| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Mouse Genomics Lab,* Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge, United Kingdom; the Department of Orthopaedics, Brown Medical School/Rhode Island Hospital, Providence, Rhode Island; and the Department of Pathology, Anatomy, and Cell Biology, Thomas Jefferson University, Philadelphia, Pennsylvania
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
Matrilin-3 is the least complex member of the matrilin family, consisting of only one vWFA domain, four EGF-like domains, and a C-terminal coiled-coil domain.3
The vWFA domain is found in various collagenous and noncollagenous extracellular matrix proteins13
and is composed of a central ß-sheet core flanked by 
-helices. In humans, nine missense mutations in the matrilin-3 gene (MATN3) that affect the vWFA domain (typically the ß-sheets) have been found in patients with multiple epiphyseal dysplasia (MED), characterized by delayed and irregular ossification of the epiphyses and early-onset osteoarthritis.13-17
Mutations in MATN3 have also been reported in other osteochondrodysplasias, including bilateral hereditary microepiphyseal dysplasia, a MED-like disorder characterized by small epiphyses in the hip and knee joints,15
spondylo-epimetaphyseal dysplasia, which includes a number of conditions associated with vertebral, epiphyseal, and metaphyseal anomalies,18
and idiopathic hand osteoarthritis.19
Matrilin-3 has also been reported to be up-regulated in cartilage from osteoarthritis patients with a strong correlation between enhanced matrilin-3 gene and protein expression and the extent of tissue damage.20
These findings suggest that tight regulation of matrilin-3 expression is essential for maintenance of the cartilage ECM microenvironment. However, it is not known how defective matrilin-3 leads to a variety of skeletal diseases including both chondrodysplasia during development and osteoarthritis in adulthood.
In the mouse, matrilin-3 is expressed exclusively in the developing cartilage of the skeletal system, with expression first being detected at day 12.5 and remaining unchanged from embryonic day (E) 15.5 until birth.21 In newborn mice, matrilin-3 is widely expressed in the cartilage of the developing bones of the eye, nasal cavity, ribs, long bones, sternum, and trachea, but its expression is more restricted by 6 weeks of age.4,22 Although it has been shown that matrilin-1 and -3 can form heteroligomers and are often colocalized in tissue, clear differences in their spatial distribution have been shown by double immunolabeling.22 In addition, although matrilin-1 expression continues in tissues that remain cartilaginous throughout life (such as in costal cartilage and in the nasal septum), matrilin-3 expression ceases after birth in these tissues.22
Matrilin-1 has been inactivated by gene targeting in the mouse by two different groups. In one case, no abnormalities were reported,23 whereas the other group reported alterations in cartilage collagen fibril organization and fibrillogenesis.24 More recently, matrilin-3 has been inactivated by targeted disruption in the mouse and was found to be dispensable for normal skeletal growth and development in peri- or postnatal stages, with histological and ultrastructural analyses revealing endochondral bone formation indistinguishable from that of wild-type animals.25 Given that matrilin-3 has been implicated in the pathogenesis of both chondrodysplasia and osteoarthritis, in the present study, we have generated a new allele of matrilin-3 and used these homozygous matrilin-3 functional knockout mice to examine the role of matrilin-3 in cartilage during embryonic development and adulthood. We show for the first time its role in the development of osteoarthritis during aging.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
A 500-bp Matn3 exon 2 cDNA probe was used to screen the RPCI-23 BAC filter library and isolate clone RP23-447f3. Using the BAC clone as a template, polymerase chain reaction (PCR) was performed using Platinum PCR Supermix High Fidelity (Invitrogen, Carlsbad, CA) for 18 amplification cycles to generate the homology arms of the targeting vector. The 5' homology arm consisted of a 3.9-kb EcoRV-flanked product (spanning from the 5'-untranslated region to the first few amino acids of exon 2) with a stop codon incorporated into the 3' end. The 3' homology arm consisted of a 5-kb NotI-flanked product (spanning from the last few amino acids of exon 2 to intron 3) and introduced an SstI restriction site at the 3' end. The PCR products were cloned into pGEM-T Easy (Promega, Madison, WI) and sequenced to ensure no mutations had been introduced during amplification before being cloned into a phosphoglycerate kinase-neomycin cassette-containing vector.
Ten micrograms of the SalI-linearized Matn3 targeting vector (pM29) was electroporated into AB2.2 embryonic stem (ES) cells (from mouse strain 129S5/SvEvBrd).26 The ES cells were cultured on a lethally irradiated SNL76/7 feeder layer27 and picked into 96-well plates after 7 days of drug selection in G418 (180 µg/ml). To check for homologous recombination, genomic DNA was analyzed by Southern blotting using both 520-bp 5' external probe pO1 (forward, 5'-GCATCCCATTCACGATGCTAGAATTTGTGAGGC-3'; reverse, 5'-ATGGGCTTGACGACCTGCCGGGGTCTGTGAGC-3') on SpeI-digested DNA to identify a 12-kb wild-type allele and a 7.6-kb targeted allele and a 554-bp 3' external probe pM4 (forward, 5'-AGTCTAGCAAAGCAAGACCTTTATTTGCATTAGGCATAAA-3'; reverse, 5'-AGGAGTGGGCACAGGAAAGGGAACTGATGGAATTTCTGGT-3') on SstI-digested DNA to identify a 9-kb wild-type allele and a 6-kb targeted allele. Correctly targeted ES cell clones termed Matn3Brdtm1 (Matn3m1/+) were injected into C57BL/6J blastocysts for germline transmission as described previously,26 and germline transmission of the targeted (mutant) allele was demonstrated by Southern blot analysis of tail DNA using both probes. Mice were maintained on a mixed 129/C57 background and housed in accordance with Sanger Institute home office regulations (United Kingdom). The matrilin-1 null (Matn1–/–) mice were imported from Paul Goetinck (Harvard Medi-cal School, Boston, MA) and have been previously described.24
RNA Isolation, Reverse Transcription (RT)-PCR, and Real-Time Quantitative RT-PCR
Total RNA was extracted from the hind limb of Matn3 wild-type and null (m1/m1) embryos at day E18.5 using the RNAqueous kit (Ambion, Austin, TX) according to the manufacturer’s instructions. For RT-PCR, 1.5 µg of RNA was reverse-transcribed using RETROscript (Ambion) according to the manufacturer’s instructions, and the resulting cDNA was used in PCR analysis of the expression of matrilin-3 using primers spanning exon 2 (GenBank accession no. NM_010770; forward, 5'-AGGTGTTTGCAAGAGCAGGCCTTTGGACTT-3'; reverse, 5'-CAAAAGGTTTCCTGGAATCTAGCAGAAAGC-3'; 570-bp product) and exons 1 to 3 (forward, 5'-ATGTTGCTCTCAGCCCCCTTACGCC-3'; reverse, 5'-GTGCCAAGCATGCACTGATCCAGA-3'; 800-bp product); matrilin-1 using primers spanning exons 2 to 3 (GenBank accession no. NM_010769; forward, 5'-ACGGACCTGGTGTTTGTTGT-3'; reverse, 5'-AGAAGGCCTCTTGGAACT-3'; 544-bp product); and ß-actin using primers spanning exons 2 to 3 (GenBank accession no. NM_007393; forward, 5'-ACCAACTGGGACGATATGGAGAAGA-3'; reverse, 5'-TACGACCAGAGGCATACAGGGACAA-3; 215-bp product). The cDNA was amplified in 50-µl reactions using 45 µl of Platinum PCR Supermix (Invitrogen) and 100 ng of each primer pair with the following PCR cycle profile: 1 cycle at 94°C for 2 minutes followed by 30 cycles at 94°C for 30 seconds, 65°C for 1 minute, and 72°C for 30 seconds with a final cycle of 72°C for 10 minutes. All PCR products were cloned into pGEM-T Easy (Promega) and sequenced to confirm their identity.
For real-time quantitative RT-PCR, 1 µg of total RNA was used for each reverse transcriptase reaction in a reaction buffer containing 1 µl of oligo(dT) and 1 µl of 10 mmol/L dNTP Mix (Ambion). Real-time quantitative PCR amplification was performed using QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA) with DNA Engine Opticon 2 Continuous Fluorescence Detection System (MJ Research, Waltham, MA). Primers used in amplification of target genes’ mRNA are as follows: Matrilin-1 (forward, 5'-CCCCCGACATCAGCAAGGTT-3'; reverse, 5'-CGCAGCGTAGCCTTGTCCAC-3'), Matrilin-2 (forward, 5'-TGCCTCTGAGCCCATTGACAAG-3'; reverse, 5'-TATGTTGCACTGTTGGCTGGT-3'), Matrilin-4 (forward, 5'CCGCGAGGACATGGAACGA 3'; reverse, 5'TGCGAAGAGAGCCCACGTCA 3'), Ihh (forward, 5'-CCACTTCCGGGCCACATTTG-3'; reverse, 5'-GGCCACCACATCCTCCACCA-3'), Type X collagen (forward, 5'-CCAGGTGTCCCAGGATTCCC-3'; reverse, 5'-CAAGCGGCATCCCAGAAAGC-3'), VEGF (forward, 5'-CCTGGTAATGGCCCCTCCTC-3'; reverse, 5'-CCCCATTGCTCTGTGCCTTG-3'), and 18S RNA (forward, 5'-CGGCTACCACATCCAAGGAA-3'; reverse, 5'-GCTGGAATTACCGCGGCT-3'). All target gene mRNA levels were normalized to housekeeping gene 18S RNA levels. Calculation of mRNA values was performed as previously described.8
The 18S RNA was amplified at the same time and used as an internal control. The cycle threshold (Ct) values for 18S RNA and that of samples were measured and calculated by computer software (PE ABI, Foster City, CA). Relative transcript levels were calculated as x = 2–
Ct, in which Ct = E – C, and E = Ctexp – Ct18s; C = Ctctl – Ct18s.
Data were presented as mean ± SEM for six animal samples and analyzed using two-way analysis of variance. The level of each gene in wild-type limb tissues was designated as 1. Statistical significance was taken at P values of less than 0.05 (P < 0.05).
Skeletal Staining and Radiographical Analysis
Skeletons of Matn3 null (m1/m1) and wild-type (+/+) embryos (E17.5) and newborn (P1) mice were prepared and stained with alcian blue and alizarin red as described previously.28 For radiographical analysis, male and female Matn3 null and wild-type mice were euthanized at 7, 18, and 52 weeks of age and images taken with a PIXImus II Bone Densitometer (X-ray tube, 80/35 kVp at 0.5 mA; GE Medical Systems, Bedford, United Kingdom). The PIXImus software package automatically analyzes the resulting images to calculate bone area, bone mineral content, bone mineral density (BMD; bone mineral content/bone area), lean tissue, fat tissue, and percentage of fat. For whole-body measurements, the skull was excluded and for knee joint measurements, a standard "inclusion region of interest" (40 x 40 pixels) was used to gate the knee joint. For Faxitron analysis, knee joints from Matn3 null and wild-type mice at 1 year of age were dissected free of surrounding tissues and imaged with a Faxitron X-ray MX-20 (Faxitron X-ray Corporation, Wheeling, IL).
Histology
Hind limbs dissected from Matn3 null (m1/m1) and wild-type (+/+) embryos at ages E12.5 to E18.5 and newborn mice (P1) were fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (pH 7.4), dehydrated in ethanol, cleared in xylene, and embedded in paraffin, and 6-µm sections were cut. Samples taken after birth were decalcified in 10% ethylenediamine tetraacetic acid-phosphate-buffered saline (PBS) for up to 2 weeks before being processed. For histology, sections were stained with hematoxylin and eosin (H&E) according to standard histochemical protocols. For Safranin-O/Fast Green staining, 5-µm paraffin-embedded sections of tibia from mice were counterstained with hematoxylin before being stained with 0.02% aqueous Fast Green for 4 minutes (followed by three dips in 1% acetic acid) and then 0.1% Safranin-O for 6 minutes. The slides were then dehydrated and mounted with crystal mount medium. At least five animals from each stage were collected for histological analysis. The hypertrophic zone was defined by visual inspection of enlarging cell size in the zone on the histology slide and by expression of type X collagen mRNA through in situ hybridization analysis. Comparison of healthy (grade 0) and osteoarthritis (OA) cartilage morphological changes was determined by modified Wilhelmi OA scoring system29
with the single worst affected score of H&E paraffin slides through the entire knee joint. At least two blinded observers scored the cartilage sections. Significance of scores between Matn3 null (m1/m1) and wild-type (+/+) mice was determined by 
2 statistics.
Immunohistochemistry
For immunohistochemistry, sections were digested with bovine testicular hyaluronidase (4000 U/ml in PBS; Sigma, St. Louis, MO) for 30 minutes at 37°C. After washing in PBS, the sections were incubated with 5% normal goat serum for 30 minutes at room temperature before being incubated for 1 hour at room temperature with either polyclonal anti-collagen type II antibody (Chemicon Europe Ltd., Hampshire, United Kingdom), anti-matrilin-1 monoclonal antibody 1H1,30 or anti-matrilin-2 monoclonal antibody (to generate a polyclonal antibody against matrilin-2, a peptide encoding 20 amino acids [SRSTQKLFHSTKSSGNPLEE] from the unique domain of mouse matrilin-2 was synthesized and the antibody was raised by immunizing rabbits with the synthetic peptide followed by affinity purification). Affinity-purified fluorescein-conjugated or phycoerythrin-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA) were then applied at 1:100 for 1 hour at room temperature.
Distribution of proliferating cell nuclear antigen (PCNA) antigen in growth plate was examined by immunohistochemistry with a Histostain SP kit (Zymed, San Francisco, CA) using anti-PCNA monoclonal antibody (sc-56; Santa Cruz Biotechnology, Santa Cruz, CA) as primary antibody, as described in http://www.ihcworld.com/_protocols/antibody_protocols/pcna_santa_cruz.htm.
After hyaluronidase treatment, deparaffinized sections were incubated in 0.2% Triton X-100/PBS for 5 minutes at room temperature. Slides were washed with PBS and treated with peroxidase-quenching solution to eliminate endogenous peroxidase activity. After blocking with a blocking solution for 10 minutes at room temperature, sections were then incubated with primary antibodies (1:100) for 1 hour at 37°C followed by incubation overnight at 4°C. After washing, the sections were incubated at room temperature with biotinylated secondary antibodies for 10 minutes, with a streptavidin-peroxidase con-jugate for 10 minutes, and with a solution containing diamino-benzidine (chromogen) and 0.03% hydrogen peroxide for 5 minutes. Sections were counterstained with hematoxylin, dehydrated, and mounted. Photography was performed with a Nikon microscope. The length ratio of the hypertrophic zone was calculated as the length of the hypertrophic zone over the total length of proximal tibial growth plate. PCNA-positive cellular profiles were calculated as the percentage of total counted cellular profiles in the different zones of proximal tibial growth plates. A total of 16 sections from four animals were used to perform PCNA study. Statistical analysis was performed using Student’s t-test after consultation with a statistician to ensure the proper sample sizes. Data were expressed as mean ± SD.
In Situ Hybridization
In situ hybridizations were performed as previously described.31 Sense and antisense 35S-labeled RNAs were synthesized from the linearized plasmids using the riboprobe systems kit (Promega) and [35S]UTP (Amersham, Piscataway, NJ). Sense RNA was used as control. The following cDNA plasmids were used: aggrecan, collagen type X, and Sox 9 cDNA plasmids were provided by Prof. Kathy Cheah (University of Hong Kong, Hong Kong), the Indian hedgehog cDNA plasmid was provided by Dr. Andrew McMahon (Harvard University), and the parathyroid hormone-related peptide cDNA plasmid was provided by Dr. Trevor Williams (University of Colorado Health Sciences Center, Denver, CO).
Transmission Electron Microscopy
Hind limbs dissected from Matn3 null (m1/m1) and wild-type (+/+) embryos (E17.5) and newborn (P1) mice were fixed in 4% paraformaldehyde/2.5% glutaraldehyde/0.1 mol/L sodium cacodylate, pH 7.4, with 8 mmol/L CaCl2 for 15 minutes at room temperature, during which time the skin and muscle was dissected away. After this time, the tissue was incubated at 4°C for 40 minutes before being processed as described previously.32 Tibia and femur from six animals from each stage were analyzed. Sections were viewed in an electron microscope (CM10; Philips Electronic Instruments, Inc., Mahwah, NJ).
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Like the human matrilin-3 gene (MATN3), the mouse homolog Matn3 consists of eight exons: exon 1 encodes a signal peptide and a positively charged domain; exon 2, the vWFA domain; exons 3 to 6, the four EGF-like domains; and exons 7 and 8, a coiled-coil domain (Figure 1A)
. Because the vWFA domain is the site of all nine MATN3 mutations in MED patients and vWFA domains are thought to mediate interactions with other proteins, we chose to ablate exon 2 of Matn3 by homologous recombination in ES cells and replace it with a neomycin resistance cassette and an in-frame stop codon (Figure 1A)
. AB2.2 ES cells were electroporated with the nonisogenic targeting vector, pM29 (Figure 1A)
. Of the 1000 G418-resistant ES cell clones that were picked, two correctly targeted clones were identified by Southern blot analysis of SpeI- and SstI-digested genomic DNA using a 5' (pO1) and 3' (pM1) external probe, respectively (data not shown). ES cells from the two targeted clones were used to generate chimaeras, which transmitted the targeted allele Matn3Brdm1 (m1) to their progeny. Heterozygous mice were intercrossed to produce wild-type, heterozygous, and homozygous offspring (Figure 1B)
in normal Mendelian ratios. To confirm that the mutant allele was a null, RT-PCR was performed on RNA extracted from the hind limbs of embryonic day 17.5 wild-type and homozygous (m1/m1) mutant mice. Using primers designed against exon 2, the expected 570-bp product was produced from RNA from wild-type but not m1/m1 mice (Figure 1C)
. Using primers designed against exons 1 to 3, RNA from wild-type mice produced the expected 800-bp product, whereas RNA from m1/m1 mice produced a 225-bp product (Figure 1C)
, which when sequenced showed a splicing of exon 1 with exon 3 (Figure 1C
, box). The skipping of exon 2 in the m1 allele results in a reading frame shift that would be predicted to result in a nonsense protein, containing the signal peptide region but not any of the major domains of matrilin-3. Therefore, it is not expected to serve a dominant-negative function, and we conclude that the Matn3Brdm1 allele is a null.
|
Matn3 null mice were healthy at birth. Both males and females were fertile and had a normal lifespan. Because matrilin-3 is expressed by chondrocytes and osteoblasts during endochondral bone formation,4
we analyzed the gross skeletal morphology of embryonic and adult Matn3 null mice. Staining of E17.5 and newborn (P1) Matn3 null mice with alcian blue (for cartilage) and alizarin red (for bone) showed no obvious differences from wild-type littermates (Figure 2A)
. Radiographical analysis of 7- and 18-week-old Matn3 null mice showed no gross skeletal malformations (Figure 2B)
. Thus the lack of matrilin-3 does not appear to grossly affect normal skeletal patterning and growth.
|
. Expression and Distribution of the Other Matrilins in Matrilin-3 Null Mice
To determine whether the absence of an overt Matn3 null phenotype was due to compensation by other members of the matrilin family, we analyzed expression of other matrilins. Real-time quantitative RT-PCR indicated that there were no significant differences in the levels of mRNAs encoding matrilin-1, -2, and -4 in newborn Matn3 null mice compared with wild-type littermates (Figure 3A)
. Thus there is no evidence of a compensatory up-regulation of other members of the matrilin family in Matn3 null mice. Immunostaining of tibiae showed normal expression patterns of matrilin-1 and -2 in the proximal epiphyseal growth plate of Matn3 null mice, with matrilin-1 present in the proliferating zone and the prehypertrophic zone and matrilin-2 present in the hypertrophic zone (Figure 3B)
. However, the hypertrophic zone in a Matn3 null proximal growth plate was expanded in comparison with the wild-type at E16.5 and E17.5 (Figure 3B)
. Histological analysis indicated that the length of the hypertrophic zone was increased by 47% in Matn3 null mice compared with wild-type littermates at E16.5 (Figure 3C)
. The expansion of the hypertrophic zone in Matn3 null proximal tibial growth plates was attenuated during perinatal development, and no difference of the length of the hypertrophic zone was observed between wild-type and Matn3 null growth plates in newborn mice.
|
To determine the mechanistic basis of the expansion of the hypertrophic zone in Matn3 null embryonic growth plates, we analyzed Matn3 null proximal tibial growth plates in more detail. Immunohistochemical analysis of PCNA staining, a marker of cell proliferation, showed that the percentage of the proliferating cellular profiles was significantly decreased in the columnar regions of Matn3 null embryonic growth plate in comparison with the wild-type (Figure 4C)
. This indicated that Matn3 null chondrocytes exit cell cycle precociously.
|
. In situ hybridization of the tibia from E16.5 Matn3 null mice showed intense aggrecan mRNA signals in the prehypertrophic zone. The expression area of collagen type X mRNA, a marker of the hypertrophic chondrocytes, was expanded in Matn3 null growth plates. These data indicated that Matn3 null chondrocytes undergo premature differentiation to the hypertrophic stage. In situ hybridization was performed using probes for genes involved in signaling pathways important for the regulation of bone growth. The expression domain of Indian hedgehog (Ihh), which is expressed by prehypertrophic chondrocytes, was expanded in the Matn3 null growth plate in comparison with the wild-type. Sox9 mRNA signals were decreased in Matn3 null mice, and the mRNA signals of the parathyroid hormone-related peptide (PTHrP) were diminished in the perichondrium regions next to the prehypertrophic and hypertrophic zones in Matn3 null mice (Figure 5A)
.
|
. Levels of Ihh and Col X were significantly increased in Matn3 null chondrocytes, which is consistent with the in situ hybridization analysis. However, the level of VEGF was not affected. Taken together, these data suggest that expanded hypertrophic zone seen in Matn3 null mice is due to accelerated differentiation (prehypertrophy and hypertrophy) rather than delayed matrix resorption. Elevated Bone Mass Density in Adult Matrilin-3 Null Mice
Although the Matn3 null mice showed no obvious gross abnormalities in bone structure, we wanted to determine whether the expanded hypertrophic zone seen in embryonic endochondral bone formation would have any effect on the mineral density of bones in the adult. Dual-energy X-ray absorptiometry densitometry was used to measure whole-body and knee joint BMD of Matn3 null mice at various ages. As expected, both Matn3 null and wild-type mice showed a gradual increase in whole-body BMD levels with age (Figure 6A)
; however, by 18 weeks of age Matn3 null mice showed a significantly elevated BMD (0.062 ± 0.003) compared with both wild-type mice (0.054 ± 0.003) and Matn1 null mice (0.054 ± 0.002) (Figure 6B)
. When the knee joints were analyzed separately, wild-type mice showed a relatively stable BMD value at different ages, whereas Matn3 null mice showed elevated BMD values starting from 7 weeks of age (Figure 6C)
. The differences were most overt by 18 weeks of age (Matn3 null, 0.093 ± 0.007; Matn1 null, 0.077 ± 0.006; and wild-type, 0.073 ± 0.007) (Figure 6B)
. Therefore, adult Matn3 null mice have significantly higher bone mass density than wild-type littermates or Matn1 null mice.
|
Because elevated BMD is one feature of osteoarthritis, the articular cartilage of Matn3 null mice knee joints were examined for evidence of osteoarthritis. Osteoarthritis of the knee joint cartilage in Matn3 null mice was not observed in 7-week-old mice, occurred infrequently in 18 week mice (data not shown), but affected 100% of mice at 1 year of age (Table 1)
. In contrast, 45% of wild-type mice exhibited osteoarthritis at 1 year of age but of a less severe grade (Table 1)
. The histological features of osteoarthritis included fissuring of the articular surface, clustering of chondrocytes, formation of osteophytes, degeneration of the matrix, cleft of cartilage, and even exposure of the subchondral bone surface (Figure 7A)
. Staining of the Matn3 null mice knee joint sections with Safranin-O/Fast Green indicated the loss of proteoglycan from articular cartilage and degradation of cartilage matrix (Figure 7B)
. Furthermore, the subchondral bone area was increased, which coincides with the decrease of bone marrow area (Figure 7B)
. Faxitron radiographical analysis of Matn3 null mice showed characteristics of osteoarthritis including narrowing of joint space and increase of subchondral bone density (Figure 7C)
. Therefore, osteoarthritis occurs with higher incidence and more severity in adult matrilin-3 null mice during aging despite the lack of chondrodysplasia in postnatal development.
|
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
All four members of the matrilin family of proteins are expressed in developing cartilage and play an important role in the ECM through the formation of self-assembled filamentous networks35-37 . To date, matrilin-3 is the only member of this family found to be associated with osteochondrodysplasias. In humans, mutations in the matrilin-3 gene (MATN3) have been found in patients with MED, bilateral hereditary microepiphyseal dysplasia, spondylo-epi-metaphyseal dysplasia, and idiopathic hand osteoarthritis,13-19 and up-regulation of matrilin-3 has been found in a cohort of Swedish osteoarthritic patients.20 OA is often associated with the increase of extracellular matrix molecules, although the lack of such functional ECM molecules often leads to OA as well.20 This may be an attempt of the repairing process by OA chondrocytes.
To more fully understand the role of matrilin-3, we ablated the matrilin-3 gene (Matn3). Matn3 null mice were viable and fertile and had a normal lifespan. Adult Matn3 null mice revealed no gross skeletal malformation, and the architecture of the epiphyseal proximal growth plate of tibiae from newborn Matn3 null mice (P1) showed no difference from wild-type littermates, similar to a previous report.25 However, in contrast to the suggestion of functional redundancy between the matrilins,25 we found that the embryonic epiphyseal proximal growth plates from Matn3 null mice tibiae clearly showed an expansion of the hypertrophic zone of chondrocytes (most prominent at E16.5).
A number of secreted polypeptides and transcription factors are known to cooperatively regulate the rates of proliferation of chondrocytes and their transition to hypertrophy. Parathyroid hormone-related peptide (PTHrP), together with Ihh, controls the rate of chondrocyte proliferation and the transition of these cells to hypertrophy.38 PTHrP signals through activating protein kinase A and has been postulated to negatively regulate chondrocyte maturation by increasing the activity of Sox9,39 a transcription factor that inhibits chondrocyte hypertrophy.38,40 Another important factor is vascular endothelial growth factor (VEGF), which is expressed by hypertrophic chondrocytes and an essential coordinator of chondrocyte death, chondroclast function, extracellular matrix remodeling, angiogenesis, and bone formation in the growth plate.41 Transcripts for Sox9 and Pthrp but not VEGF were present at lower levels in the embryonic growth plates of Matn3 null mice than the wild-type controls, indicating that the expanded hypertrophic zone is due to accelerated differentiation of the chondrocytes rather than delayed matrix resorption.
Our data indicate that the accelerated differentiation of Matn3 null chondrocytes may result from precocious entry to the prehypertrophic stage from the proliferation stage. A premature exit from the cell cycle is suggested by a significant decrease of proliferating chondrocytes in the columnar region of the Matn3 null proximal tibial growth plate compared with the wild-type. A precocious entry into the prehypertrophic stage is suggested by the up-regulation of Ihh mRNA in the Matn3 null tibial growth plate. Down-regulation of Sox9 in Matn3 null tibial growth plates may cause premature prehypertrophy, because Sox family proteins have been shown to keep chondrocytes proliferating, to delay prehypertrophy, and to down-regulate Ihh signaling.42 Although the reduced levels of Sox9 is most likely responsible for the accelerated transition of the chondrocytes to hypertrophy, it is unclear how loss of matrilin-3 expression would induce this. This is the first report of a member of the matrilin family regulating Sox9 expression, either directly or indirectly. Alterations of cartilage matrix may primarily affect the diffusion and sequestration of extracellular growth/differentiation factors including Ihh, PthrP, FGFs, BMPs, and Wnts and secondarily chondrocyte differentiation and hence the expression of these regulatory genes. It remains to be determined whether matrilin-3 interacts with these factors or their binding proteins.
Expanded zones of hypertrophic chondrocytes in the epiphyseal growth plate have been observed in several other knockout mice, including those deficient in Smad3,43 Fgfr3,44,45 Fgf18,46 and connective tissue growth factor.47 However, the significance of this in the Matn3 null mice is unclear because the expansion is only seen during embryonic stages, with the postnatal size of the hypertrophic zone being comparable with that seen in wild-type mice. Matn3 null mice generated by Ko et al25 also showed no histological abnormalities in endochondral bone formation in the adult (histological analysis of embryonic stages was not reported). Matrilin-3 has been shown to be expressed in the developing long bones after birth,22 so the lack of an expanded hypertrophic zone in newborn and adult Matn3 null mice cannot be explained by the reason that matrilin-3 is not normally present in the adult. Because the loss of matrilin-3 causes increased hypertrophic differentiation of growth plate chondrocytes in the embryo but not peri- or postnatally, we suggest that matrilin-3 is involved in modulating chondrocyte differentiation in an epiphyseal growth plate during the prenatal period only.
Our study reveals an unexpected property of matrilin-3 in maintaining proper BMD, a factor that was not previously examined.25 BMD is regulated by both environmental and genetic factors (reviewed in Ref. 48 ). Compared with wild-type mice, Matn3 null mice showed significantly elevated whole-body and knee joint BMD values at 18 weeks of age, the time when mice typically reach peak bone density.49 Increased BMD levels have also been reported in Smad1C transgenic mice,50 GDF8 (myostatin)-deficient mice,51 and Stat1-deficient mice.52 It is tempting to speculate that the elevated BMD levels seen in Matn3 null mice are due to an increase in mineralization of the ECM caused by increased Ihh expression and/or by decreased PTHrP distribution in perichondrium. Ihh is a potent stimulator of osteoblast differentiation and mineralization,38,40 whereas PTHrP is an inhibitor of chondrocyte hypertrophy and mineralization. PTH/PTHrP-treated cultured hypertrophic chondrocytes show a repression of collagen type X expression, and the cells mimic proliferating cartilage and are unable to express alkaline phosphatase and mineralize.53
We also show for the first time that the loss of Matn3 leads to onset of osteoarthritis (OA) with higher incidence and more severity in the mouse knee, which exhibit some features mimicking human osteoarthritis, including osteophyte formation, loss of proteoglycan from cartilage, articular cartilage degeneration, and increase of subchondral bone density. The absence of matrilin-3 in the pericellular matrix where it normally interacts with collagen and aggrecan could affect the biomechanical integrity of the cartilage matrix. In addition, clinical studies have shown that the prevalence of radiographical knee and hip osteoarthritis, especially in terms of osteophytes, increases with increasing BMD.8,54-58 However, the mechanism of the association between increased bone density and joint degeneration is not known. Our data show that matrilin-3 deficiency results in both the increase of BMD and joint cartilage degeneration, thereby connecting these two events together. It is intriguing that the loss of a single molecule matrilin-3 would lead to these two processes, one occurring in the bone and the other occurring in articular cartilage. It is not known yet whether the changes in the subchondral bone cause cartilage degeneration, or vice versa, because matrilin-3 is expressed by both chondrocytes and osteoblasts.59 However, the generation of the Matn3 null mice provides a powerful animal model to study the relationship between articular cartilage and subchondral bone.
Our Matn3 null mouse model is particularly relevant to studying pathogenesis of osteoarthritis given that MED patients suffer early-onset OA14 and that mutations in MATN3 have been reported in patients with idiopathic hand OA.19 Macrostructural changes of the joints in MED patients resulting from chondrodysplasia during development may make them more susceptible to developing osteoarthritis. However, it is puzzling why Matn3-associated MED patients develop both chondrodysplasia and osteoarthritis, whereas Matn3-associated idiopathic hand OA patients do not have chondrodysplasia. Our data suggest that chondrodysplasia and osteoarthritis are not necessarily coupled in Matn3-defective cartilage because Matn3 null mice develop higher incidence of osteoarthritis in adulthood without chondrodysplasia in childhood. The fact that the loss of matrilin-3 does not lead to postnatal chondrodysplasia suggests that this developmental disease is caused by a dominant-negative effect of the mutant matrilin-3, rather than by the lack of Matn3. On the other hand, the lack of the functional Matn3 can at least partially account for the pathogenesis of OA associated with Matn3 mutations.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by a CJ Martin/RG Menzies fellowship (to L.v.d.W.) and a CJ Martin fellowship (D.J.A.) from the National Health and Medical Research Council of Australia, by the National Institutes of Health (Q.C., L.W., and D.E.B.), and by the Arthritis Foundation (Q.C.).
Accepted for publication April 27, 2006.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  K. L. Posey, K. Hankenson, A. C. Veerisetty, P. Bornstein, J. Lawler, and J. T. Hecht Skeletal Abnormalities in Mice Lacking Extracellular Matrix Proteins, Thrombospondin-1, Thrombospondin-3, Thrombospondin-5, and Type IX Collagen Am. J. Pathol., June 1, 2008; 172(6): 1664 - 1674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Nicolae, Y.-P. Ko, N. Miosge, A. Niehoff, D. Studer, L. Enggist, E. B. Hunziker, M. Paulsson, R. Wagener, and A. Aszodi Abnormal Collagen Fibrils in Cartilage of Matrilin-1/Matrilin-3-deficient Mice J. Biol. Chem., July 27, 2007; 282(30): 22163 - 22175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Leighton, S. Nundlall, T. Starborg, R. S. Meadows, F. Suleman, L. Knowles, R. Wagener, D. J. Thornton, K. E. Kadler, R. P. Boot-Handford, et al. Decreased chondrocyte proliferation and dysregulated apoptosis in the cartilage growth plate are key features of a murine model of epiphyseal dysplasia caused by a matn3 mutation Hum. Mol. Genet., July 15, 2007; 16(14): 1728 - 1741. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Hills, R. Mazzarella, K. Fok, M. Liu, O. Nemirovskiy, J. Leone, M. D. Zack, E. C. Arner, M. Viswanathan, A. Abujoub, et al. Identification of an ADAMTS-4 Cleavage Motif Using Phage Display Leads to the Development of Fluorogenic Peptide Substrates and Reveals Matrilin-3 as a Novel Substrate J. Biol. Chem., April 13, 2007; 282(15): 11101 - 11109. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||
