate skin. Although we could only study the role of E-selectin ligands on Th1 cells, our in vivo rolling data provide us with some interesting information. Although inhibition of E-selectin did not affect the flux of rolling Th1 cells, it significantly increased the velocity of rolling. It should be noted that increasing velocity of rolling has been demonstrated to diminish the opportunity for activation and firm adhesion of the rolling leukocytes.⁵² In addition, engagement of E-selectin has been reported to contribute significantly to subsequent adhesion.⁵³ Indeed, our E-selectin inhibition data led to some decrease in Th1 cell adhesion (data not shown) suggesting a significant contribution of this molecule to the recruitment paradigm.

Although our data do not show a significant role for ₄-integrin in Th1 or Th2 cell rolling flux, we did see some increase in rolling velocity after ₄-integrin inhibition. This is an observation previously described for eosinophils and CD8⁺ cells, but not CD4⁺ Th1 or Th2 lymphocytes.^36,54 It is true that ₄-integrin has been shown to inhibit inflammation in models of IBD and that our data suggest that ₄-integrin antibody has minimal effects on Th1 cell rolling and adhesion in the intestinal vasculature in response to either TNF- or IL4. This does not mean that ₄-integrin is not important in the setting of IBD but perhaps suggests that ₄-integrin antibodies may target other cell types aside from CD4 T cells. The other major integrin that mediates adhesion of leukocytes is the ß₂-integrin. Bernstein and co-workers⁵⁵ have previously demonstrated that there is altered expression of ß₂-integrins on CD4⁺ lamina propria lymphocytes in ulcerative colitis (UC) and Crohn’s disease (CD) but whether ß₂-integrins served any major function in the recruitment of these cells has not been well characterized. In this current study we demonstrate that both Th1 and Th2 cells use ß₂-integrin to adhere to intestinal endothelium after exposure to TNF- and IL-4. Although there is great interest in the targeting of ₄ß₇:MAdCAM-1 interactions in the treatment of IBD, our observations suggest some consideration should be given to the role of ß₂-integrin.^34,56

The final accumulation of leukocytes at a site of inflammation depends on both the nature of the locally secreted chemokines as well as the relative expression of the multitude of specific chemokine receptors. Many studies have focused on the fact that Th1 and Th2 cells express different chemokine receptors and respond to chemokines differently.^57,58 For example, the chemokine receptors CCR5 and CXCR3 (for RANTES/MIP-1ß and IP-10/TARC/Mig, respectively) are preferentially expressed by Th1 cells^58,59 and CCR4, CCR8, and CCR3 to a lesser extent (for TARC/MDC, I-309 and eotaxin/MCP-3, respectively) are preferentially expressed by Th2 cells.^58,60,61 Our data would suggest that exposure to the intestinal cytokine milieu in IL-10-deficient mice was insufficient to selectively induce just Th1 or Th2 lymphocyte adhesion and subsequent extravasation. These observations suggest that either Th1 and Th2 cells have chemokine receptors that overlap or that the expression of chemokines in these Th1 or Th2 microenvironments are not sufficiently selective to specifically recruit either Th1 or Th2 cells. Evidence supporting the former theory comes from Bonecchi and co-workers⁵⁸ who have shown that both Th1 and Th2 cells express an equivalent level of CXCR4 and CCR1 such that SDF-1 and RANTES/MIP-1/MCP-3 will recruit Th1 and Th2 cells indiscriminately in vitro. In the context of intestinal inflammation, studies have shown that Th1 and Th2 cells migrate in response to the chemokines MCP-1, MIP-1, and MIP-1ß, and that these are in fact up-regulated in IBD.^58,62 A recent study by Iqbal and co-workers⁶³ demonstrated that the same stimulus could induce intestinal inflammation (of equivalent severity and time for development) by both Th1 and Th2 lymphocytes. Similarly, Xu and co-workers¹² demonstrated that both Th1 and Th2 cells are able to traffic to the retina in the initial stages of experimental autoimmune uveoretinitis. Taken together, these studies and our own suggest that the local microenvironment may not discriminate between Th1 or Th2 cells for CD4⁺ cell recruitment during an immune response and that similarities in the mechanisms for recruitment may exist.

	Acknowledgements

 
We thank Krista McRae and Lori Zbytnuik for animal assistance and Dr. John Lowe for provision of plasmids that express P- and E-selectin-hIgM fusion proteins.

	Footnotes

 
Address reprint requests to Paul Kubes, Ph.D., Dept. of Physiology and Biophysics, University of Calgary, 3330 Hospital Dr. NW, Calgary, AB, T2N 4N1, Canada. E-mail: pkubes{at}ucalgary.ca

Supported by grants from the Crohn’s and Colitis Foundation of Canada, the Canadian Institutes of Health Research (group grant), the National Institutes of Health (to C.T.W. and P.R.M.), and the Crohn’s and Colitis Foundation of America (to D.C.B.).

P.K. is an Alberta Heritage Foundation for Medical Research scientist and a Canadian Research chair recipient; D.-M.M. is a Canadian Institutes of Health Research scholar; M.U.N. is an Australian National Health and Medical Research Council C.J. Martin fellowship holder (no. 284394); and C.S.B. held a Canadian Association of Gastroenterology fellowship and is currently an Australian National Health and Medical Research Council fellowship holder (no. 278806).

Accepted for publication July 28, 2005.

	References

Top Abstract Materials and Methods Results Discussion References

 

1. Racke MK, Bonomo A, Scott DE, Cannella B, Levine A, Raine CS, Shevach EM, Rocken M: Cytokine-induced immune deviation as a therapy for inflammatory autoimmune disease. J Exp Med 1994, 180:1961-1966[Abstract/Free Full Text]
2. Liblau RS, Singer SM, McDevitt HO: Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol Today 1995, 16:34-38[Medline]
3. Fuss IJ, Neurath M, Boirivant M, Klein JS, de la MC, Strong SA, Fiocchi C, Strober W: Disparate CD4+ lamina propria (LP) lymphokine secretion profiles in inflammatory bowel disease. Crohn’s disease LP cells manifest increased secretion of IFN-gamma, whereas ulcerative colitis LP cells manifest increased secretion of IL-5. J Immunol 1996, 157:1261-1270[Abstract]
4. Parronchi P, Romagnani P, Annunziato F, Sampognaro S, Becchio A, Giannarini L, Maggi E, Pupilli C, Tonelli F, Romagnani S: Type 1 T-helper cell predominance and interleukin-12 expression in the gut of patients with Crohn’s disease. Am J Pathol 1997, 150:823-832[Abstract]
5. Voskuhl RR, Martin R, Bergman C, Dalal M, Ruddle NH, McFarland HF: T helper 1 (Th1) functional phenotype of human myelin basic protein-specific T lymphocytes. Autoimmunity 1993, 15:137-143[Medline]
6. Miltenburg AM, van Laar JM, de Kuiper R, Daha MR, Breedveld FC: T cells cloned from human rheumatoid synovial membrane functionally represent the Th1 subset. Scand J Immunol 1992, 35:603-610[Medline]
7. Lawrence MB, Springer TA: Leukocytes roll on a selectin at physiologic flow rates: distinction from and prerequisite for adhesion through integrins. Cell 1991, 65:859-873[Medline]
8. Johnston B, Issekutz TB, Kubes P: The alpha 4-integrin supports leukocyte rolling and adhesion in chronically inflamed postcapillary venules in vivo. J Exp Med 1996, 183:1995-2006[Abstract/Free Full Text]
9. Springer TA: Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu Rev Physiol 1995, 57:827-872[Medline]
10. Zimmerman GA, McIntyre TM, Prescott SM: Adhesion and signaling in vascular cell-cell interactions. J Clin Invest 1996, 98:1699-1702[Medline]
11. Albelda SM, Smith CW, Ward PA: Adhesion molecules and inflammatory injury. FASEB J 1994, 8:504-512[Abstract]
12. Xu H, Manivannan A, Jiang HR, Liversidge J, Sharp PF, Forrester JV, Crane IJ: Recruitment of IFN-gamma-producing (Th1-like) cells into the inflamed retina in vivo is preferentially regulated by P-selectin glycoprotein ligand 1: P/E-selectin interactions. J Immunol 2004, 172:3215-3224[Abstract/Free Full Text]
13. Austrup F, Vestweber D, Borges E, Lohning M, Brauer R, Herz U, Renz H, Hallmann R, Scheffold A, Radbruch A, Hamann A: P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflammed tissues. Nature 1997, 385:81-83[Medline]
14. Haddad W, Cooper CJ, Zhang Z, Brown JB, Zhu Y, Issekutz A, Fuss I, Lee HO, Kansas GS, Barrett TA: P-selectin and P-selectin glyco-protein ligand 1 are major determinants for Th1 cell recruitment to nonlymphoid effector sites in the intestinal lamina propria. J Exp Med 2003, 198:369-377[Abstract/Free Full Text]
15. Piccio L, Rossi B, Scarpini E, Laudanna C, Giagulli C, Issekutz AC, Vestweber D, Butcher EC, Constantin G: Molecular mechanisms involved in lymphocyte recruitment in inflamed brain microvessels: critical roles for P-selectin glycoprotein ligand-1 and heterotrimeric G(i)-linked receptors. J Immunol 2002, 168:1940-1949[Abstract/Free Full Text]
16. Campbell DJ, Butcher EC: Rapid acquisition of tissue-specific homing phenotypes by CD4(+) T cells activated in cutaneous or mucosal lymphoid tissues. J Exp Med 2002, 195:135-141[Abstract/Free Full Text]
17. Kretschmer U, Bonhagen K, Debes GF, Mittrucker HW, Erb KJ, Liesenfeld O, Zaiss D, Kamradt T, Syrbe U, Hamann A: Expression of selectin ligands on murine effector and IL-10-producing CD4+ T cells from non-infected and infected tissues. Eur J Immunol 2004, 34:3070-3081[Medline]
18. Haskins K, Kubo R, White J, Pigeon M, Kappler J, Marrack P: The major histocompatibility complex-restricted antigen receptor on T cells. I. Isolation with a monoclonal antibody. J Exp Med 1983, 157:1149-1169[Abstract/Free Full Text]
19. Bucy RP, Karr L, Huang GQ, Li J, Carter D, Honjo K, Lemons JA, Murphy KM, Weaver CT: Single cell analysis of cytokine gene coexpression during CD4+ T-cell phenotype development. Proc Natl Acad Sci USA 1995, 92:7565-7569[Abstract/Free Full Text]
20. Ohara J, Paul WE: Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1. Nature 1985, 315:333-336[Medline]
21. Wysocka M, Kubin M, Vieira LQ, Ozmen L, Garotta G, Scott P, Trinchieri G: Interleukin-12 is required for interferon-gamma production and lethality in lipopolysaccharide-induced shock in mice. Eur J Immunol 1995, 25:672-676[Medline]
22. Szabo SJ, Jacobson NG, Dighe AS, Gubler U, Murphy KM: Developmental commitment to the Th2 lineage by extinction of IL-12 signaling. Immunity 1995, 2:665-675[Medline]
23. Mangan PR, O’Quinn D, Harrington L, Bonder CS, Kubes P, Kucik DF, Bullard DC, Weaver CT: Both Th1 and Th2 cells require PSGL-1 for optimal rolling on inflamed endothelium. Am J Pathol 2005, 167:1661-1674[Abstract/Free Full Text]
24. Eppihimer MJ, Wolitzky B, Anderson DC, Labow MA, Granger DN: Heterogeneity of expression of E- and P-selectins in vivo. Circ Res 1996, 79:560-569[Abstract/Free Full Text]
25. Hickey MJ, Kanwar S, McCafferty DM, Granger DN, Eppihimer MJ, Kubes P: Varying roles of E-selectin and P-selectin in different microvascular beds in response to antigen. J Immunol 1999, 162:1137-1143[Abstract/Free Full Text]
26. Carvalho-Tavares J, Hickey MJ, Hutchison J, Michaud J, Sutcliffe IT, Kubes P: A role for platelets and endothelial selectins in tumor necrosis factor-alpha-induced leukocyte recruitment in the brain microvasculature. Circ Res 2000, 87:1141-1148[Abstract/Free Full Text]
27. Wiersema AM, Dirksen R, Oyen WJ, Van der Vliet JA: A method for long duration anaesthesia for a new hindlimb ischaemia-reperfusion model in mice. Lab Anim 1997, 31:151-156[Abstract/Free Full Text]
28. Wong J, Johnston B, Lee SS, Bullard DC, Smith CW, Beaudet AL, Kubes P: A minimal role for selectins in the recruitment of leukocytes into the inflamed liver microvasculature. J Clin Invest 1997, 99:2782-2790[Medline]
29. Massberg S, Eisenmenger S, Enders G, Krombach F, Messmer K: Quantitative analysis of small intestinal microcirculation in the mouse. Res Exp Med (Berl) 1998, 198:23-35
30. Connor EM, Eppihimer MJ, Morise Z, Granger DN, Grisham MB: Expression of mucosal addressin cell adhesion molecule-1 (MAdCAM-1) in acute and chronic inflammation. J Leukoc Biol 1999, 65:349-355[Abstract]
31. Kanwar S, Bullard DC, Hickey MJ, Smith CW, Beaudet AL, Wolitzky BA, Kubes P: The association between alpha4-integrin, P-selectin, and E-selectin in an allergic model of inflammation. J Exp Med 1997, 185:1077-1087[Abstract/Free Full Text]
32. Tjandra K, Sharkey KA, Swain MG: Progressive development of a Th1-type hepatic cytokine profile in rats with experimental cholangitis. Hepatology 2000, 31:280-290[Medline]
33. Alon R, Feizi T, Yuen CT, Fuhlbrigge RC, Springer TA: Glycolipid ligands for selectins support leukocyte tethering and rolling under physiologic flow conditions. J Immunol 1995, 154:5356-5366[Abstract]
34. Berlin C, Bargatze RF, Campbell JJ, von Andrian UH, Szabo MC, Hasslen SR, Nelson RD, Berg EL, Erlandsen SL, Butcher EC: Alpha 4 integrins mediate lymphocyte attachment and rolling under physiologic flow. Cell 1995, 80:413-422[Medline]
35. Forlow SB, Foley PL, Ley K: Severely reduced neutrophil adhesion and impaired host defense against fecal and commensal bacteria in CD18–/–P-selectin–/– double null mice. FASEB J 2002, 16:1488-1496[Abstract/Free Full Text]
36. Singbartl K, Thatte J, Smith ML, Wethmar K, Day K, Ley K: A CD2-green fluorescence protein-transgenic mouse reveals very late antigen-4-dependent CD8+ lymphocyte rolling in inflamed venules. J Immunol 2001, 166:7520-7526[Abstract/Free Full Text]
37. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W: Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993, 75:263-274[Medline]
38. Pober JS, Cotran RS: Cytokines and endothelial cell biology. Physiol Rev 1990, 70:427-451[Free Full Text]
39. Atherton A, Born GV: Quantitative investigations of the adhesiveness of circulating polymorphonuclear leucocytes to blood vessel walls. J Physiol 1972, 222:447-474[Abstract/Free Full Text]
40. Haraldsen G, Kvale D, Lien B, Farstad IN, Brandtzaeg P: Cytokine-regulated expression of E-selectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) in human microvascular endothelial cells. J Immunol 1996, 156:2558-2565[Abstract]
41. Horie Y, Chervenak RP, Wolf R, Gerritsen ME, Anderson DC, Komatsu S, Granger DN: Lymphocytes mediate TNF-alpha-induced endothelial cell adhesion molecule expression: studies on SCID and RAG-1 mutant mice. J Immunol 1997, 159:5053-5062[Abstract]
42. Yao L, Pan J, Setiadi H, Patel KD, McEver RP: Interleukin 4 or oncostatin M induces a prolonged increase in P-selectin mRNA and protein in human endothelial cells. J Exp Med 1996, 184:81-92[Abstract/Free Full Text]
43. Stocker CJ, Sugars KL, Harari OA, Landis RC, Morley BJ, Haskard DO: TNF-alpha, IL-4, and IFN-gamma regulate differential expression of P- and E-selectin expression by porcine aortic endothelial cells. J Immunol 2000, 164:3309-3315[Abstract/Free Full Text]
44. Berger RB, Blackwell NM, Lass JH, Diaconu E, Pearlman E: IL-4 and IL-13 regulation of ICAM-1 expression and eosinophil recruitment in Onchocerca volvulus keratitis. Invest Ophthalmol Vis Sci 2002, 43:2992-2997[Abstract/Free Full Text]
45. Colgan SP, Resnick MB, Parkos CA, Delp-Archer C, McGuirk D, Bacarra AE, Weller PF, Madara JL: IL-4 directly modulates function of a model human intestinal epithelium. J Immunol 1994, 153:2122-2129[Abstract]
46. Borges E, Tietz W, Steegmaier M, Moll T, Hallmann R, Hamann A, Vestweber D: P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J Exp Med 1997, 185:573-578[Abstract/Free Full Text]
47. Maly P, Thall A, Petryniak B, Rogers CE, Smith PL, Marks RM, Kelly RJ, Gersten KM, Cheng G, Saunders TL, Camper SA, Camphausen RT, Sullivan FX, Isogai Y, Hindsgaul O, von Andrian UH, Lowe JB: The alpha(1,3)fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell 1996, 86:643-653[Medline]
48. Knibbs RN, Craig RA, Natsuka S, Chang A, Cameron M, Lowe JB, Stoolman LM: Alpha(1,3)-fucosyltransferase VII-dependent synthesis of P- and E-selectin ligands on cultured T lymphoblasts. J Immunol 1998, 161:6305-6315[Abstract/Free Full Text]
49. Wagers AJ, Waters CM, Stoolman LM, Kansas GS: Interleukin 12 and interleukin 4 control T cell adhesion to endothelial selectins through opposite effects on alpha1,3-fucosyltransferase VII gene expression. J Exp Med 1998, 188:2225-2231[Abstract/Free Full Text]
50. Akdis M, Klunker S, Schliz M, Blaser K, Akdis CA: Expression of cutaneous lymphocyte-associated antigen on human CD4(+) and CD8(+) Th2 cells. Eur J Immunol 2000, 30:3533-3541[Medline]
51. Teraki Y, Picker LJ: Independent regulation of cutaneous lymphocyte-associated antigen expression and cytokine synthesis phenotype during human CD4+ memory T cell differentiation. J Immunol 1997, 159:6018-6029[Abstract]
52. Dunne JL, Collins RG, Beaudet AL, Ballantyne CM, Ley K: Mac-1, but not LFA-1, uses intercellular adhesion molecule-1 to mediate slow leukocyte rolling in TNF-alpha-induced inflammation. J Immunol 2003, 171:6105-6111[Abstract/Free Full Text]
53. Simon SI, Hu Y, Vestweber D, Smith CW: Neutrophil tethering on E-selectin activates beta 2 integrin binding to ICAM-1 through a mitogen-activated protein kinase signal transduction pathway. J Immunol 2000, 164:4348-4358[Abstract/Free Full Text]
54. Ulfman LH, Kuijper PH, van der Linden JA, Lammers JW, Zwaginga JJ, Koenderman L: Characterization of eosinophil adhesion to TNF-alpha-activated endothelium under flow conditions: alpha 4 integrins mediate initial attachment, and E-selectin mediates rolling. J Immunol 1999, 163:343-350