Advertisement

Age-Related Dysfunction of the Lacrimal Gland and Oxidative Stress

Evidence from the Cu,Zn-Superoxide Dismutase-1 (Sod1) Knockout Mice
      An imbalance between free radical generation and radical scavenging antioxidant systems results in oxidative stress, which has been associated with cell injury observed in many age-related diseases. The superoxide dismutase (SOD) family is a major antioxidant system, and deficiency of Cu,Zn-superoxide dismutase-1 (Sod1) in mice leads to many different phenotypes that resemble accelerated aging. In this study we examined the morphologic features and the secretory functions of the lacrimal glands in Sod1−/− mice. Lacrimal glands showed atrophy of acinar units; fibrosis; infiltration with CD4+ T cells, monocytes, and neutrophils; increased staining with both 4-hydroxy-2-nonenal and 8-hydroxy-2′-deoxyguanosine; increases in apoptotic cells; and the presence of the epithelial-mesenchymal transition in senescent Sod1−/− mice. Electron microscopy findings revealed evidence of epithelial-mesenchymal transition, presence of swollen and degenerated mitochondria, and the presence of apoptotic cell death in the lacrimal glands of senescent Sod1−/− mice. These alterations were also associated with the accumulation of secretory vesicles in acinar epithelial cells, decreased production of both stimulated and nonstimulated tears, and a decline in total protein secretion from the lacrimal glands. Our results suggest that Sod1−/− mice may be a good model system in which to study the mechanism of reactive oxygen species–mediated lacrimal gland alterations.
      Aging is associated with damage to tissues by free radicals. An imbalance between generation of free radicals and radical scavenging antioxidant systems results in oxidative stress, a condition that has been associated with cell injury observed in many age-related diseases and is also considered a major factor in the process of senescence.
      • Droge W.
      Free radicals in the physiological control of cell function.
      One of the well-known antioxidant defense systems is superoxide dismutase (SOD), an enzyme system that is composed of three isozymes: SOD1, SOD2, and SOD3. Among them, SOD1 is widely distributed in the tissues and represents 90% of the total SOD activity.
      • Crapo J.D.
      • Oury T.
      • Rabouille C.
      • Slot J.W.
      • Chang L.Y.
      Copper,zinc superoxide dismutase is primarily a cytosolic protein in human cells.
      • Fridovich I.
      Superoxide anion radical (O2-.), superoxide dismutases, and related matters.
      Previously, Imamura et al
      • Imamura Y.
      • Noda S.
      • Hashizume K.
      • Shinoda K.
      • Yamaguchi M.
      • Uchiyama S.
      • Shimizu T.
      • Mizushima Y.
      • Shirasawa T.
      • Tsubota K.
      Drusen, choroidal neovascularization, and retinal pigment epithelium dysfunction in SOD1-deficient mice: a model of age-related macular degeneration.
      reported that Sod1 gene knockout in a mouse model was associated with signs of oxidative stress–related retinal damage and features of age-related macular degeneration (AMD), an aging disease of the human retina.
      The prevalence of AMD in the US population 40 years or older is estimated to be 1.47%.
      • Friedman D.S.
      • O'Colmain B.J.
      • Munoz B.
      • Tomany S.C.
      • McCarty C.
      • de Jong P.T.
      • Nemesure B.
      • Mitchell P.
      • Kempen J.
      Prevalence of age-related macular degeneration in the United States.
      Even more prevalent than AMD is another age-related ophthalmic disorder, the dry eye disease, the prevalence of which varies from 3.98% to 9.80% in the United States.
      • Smith J.A.
      • Albeitz J.
      • Begley C.
      • Caffery B.
      • Nichols K.
      • Schaumberg D.
      • Schein O.
      The epidemiology of dry eye disease: report of the Epidemiology Subcommittee of the International Dry Eye WorkShop.
      Dry eye, which is a visually disabling disease,
      • Smith J.A.
      • Albeitz J.
      • Begley C.
      • Caffery B.
      • Nichols K.
      • Schaumberg D.
      • Schein O.
      The epidemiology of dry eye disease: report of the Epidemiology Subcommittee of the International Dry Eye WorkShop.
      has been reported to be a major public health issue in many societies with a significant effect on quality of life and especially on the visual quality of patients with this disorder.
      • Smith J.A.
      • Albeitz J.
      • Begley C.
      • Caffery B.
      • Nichols K.
      • Schaumberg D.
      • Schein O.
      The epidemiology of dry eye disease: report of the Epidemiology Subcommittee of the International Dry Eye WorkShop.
      Evidence from mouse models and human studies of dry eye disease showed decreased tear production, corneal epithelial damage, and lacrimal gland inflammation as important alterations in the pathogenesis of dry eye disease.
      • Pflugfelder S.C.
      • Jones D.
      • Ji Z.
      • Afonso A.
      • Monroy D.
      Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren's syndrome keratoconjunctivitis sicca.
      • Stern M.E.
      • Pflugfelder S.C.
      Inflammation in dry eye.
      • Barabino S.
      • Chen W.
      • Dana M.R.
      Tear film and ocular surface tests in animal models of dry eye: uses and limitations.
      • Suwan-apichon O.
      • Rizen M.
      • Rangsin R.
      • Herretes S.
      • Reyes J.M.
      • Lekhanont K.
      • Chuck R.S.
      Botulinum toxin B-induced mouse model of keratoconjunctivitis sicca.
      • Zoukhri D.
      Effect of inflammation on lacrimal gland function.
      • Niederkorn J.Y.
      • Stern M.E.
      • Pflugfelder S.C.
      • De Paiva C.S.
      • Corrales R.M.
      • Gao J.
      • Siemasko K.
      Desiccating stress induces T cell-mediated Sjögren's syndrome-like lacrimal keratoconjunctivitis.
      • Song X.J.
      • Li D.Q.
      • Farley W.
      • Luo L.H.
      • Heuckeroth R.O.
      • Milbrandt J.
      • Pflugfelder S.C.
      Neurturin-deficient mice develop dry eye and keratoconjunctivitis sicca.
      With the aim to investigate the eligibility of the Sod1 knockout (Sod1−/−) mice as a model for age-related dry eye disease, we studied the functional and histopathologic alterations of the lacrimal gland in the Sod1−/− mice, comparing the results with wild-type (WT) mice. We also investigated the histopathologic changes in human lacrimal gland samples obtained soon after death from young and elderly individuals.

      Materials and Methods

      Animals

      Seventeen Sod1−/− male mice with C57BL/background and 14 C57BL6 strain WT male mice were examined at 10 and 50 weeks in this study. The Sod1−/− mice were received from the Tokyo Metropolitan Institute of Gerontology and the WT C57BL/6 mice were purchased from Japan Clea (Osaka, Japan). Sod1−/− mice were backcrossed to Sod2flox/flox
      • Ikegami T.
      • Suzuki Y.
      • Shimizu T.
      • Isono K.
      • Koseki H.
      • Shirasawa T.
      Model mice for tissue-specific deletion of the manganese superoxide dismutase (MnSOD) gene.
      for two generations to obtain the Sod1−/−, Sod2flox/flox. All studies were performed in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.

      Aqueous Tear Production Measurements

      Aqueous tear production was measured with phenol red–impregnated cotton threads (Zone-Quick, Showa Yakuhin Kako Co., Ltd., Tokyo, Japan) without anesthesia. The validity of this test in mice has been previously described.
      • Dursun D.
      • Wang M.
      • Monroy D.
      • Li D.Q.
      • Lokeshwar B.L.
      • Stern M.E.
      • Pflugfelder S.C.
      A mouse model of keratoconjunctivitis sicca.
      The threads were held with a jeweler forceps and then immersed into the tear meniscus in the lateral canthus for 60 seconds. The length of wetting of the thread was measured in millimeters. Aqueous tear production was weight adjusted by dividing the amount of total aqueous tear produced in 60 seconds by weight. In a separate experiment to determine the incidence of dry eye disease, 40 Sod1−/− male mice and 118 WT male mice aged 50 weeks underwent weight and aqueous tear production measurements. To be able to define the incidence of dry eye disease in mice, we defined dry eye disease as a cotton thread test value of <0.1 mm/g and a corneal fluorescein staining score exceeding 3 points. We then calculated the percentages of mice with dry eye disease in each group.

      Ocular Surface Epithelial Damage Assessment

      Corneal fluorescein staining was evaluated with slit lamp biomicroscopy using cobalt blue light after instillation of 2 μL of 0.5% sodium fluorescein. Excess of fluorescein was wiped from the lateral tear meniscus. The cornea was examined with a handheld slit lamp 2 minutes after fluorescein instillation. Punctuate staining was recorded using a grading system of 0 to 3 points for superior, central, and inferior corneal areas. The fluorescein staining scores ranged from a minimum of 0 to a maximum of 9 points.

      Pilocarpine-Stimulated Aqueous Tear Production Measurements

      Tear secretion was stimulated 3 minutes after anesthesia (6 mg/mL of ketamine and 4 mg/mL of xyladine) by intraperitoneal injection of 0.06% pilocarpine solution (3 mg/kg; Santen Pharmaceutical Co., Ltd., Osaka, Japan), a nonselective muscarinic receptor agonist of the parasympathetic nervous system. Tears were collected from the lateral canthus for 15 minutes using 5 μL of graded capillary microglass tubes (Hirschmann Laborgerate and GmbH & Co., Eberstadt, Germany), and graticule readings were recorded at the end of each measurement.

      Lacrimal Gland Carbachol–Stimulated Total Protein Secretion Measurements

      The nerves in the lacrimal gland provide the major stimuli for secretion of proteins, electrolytes, and water.
      • Botelho S.Y.
      • Hisada M.
      • Fuenmayor N.
      Functional innervation of the lacrimal gland in the cat: origin of secretomotor fibers in the lacrimal nerve.
      • Ruskell G.L.
      The distribution of autonomic post-ganglionic nerve fibres to the lacrimal gland in monkeys.
      • Walcott B.
      • Claros N.
      • Patel A.
      • Brink P.R.
      Age-related decrease in innervation density of the lacrimal gland in mouse models of Sjögren's syndrome.
      To test the total protein secretion from the lacrimal glands, we exposed lacrimal gland fragments to cholinergic agonists and measured the amount of protein secreted in response to carbachol, a drug that binds and activates the acetylcholine receptor. Mice lacrimal glands were weighed before being cut into small fragments of 1 to 2 mm with a scalpel blade. The fragments were washed in 5 mL of saline solution containing 116 mmol/L NaCl, 5.4 mmol/L KCl, 1.8 mmol/L CaCl2, 0.81 mmol/L MgCl2, 1.01 mmol/L NaH2PO4, 26.2 mmol/L NaHCO3, and 5.6 mmol/L dextrose (pH 7.4), maintained at 37°C and vigorously bubbled with 95% O2 and 5% CO2 in a beaker for 10 minutes. The solution was changed three times and discarded. The gland fragments were then incubated in 1 mL of saline for 10 minutes at 37°C, and the saline was removed and replaced with fresh medium. This cycle was repeated three times, and the saline was collected after each 10-minute incubation. The protein level measured in these samples represented the basal total protein secretion from the glands. After another 10 minutes of incubation, the medium was removed and saved, and the protein levels in these solutions represented the stimulated total protein secretion in response to carbachol. One gland was used in each experiment. The lacrimal gland samples were analyzed for total protein with a Coomassie protein assay kit (Pierce, Rockford, IL). Bovine serum albumin was used as the standard protein, and standards were run with each assay. Protein concentrations were determined from the standard curves measured with each assay. The assays were performed in a microplate reader (model EL 808; Bio-Tek Instruments, Winooski, VT) at 595 nm. Both samples and standards were read in duplicate in 96-well flat-bottomed microplates (Costar; Corning Inc., Corning, NY). Total protein concentration was determined with the software provided by the manufacturer (KC4 version 2.7; Bio-Tek Instruments). Stimulated protein secretion was calculated by subtracting the basal protein secretion levels from the post–carbachol-stimulated protein secretion levels. The readings from the plate reader were then converted to micrograms per milliliter per minute.

      Tear Fluid Collections

      A total of 10 μL of 0.1 mol/L PBS was introduced onto the ocular surface by a micropipette and then collected with a 10-μL glass capillary tube (Hirschmann Laborgerate and GmbH & Co) from the lateral canthus. This procedure was performed at 10 and 50 weeks in both Sod1−/− and WT mice. Collected tears were stored at −80°C until tear cytokine concentration assessments.

      Cytometric Bead Array for Assessment of Inflammatory Cytokines in Tears

      The Becton Dickinson Cytometric Bead Array system was used to investigate the sensitivity of amplified fluorescence detection by flow cytometry to measure soluble analyses in particle-based immunoassay. Each bead provides a capture surface for a specific protein and is analogous to an individual coated well in an enzyme-linked immunosorbent assay (ELISA) plate. The testing allows the detection of multiple analyses in a small-volume sample. We quantitatively measured IL-6, IL-10, monocyte chemoattractant protein-1 (MCP-1), interferon (IFN)-γ, tumor necrosis factor (TNF), and IL-12p70 protein levels in tears and serum samples using the mouse inflammation kit (BD Bioscience, Franklin Lakes, NJ).
      Blood was collected from the intracardiac space and centrifuged at 9100 × g for 5 minutes at 4°C. Serum was separated from the clotted blood and stored at −80°C. After reconstituting the mouse inflammation standards, the cytokine standard mixture (20 μL) and the tear and serum (20 μL) samples were diluted with 30 μL of the assay diluent. The standards and samples were added to a mixture of 50 μL of capture antibody-bead reagent and detector antibody-phosphatidylethanolamine phycoerythrin reagent. The mixture (150 μL) was subsequently incubated for 2 hours at room temperature and washed with 1 mL of wash buffer (from the kit) to remove unbound detector antibody-phycoerythrin reagent. After washing, the samples and standards were centrifuged at 200 × g for 5 minutes, and then the supernatants were carefully removed. The bead pellets were resuspended with 300 μL of wash buffer before data acquisition using flow cytometry.
      Flow cytometric analysis was performed using a FACSCalibur flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA). Data were acquired and analyzed using the Becton Dickinson Cytometric Bead Array software version 1.4 (BD Bioscience).
      • Dotti G.
      • Savoldo B.
      • Takahashi S.
      • Goltsova T.
      • Brown M.
      • Rill D.
      • Rooney C.
      • Brenner M.
      Adenovector-induced expression of human-CD40-ligand (hCD40L) by multiple myeloma cells: a model for immunotherapy.

      Lacrimal Gland Specimen Collections

      Animals were sacrificed at 10 and 50 weeks. The preauricular lacrimal glands were rapidly removed by trimming the glands from the surrounding tissues. Samples were divided and fixed in 4% buffered paraformaldehyde for stainings or stored in 2.5% glutaraldehyde in 0.1M phosphate for electron microscopy or were prepared for protein secretion analysis.

      Histopathologic Assessment of Lacrimal Gland Specimens

      All lacrimal gland specimens were immediately fixed in 4% buffered paraformaldehyde, embedded in paraffin wax, cut into 4-μm–thick paraffin sections, and processed according to conventional histological techniques, including H&E and Mallory stainings.
      • Anderson G.G.
      Tissue processing, microtomy and paraffin sections Theory and practice of histological techniques.
      • Hopwood J.
      Fixation and fixtative Theory and practice of histological techniques.

      Lacrimal Gland Acinar Unit and Secretory Vesicle Density Quantifications

      Five randomly selected nonoverlapping areas in each specimen in 890 × 705-μm frames were digitally photographed (Axioplan2imaging; Carl Zeiss, Jena, Germany). A total of five images from each Sod1−/− or WT mouse were taken with the photographer masked to the mouse genetic information. The acinar units and secretory vesicles were counted manually, and scores from the samples were averaged as the lacrimal acinar unit density for that lacrimal gland.

      Lacrimal Gland Inflammatory Cell Density Assessment

      Using an image capturing software (Adobe Photoshop Creative Suite version 8.0.1, San Jose, CA), a subset of color that indicated the stained areas (brown color) was selected from the raw pictures and analyzed using ImageJ version 1.410 (NIH, Bethesda, MD). The density of inflammatory cells in each picture was measured and expressed in pixels.
      • Crapo J.D.
      • Oury T.
      • Rabouille C.
      • Slot J.W.
      • Chang L.Y.
      Copper,zinc superoxide dismutase is primarily a cytosolic protein in human cells.

      IHC Staining for Oxidative Stress Markers and CD45 Panleukocyte Antigen

      Lipid peroxidation was assessed by immunohistochemical (IHC) detection of 4-hydroxy-2-nonenal (4-HNE). Oxidative DNA damage was investigated by IHC staining with anti–8-hydroxy-2′-deoxyguanosine (8-OHdG) antibodies. The avidin-biotin-peroxidase complex (ABC) method was used in immunostainings. Tissues were fixed overnight in a 4% buffered paraformaldehyde solution and processed for paraffin embedding. Sections 4 μm thick were cut from paraffin wax blocks, mounted on precoated glass slides, deparaffinized, and rehydrated. To block nonspecific background staining, lacrimal gland sections were treated with normal horse serum (Vector Laboratories, Burlingame, CA) for 2 hours at room temperature. The tissues were then treated with mouse anti–8-OHdG monoclonal antibody at a concentration of 10 μg/mL diluted with horse-blocking serum (Japan Institute for the Control of Aging, Shizuoka, Japan) and anti–4-HNE monoclonal antibody at a concentration of 25 μg/mL diluted with horse-blocking serum (Japan Institute for the Control of Aging) for 2 hours at room temperature. For the negative controls, the primary antibody was replaced with mouse IgG1 Isotype control (MOPC-21; Sigma, St. Louis, MO). Endogenous peroxidase activity was blocked using 3.0% H2O2 in methanol for 3 minutes. The sections were incubated for 30 minutes with biotin-labeled horse anti-mouse IgG serum (Vector Laboratories), followed by avidin-biotin-alkaline phosphatase complex treatment (Vector Laboratories) for 30 minutes. The sections were washed in PBS buffer, developed in 3,−3′-diaminobenzidine (DAB) chromogen solution (Vector Laboratories), lightly counterstained with hematoxylin for 4 minutes at room temperature, washed with tap water, dehydrated, and mounted. For CD45 IHC stainings, we used the purified anti-mouse CD45 antibody solution diluted with rabbit blocking serum at a concentration of 10 μg/mL (BioLegend, San Diego, CA) and the peroxidase system Vectastain ABC kit (rat IgG; Vector Laboratories). To block nonspecific background staining, lacrimal gland sections were treated with normal rabbit serum (Vector Laboratories) for 2 hours at room temperature. The tissues were then treated with 10 μg/mL of anti-mouse CD45 for 2 hours at room temperature. For the negative controls, the primary antibody was replaced with rat IgG2B isotype control at the same concentration of the primary antibody (R&D Systems, Minneapolis, MN). Endogenous peroxidase activity was blocked using 3.0% H2O2 in methanol for 3 minutes. The sections were incubated for 30 minutes with biotin-labeled rabbit anti-rat IgG serum (Vector Laboratories), followed by avidin-biotin-alkaline phosphatase complex treatment (Vector Laboratories) for 30 minutes. The sections were washed in 0.1M PBS, developed in prepared DAB chromogen solution (Vector Laboratories), lightly counterstained with hematoxylin for 4 minutes at room temperature, washed with tap water, dehydrated, and mounted.

      Fluorescent IHC Staining for EMT Markers and Inflammatory Cell Markers

      Epithelial mesenchymal transition (EMT) has been reported to play a crucial role in fibrosis of tissues.
      • Zeisberg E.M.
      • Tarnavski O.
      • Zeisberg M.
      • Dorfman A.L.
      • McMullen J.R.
      • Gustafsson E.
      • Chandraker A.
      • Yuan X.
      • Pu W.T.
      • Roberts A.B.
      • Neilson E.G.
      • Sayegh M.H.
      • Izumo S.
      • Kalluri R.
      Endothelial-to-mesenchymal transition contributes to cardiac fibrosis.
      • Zeisberg M.
      • Kalluri R.
      Fibroblasts emerge via epithelial-mesenchymal transition in chronic kidney fibrosis.
      To evaluate whether EMT is involved in the pathogenesis of fibrosis in aged SOD1−/− mice, mice lacrimal gland specimens were immunostained with epithelial cell marker (E-cadherin) and mesenchymal cell marker [α-smooth muscle actin (SMA)]. To evaluate the continuity of basement membrane in acinar units, type I collagen was immunostained. IHC for EMT markers was performed as described previously.
      • Kojima T.
      • Chang J.H.
      • Azar D.T.
      Proangiogenic role of ephrinB1/EphB1 in basic fibroblast growth factor-induced corneal angiogenesis.
      To differentiate the type of inflammatory cells in the lacrimal gland, specimens were immunostained with CD4, CD11b, and Gr-1 antibodies. Fluorescent IHC was performed as follows. Briefly, cryosections (6 μm) from mouse lacrimal gland were fixed in 4% paraformaldehyde for 20 minutes. After blocking with 1% bovine serum albumin PBS containing 2% donkey serum, sections were incubated overnight with primary antibodies. After washing with PBS, the sections were incubated for 30 minutes with secondary antibodies and observed using a fluorescence microscope (Carl Zeiss, Oberkochen, Germany). For negative control, isotype control IgG was applied instead of primary antibody. The specimens were immunostained with the following primary antibodies: rabbit anti–α-SMA antibody (0.01 mg/mL, ab5694; Abcam, Boston, MA), rat anti–E-cadherin antibody (0.01 mg/mL, ab11512; Abcam), rabbit antitype I collagen antibody (0.01 mg/mL, ab292; Abcam), rat anti-CD4 antibody (0.01 mg/mL, 14–0041; eBioscience, San Diego, CA), rat anti-CD11b (0.026 mg/mL, ab8878; Abcam), and rat anti–Gr-1 (0.01 mg/mL, ab25377; Abcam). The secondary antibodies were fluorescein isothiocyanate–conjugated anti-rabbit IgG antibody (0.0075 mg/mL; Jackson Immunoresearch Laboratories, West Grove, PA) and fluorescein isothiocyanate–conjugated anti-rat IgG antibody (0.0075 mg/mL; Jackson Immunoresearch Laboratories). DAPI (Vector Laboratories) was used for nuclear staining.

      Immunofluorescence Staining for Apoptosis Markers

      Terminal deoxyribonucleotidyl transferase–mediated deoxyuridine triphosphate digoxigenin nick end labeling (TUNEL) staining was performed using the in situ Cell Death Detection Kit, TMR Red (Roche Applied Science, Mannheim, Germany). Initially, 10 μg/mL of proteinase K (Roche Applied Science) in 10 mmol/L Tris/HCl (pH 7.4) was applied to the lacrimal gland specimens and left for 15 minutes at room temperature. After washing the samples with 0.1M PBS twice, TUNEL reaction mixture (Roche Applied Science) was added to the samples and the label solution on the negative control sample, which were then incubated at 37°C for 60 minutes in a dark room. The specimens were rinsed in 1M PBS for 5 minutes three times, and then 100 μL of 0.5 μg/mL of DAPI diluted in Tris-buffered saline and Tween-20 was added on samples for 5 minutes at room temperature. Finally, the specimens were washed with 1M PBS and mounted with aqueous mounting medium Permafluor (Beckman Coulter, Marseille, France). Caspase-3 immunofluorescent staining was performed using the Alexa Fluor 488 Goat Anti-Rabbit SFX Kit (Molecular Probes, Eugene, OR). The samples were initially blocked with four drops of Image-iT FX signal enhancer (Molecular Probes) for 30 minutes and then with 10% normal goat serum (Dako, Tokyo, Japan) diluted in Block-Ace solution (dilution factor 1:25 in 0.1M PBS) for 2 hours. Primary cleaved caspase-3 antibody (dilution factor 1:200; Cell Signaling, Danvers, MA) was added on the specimens, which were kept refrigerated overnight at 4°C. Subsequently, after wash with 0.1M PBS, the secondary antibody anti-IgG Alexa 488 (dilution 1:200; Molecular Probes) was applied for 45 minutes in a dark incubation chamber. After wash with 0.1M PBS, specimens were coverslipped with fluorescent mounting medium with DAPI (Vectashield; Vector Laboratories). Sections were examined and photographed with an epifluorescence microscope (Axioplan2imaging; Carl Zeiss).

      Transmission Electron Microscopy Examination

      Lacrimal gland specimens were immediately fixed with 2.5% glutaraldehyde in 0.1M PBS (pH 7.4) immersed for 4 hours at 4°C, and then washed three times with 0.1M PBS solution. The samples were then postfixed in 2% osmium tetroxide, dehydrated in a series of ethanol and propylene oxide, and embedded in epoxy resin. One-micrometer sections were stained with methylene blue, and the lacrimal gland tissues were thin sectioned on an Ultratome (LKB, Gaithersburg, MD) with a diamond knife. Sections were collected on 150-mesh grids, stained with uranyl acetate and lead citrate, examined, and photographed using an electron microscope (model 1200 EXII; JEOL, Tokyo, Japan).

      Serum 8-OHdG Concentrations Assessed by ELISA

      A commercially available 8-OHdG ELISA kit (Japan Institute for the Control of Aging) was used to determine the serum 8-OHdG concentration, as reported previously.
      • Shiihara T.
      • Kato M.
      • Ichiyama T.
      • Takahashi Y.
      • Tanuma N.
      • Miyata R.
      • Hayasaka K.
      Acute encephalopathy with refractory status epilepticus: bilateral mesial temporal and claustral lesions, associated with a peripheral marker of oxidative DNA damage.
      A total of 200 μL of serum was used for 8-OHDG measurements.

      Lacrimal Gland IHC Staining for Oxidative Stress and Inflammatory Cell Markers in Humans

      Postmortem human lacrimal gland tissues from 6 individuals 17 to 48 years old (the young group) and 6 individuals 76 to 87 years old (the old group) were donated by Dr. Hiroto Obata. The samples were studied under institutional review board permission at Keio University School of Medicine. All lacrimal gland specimens were immediately fixed in 4% buffered paraformaldehyde, embedded in paraffin wax, cut into 4-μm–thick paraffin sections, and processed according to conventional histologic techniques, including H&E and Mallory staining fibrosis. Oxidative stress–induced lipid peroxidation was assessed by IHC detection of 4-HNE protein adducts. Oxidative DNA damage was investigated by IHC staining of 8-OHdG. The presence of inflammatory cells was investigated by IHC using anti-CD45 antibodies (concentration: 0.01 mg/mL; Dako, Glostrup, Denmark). The ABC method was used for immunostaining. Antigen retrieval was achieved by microwaving in 10 mmol/L sodium citrate buffer for 5 minutes then cooling for 20 minutes. The tissues were then treated with mouse anti–8-OHdG monoclonal antibody at a concentration of 10 μg/mL diluted with horse-blocking serum (Japan Institute for the Control of Aging) and anti–4-HNE monoclonal antibody at a concentration of 25 μg/mL diluted with horse-blocking serum (Japan Institute for the Control of Aging) for 2 hours at room temperature. For the negative controls, the primary antibody was replaced with mouse IgG1 isotype control (MOPC-21; Sigma). Endogenous peroxidase activity was blocked using 3.0% H2O2 in methanol for 3 minutes. The sections were incubated for 30 minutes with biotin-labeled horse anti-mouse IgG serum (Vector Laboratories), followed by avidin-biotin-alkaline phosphatase complex treatment (Vector Laboratories) for 30 minutes. The sections were washed in PBS buffer, developed in prepared DAB chromogen solution (Vector Laboratories), lightly counterstained with hematoxylin for 4 minutes at room temperature (4-HNE stainings), washed with tap water, dehydrated, and mounted.

      Quantitative RT-PCR for EMT Markers

      Mouse lacrimal glands were preserved overnight in RNA later (Applied Biosystems, Carlsbad, CA) after prompt excision. Tissues were then transferred into isogen (Nippon Gene, Tokyo, Japan) and homogenized well. Total RNA was extracted, cleaned up, and treated with DNase using RNeasy mini kit (Qiagen, Valencia, CA). cDNA synthesis was performed using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). SYBR Green–based quantitative real-time PCR was performed using StepOnePlus system (Applied Biosystems). Mouse glyceraldehyde-3-phosphate (GAPDH) (sense 5′-TGACGTGCCGCCTGGAGAAA-3′, antisense, -3′AGTGTAGCCCAAGATGCCCTTCAG5′-), Snail (sense 5′-TGGAAAGGCCTTCTCTAGGC-3′, antisense, -3′CTTCACATCCGAGTGGGTTT5′-), E-cadherin (sense 5′-GGCTTCAGTTCCGAGGTCTA-3′, antisense, -3′CGAAAAGAAGGCTGTCCTTG5′-), α-SMA (sense 5′-CTGACAGAGGCACCACTGAA-3′, antisense, -3′AGAGGCATAGAGGGACAGCA5′-) primers were used as templates for GAPDH, Snail, E-cadherin, and α-SMA amplification. Data were normalized to GAPDH.

      Results

      Lack of SOD1 Accelerates Oxidative Lipid and DNA Damage in the Lacrimal Glands and Causes Elevation of Serum 8-OHdG Levels

      Aldehyde molecules generated endogenously during the process of lipid peroxidation have been reported to be associated with oxidative stress in cells and tissues.
      • Dalle-Donne I.
      • Rossi R.
      • Colombo R.
      • Giustarini D.
      • Milzani A.
      Biomarkers of oxidative damage in human disease.
      4-HNE is one of the best recognized and most studied cytotoxic product of lipid peroxidation.
      • Dalle-Donne I.
      • Rossi R.
      • Colombo R.
      • Giustarini D.
      • Milzani A.
      Biomarkers of oxidative damage in human disease.
      To evaluate the influence of the Sod1 knockout on the lipid peroxidation process, we initially performed lacrimal gland IHC stainings with anti–4-HNE antibodies (Figure 1A). Specimens from 50-week-old Sod1−/− mice exclusively showed dense staining compared with the specimens from the WT mice at 10 and 50 weeks and Sod1−/− mice at 10 weeks (Figure 1A). The mean areas (pixels
      • Crapo J.D.
      • Oury T.
      • Rabouille C.
      • Slot J.W.
      • Chang L.Y.
      Copper,zinc superoxide dismutase is primarily a cytosolic protein in human cells.
      ) of positively stained cells were 11.98 ± 4.26 for WT mice at 10 weeks, 12.29 ± 4.64 for Sod1−/− mice at 10 weeks, 27.23 ± 12.37 for WT mice at 50 weeks, and 87.43 ± 30.37 for Sod1−/− mice at 50 weeks. The extent of lacrimal gland staining with 4-HNE antibodies showed a significant increase (P < 0.0001) in both Sod1−/− and WT mice from 10 weeks to 50 weeks as shown in Figure 1C. The extent of staining with 4-HNE antibodies in the Sod1−/− mice at 50 weeks was significantly higher (P < 0.0001) than the WT mice at 50 weeks (Figure 1C).
      Figure thumbnail gr1
      Figure 1Oxidative lipid and DNA changes in the lacrimal glands and alterations in serum 8-OHdG levels. A: Late-phase lipid peroxidation marker 4-HNE stained cells positively, showing a dense staining in the 50-week-old Sod1−/− mouse. WT mice specimens were also stained but not to the extent observed in Sod1−/− mice. B: Acinar cell nuclei showed scanty staining with 8-OHdG antibodies in the Sod1−/− and WT mice at 10 weeks. There was a marked increase in nuclear staining from 10 to 50 weeks, exclusively in all Sod1−/− mice. Relatively more acinar cellular nuclei stained with anti–8-OHdG antibodies in the Sod1−/− mice at 50 weeks compared with lacrimal gland specimens from WT mice at 50 weeks. C: Semiquantitative analysis of the extent of cellular staining for 4-HNE revealed a statistically significance increase in the 50-week-old mice group compared with the 10-week-old group and a significant elevation in staining for the Sod1−/− mice group compared with the WT mice at 50 weeks (P < 0.0001). Error bars indicate SD from at least five independent samples. D: The mean 8-OHdG serum concentrations were significantly higher in the Sod1−/− than the WT mice at 10 (P < 0.05) and 50 weeks (P = 0.008). Note the significant elevation of serum 8-OHdG concentration from 10 to 50 weeks in the Sod1−/− mice. Error bars indicate SD from at least five independent samples per group of two separate experiments.
      8-OHdG is a well-known marker for oxidative stress–induced DNA damage.
      • Dalle-Donne I.
      • Rossi R.
      • Colombo R.
      • Giustarini D.
      • Milzani A.
      Biomarkers of oxidative damage in human disease.
      To assess the cellular DNA damage, we next performed IHC with anti–8-OHdG antibodies. Acinar cell nuclei showed scanty staining with 8-OHdG antibodies in the Sod1−/− and WT mice at 10 weeks. There was a marked increase in nuclear staining from 10 to 50 weeks in all Sod1−/− mice. Relatively more acinar cellular nuclei stained with anti–8-OHdG antibodies in the Sod1−/− mice at 50 weeks compared with lacrimal gland specimens from WT mice at 50 weeks (Figure 1B). Serum 8-OHdG assessment has been shown to be a reliable marker for elevated systemic oxidative stress status.
      • Dalle-Donne I.
      • Rossi R.
      • Colombo R.
      • Giustarini D.
      • Milzani A.
      Biomarkers of oxidative damage in human disease.
      To investigate this possibility, we performed ELISA to determine serum 8-OHdG concentrations in the Sod1−/− and WT mice at both 10 and 50 weeks. The mean 8-OHdG concentrations were significantly higher in the Sod1−/− than the WT mice at 10 (P < 0.05) and 50 weeks (P = 0.008).
      A significant timewise increase was seen in the mean serum 8-OHdG concentration in the Sod1−/− mice from 10 to 50 weeks. The mean values for serum 8-OHdG concentrations were 0.12 ± 0.01 ng/mL for WT mice at 10 weeks, 0.15 ± 0.02 ng/mL for Sod1−/− mice at 10 weeks, 0.12 ± 0.01 ng/mL for WT mice at 50 weeks, and 0.27 ± 0.03 ng/mL for Sod1−/− mice at 50 weeks (Figure 1D).

      Oxidative Lipid and DNA Damage Is Associated with Ultrastructural Mitochondrial Alterations

      At organelle level, we could observe, by transmission electron microscopy examination, certain ultrastructural changes in the mitochondria, which are the power houses of the living cells.
      • Wallace D.C.
      • Fan W.
      Energetics, epigenetics, mitochondrial genetics.
      Whereas the mitochondria did not show any phenotypic alterations from 10 to 50 weeks in the WT or the Sod1−/− mice at 10 weeks, mitochondrial swelling, disorientation, shortening, and disorganization of cristae were noted prominently at 50 weeks in 88.2% of the Sod1−/− mice (Figure 2).
      Figure thumbnail gr2
      Figure 2Ultrastructural mitochondrial alterations. Transmission electron microscopic examination of WT and Sod1−/− mice at 10 and 50 weeks revealed marked ultrastructural changes in the mitochondria. Whereas the mitochondria did not show any phenotypic alterations from 10 to 50 weeks in the WT mice, mitochondrial swelling, disorientation, shortening, and disorganization of cristae were noted at 50 weeks in the Sod1−/− mice.

      Sod1 Knockout Is Also Associated with Increased Inflammatory Response in the Lacrimal Gland and Elevation of Inflammatory Cytokines in Tears and Serum

      Oxidative damage has been reported to be associated with induction of inflammation.
      • Hensley K.
      • Robinson K.A.
      • Gabbita S.P.
      • Salsman S.
      • Floyd R.A.
      Reactive oxygen species, cell signaling, and cell injury.
      • Halliday G.M.
      Inflammation, gene mutation and photoimmunosuppression in response to UVR-induced oxidative damage contributes to photocarcinogenesis.
      • Dahl M.
      • Bauer A.K.
      • Arredouani M.
      • Soininen R.
      • Tryggvason K.
      • Kleeberger S.R.
      • Kobzik L.
      Protection against inhaled oxidants through scavenging of oxidized lipids by macrophage receptors MARCO and SR-AI/II.
      To check whether the aforementioned oxidative stress changes were associated with increased lacrimal gland inflammation, we performed IHC stainings with CD45 antibodies. CD45 is a panleukocyte marker and has been shown to be a good marker for staining of T lymphocytes, B lymphocytes, granulocytes, monocytes, and macrophages.
      • Pulido R.
      • Cebrian M.
      • Acevedo A.
      • de Landazuri M.O.
      • Sanchez-Madrid F.
      Comparative biochemical and tissue distribution study of four distinct CD45 antigen specificities.
      Whereas specimens from the 10-week-old Sod1−/− and WT mice showed scanty staining of inflammatory cells with anti-CD45 antibodies, there was intense staining in all specimens from the Sod1−/− mice at 50 weeks, where inflammatory cell infiltrates around glandular ducts and several foci of inflammation could be observed. Relatively more inflammatory infiltrates were observed in specimens from the 50-week-old Sod1−/− mice compared with the WT mice (Figure 3A). To differentiate the type of inflammatory cells in the 50-week-old Sod1−/− mice, we performed further IHC stainings with CD4, CD11b, and Gr-1 antibodies. CD4 is a marker of helper T cells, whereas CD11b and Gr-1 are markers for neutrophils and monocytes, respectively.
      Figure thumbnail gr3
      Figure 3Inflammatory lacrimal gland, serum, and tear alterations in the Sod1−/− and WT mice. A: Specimens stained with CD45 in the 10-week-old Sod1−/− and WT mice showed scanty inflammatory cells. Note the relatively more intense staining in the specimen from the Sod1−/− mice at 50 weeks compared with the WT mice. The mean inflammatory cell densities showed a significant timewise increase from 10 weeks to 50 weeks in both the Sod1−/− and WT mice (P < 0.0001 and P = 0.0031, respectively). Note the significantly higher inflammatory cell density in the Sod1−/− mice at 50 weeks compared with the WT mice (P < 0.05). B: Specimens from the 50-week-old Sod1−/− mice were stained with anti-CD4, CD11b, and Gr-1 antibodies. Note the CD4-positive cells were dominant among inflammatory cells. The CD4-positive cell density (lower panel) was significantly higher than either the CD11b- or Gr-1–positive cell density. C: The mean serum IL-6 concentration in the Sod1−/− mice showed a significant (P = 0.009) timewise increase from 10 to 50 weeks. Serum TNF-α levels were also significantly higher (P = 0.009) in the Sod1−/− mice at 50 weeks compared with the WT mice at 50 weeks. A significant (P = 0.016) timewise increase was seen in the mean TNF-α serum concentration from 10 to 50 weeks in the Sod1−/− mice. D: The mean tear IL-6 concentration also showed a significant increase in the Sod1−/− mice from 10 to 50 weeks (P = 0.002). Note the significantly higher IL-6 concentration (P = 0.028) in the Sod1−/− mice at 50 weeks compared with the WT mice at 50 weeks. The mean tear TNF-α concentrations increased significantly from 10 to 50 weeks in both the Sod1−/− and the WT mice. Note also the significantly higher TNF-α concentration in the Sod1−/− mice compared with the WT mice at 50 weeks (P < 0.05). Error bars indicate SD from at least five independent samples per group of three separate experiments. *P < 0.05.
      Using the ImageJ and Adobe Photoshop computer software, we quantified the total inflammatory cell counts in each specimen. The mean CD45+ inflammatory cell density showed a significant timewise increase from 10 to 50 weeks in both the Sod1−/− and WT mice (P < 0.0001 and P = 0.0031, respectively). The mean inflammatory cell density was significantly higher in the Sod1−/− mice at 50 weeks compared with the WT mice (P < 0.05) (Figure 3B). The mean CD4-, CD11b-, and Gr-1–positive inflammatory cell densities were significantly higher in the Sod1−/− mice compared with the WT mice at 50 weeks. The mean CD4-positive cell density was significantly higher than the density of other inflammatory cells in the Sod1−/− mice at 50 weeks (Figure 3B).
      To investigate the inflammatory cytokine alterations in the serum and tears, we performed Cytometric Bead Array evaluating the changes in six cytokines, including IL-6, IL-10, IFN-γ, TNF-α, MCP-1, and IL-12p70. Among them, the mean serum IL-6 concentration in the Sod1−/− mice showed a significant (P = 0.009) timewise increase from 10 to 50 weeks (9.96 ± 12.95 pg/mL to 33.62 ± 14.98 pg/mL). The mean serum TNF-α levels were also significantly higher (P = 0.009) in the Sod1−/− mice (10.89 ± 3.23 pg/mL) compared with the WT mice at 50 weeks (5.6 ± 3.73 pg/mL). There was a significant (P = 0.016) timewise increase in the mean TNF-α serum concentration from 10 (5.13 ± 6.39 pg/mL) to 50 (10.89 ± 3.23 pg/mL) weeks in the Sod1−/− mice (Figure 3C).
      The mean tear IL-6 concentration also showed a significant increase in the Sod1−/− mice from 10 to 50 weeks (P = 0.002). The IL-6 concentration was significantly higher (P = 0.028) in the Sod1−/− at 50 weeks (36.88 ± 29.23 pg/mL) compared with the WT mice at 50 weeks (14.08 ± 11.65 pg/mL). The mean tear TNF-α concentration increased significantly from 10 to 50 weeks in both the Sod1−/− (9.96 ± 12.95 pg/mL and 33.62 ± 14.98 pg/mL, respectively) and the WT mice (6.82 ± 10.38 pg/mL and 46.11 ± 17.86 pg/mL, respectively). The mean tear TNF-α concentration was significantly higher in the Sod1−/− mice compared with the WT mice at 50 weeks (P < 0.05) (Figure 3D).
      The mean tear IL-10, IFN-γ, MCP-1, and IL-12p70 levels did not show significant differences from 10 to 50 weeks in both the Sod1−/− and WT mice. There were also no significant differences in the mean IL-10, IFN-γ, MCP-1, and IL-12p70 concentrations between the WT and the Sod1−/− mice at 50 weeks (data not shown).

      IHC and Ultrastructural Evidence of Increased Apoptosis in the Lacrimal Glands

      Inflammation in the lacrimal gland has previously been shown to be associated with apoptosis in acinar cells of the lacrimal glands in dry eyes associated with Sjögren syndrome.
      • Tsubota K.
      • Fujita H.
      • Tadano K.
      • Onoda N.
      • Tsuzaka K.
      • Takeuchi T.
      Abnormal expression and function of Fas ligand of lacrimal glands and peripheral blood in Sjögren's syndrome patients with enlarged exocrine glands.
      • Tsubota K.
      • Fujita H.
      • Tsuzaka K.
      • Takeuchi T.
      Quantitative analysis of lacrimal gland function, apoptotic figures: Fas and Fas ligand expression of lacrimal glands in dry eye patients.
      To investigate whether elevated oxidative damage and inflammation status were associated with increased cell death in the lacrimal glands of the current mouse model, we performed immunofluorescence staining with TUNEL and caspase-3 antibodies. TUNEL assay has been used to detect the DNA breakpoints and assess apoptotic cells.
      • Wyllie A.H.
      Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation.
      Lacrimal gland samples from all Sod1−/− mice at 50 weeks showed marked positive staining with TUNEL for apoptotic cells (572.21 cells/mm2) compared with specimens from Sod1−/− mice at 10 weeks (110.05 cells/mm2) and WT mice at 50 weeks (247.21 cells/mm2). Increased positive staining was also observed for the WT mice lacrimal gland specimens from 10 weeks (27.11 cells/mm2) to 50 weeks (247.21 cells/mm2) (Figure 4A). We also performed cleaved caspase-3 staining by immunofluorescence. Caspase-3 has been regarded to be an important mediator of apoptosis.
      • Nicholson D.W.
      • Ali A.
      • Thornberry N.A.
      • Vaillancourt J.P.
      • Ding C.K.
      • Gallant M.
      • Gareau Y.
      • Griffin P.R.
      • Labelle M.
      • Lazebnik Y.A.
      • et al.
      Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis.
      Specimens from the Sod1−/− mice at 50 weeks displayed relatively more positive staining (178.63 cells/mm2) with caspase-3 antibodies for apoptotic cells compared with specimens from Sod1−/− mice at 10 weeks (65.39 cells/mm2) and WT mice at 50 weeks (116.43 cells/mm2) (Figure 4B). We also sought for evidence of apoptosis in acinar epithelial cells by transmission electron microscopy. A total of 88.2% of the specimens from the Sod1−/− mice at 50 weeks displayed marked fragmentation and shrinkage of the nuclei, cytoplasmic vacuole formation, and loss of nuclear membranes (Figure 4C). Such changes were not observed in specimens of WT mice at 10 and 50 weeks and Sod1−/− mice at 10 weeks (data not shown).
      Figure thumbnail gr4
      Figure 4IHC and ultrastructural evidence of apoptosis in the lacrimal glands. A: Lacrimal gland samples from all Sod1−/− mice at 50 weeks showed marked positive staining with TUNEL for apoptotic cells (572.21 cells/mm2) compared with specimens from Sod1−/− mice at 10 weeks (110.05 cells/mm2) and WT mice at 50 weeks (247.21 cells/mm2). Increased positive staining was also observed for the WT mice lacrimal gland specimens from 10 weeks (27.11 cells/mm2) to 50 weeks (247.21 cells/mm2). B: Specimens from the Sod1−/− mice at 50 weeks displayed relatively more positive staining (178.63 cells/mm2) with caspase-3 antibodies for apoptotic cells compared with specimens from Sod1−/− mice at 10 weeks (65.39 cells/mm2) and WT at 50 weeks (116.43 cells/mm2). C: Note the evidence for apoptosis (A; arrows) in acinar epithelial cells by transmission electron microscopy. Specimens from the Sod1−/− mice at 50 weeks exclusively and prominently displayed fragmentation and shrinkage of the nuclei, cytoplasmic vacuole formation, and loss of nuclear membranes. The areas indicated by circles and ellipses correspond to the lacrimal gland acinar ducts (D). Images are representatives of at least five independent samples per group.

      Lacrimal Gland Fibrosis and Related Morphologic Alterations in the Sod1−/− and WT Mice

      As shown in Figure 5A, lacrimal glands removed from the 10-week-old WT and Sod1−/− mice showed normal ductal and acinar cell morphologic features and lobular architecture separated by interlobular connective tissue. At 50 weeks, lacrimal glands in the Sod1−/− mice exclusively developed a severe inflammatory response with inflammatory cells invading the interlobular spaces surrounding both acinar and ductal cells. Lobular atrophy due to atrophy of the acinar cells, interlobular and periductal fibrosis, and interlobular duct dilatation were observed. Slight periductal and interlobular fibrosis together with a few inflammatory cells were also noted in the WT mice lacrimal gland specimens. To further describe the extent of fibrosis, Mallory staining was performed, which stains areas of fibrosis with a dark blue color.
      • Anderson G.G.
      Tissue processing, microtomy and paraffin sections Theory and practice of histological techniques.
      • Hopwood J.
      Fixation and fixtative Theory and practice of histological techniques.
      Almost no interlobular fibrosis was observed in both Sod1−/− and WT mice at 10 weeks. Extensive interlobular and periacinar Mallory staining was observed in the lacrimal gland specimens of all Sod1−/− mice at 50 weeks, with some slight interlobular positive staining observed in the age-matched WT mice (Figure 5B).
      Figure thumbnail gr5
      Figure 5Evidence of further morphologic alterations in the Sod1−/− and WT mice lacrimal glands. A: Lacrimal glands from the 10-week-old WT and Sod1−/− mice showed normal ductal and acinar cell morphologic features. At 50 weeks, lacrimal glands in the Sod1−/− mice exclusively developed a severe inflammatory response, with inflammatory cells invading the interlobular spaces surrounding both the acinar and ductal cells. Lobular atrophy due to atrophy of the acinar cells, interlobular and periductal fibrosis, and interlobular duct dilatations were observed. Slight periductal and interlobular fibrosis together with a few inflammatory cells were also noted in the WT mice lacrimal gland specimens. B: Extensive interlobular and periacinar fibrosis was observed in the lacrimal gland specimens of all Sod1−/− mice at 50 weeks, with some slight interlobular positive staining in the age-matched WT mice. Images in A and B are representatives of at least five independent samples per group. C: No statistically significant differences were found between the mean acinar unit densities of the Sod1−/− and WT mice at 10 weeks. There was a timewise decrease in the mean acinar unit densities from 10 weeks to 50 weeks in both Sod1−/− and WT mice (P < 0.0001). The mean acinar unit density in the lacrimal gland specimens of the Sod1−/− mice at 50 weeks was significant lower then the acinar unit density in the WT mice at 50 weeks (*P < 0.001, Mann-Whitney test). Data in C represents the mean and SD of combined data from seven mice per group and are representative of three separate experiments.
      To quantify the lacrimal gland acinar unit densities, we counted the number of acinar units within a fixed area for all samples. We observed that there were no statistically significant differences between the mean acinar unit densities of Sod1−/− (780.89 ± 150.05 units/μm2) and WT (794.39 ± 78.75 units/μm2) mice at 10 weeks. There was a decrease in the mean acinar unit densities from 10 weeks to 50 weeks in both Sod1−/− and WT mice (Figure 5C). The mean acinar unit density in the lacrimal gland specimens of the Sod1−/− mice at 50 weeks (379.72 ± 92.78 units/μm2) was significant lower than the acinar unit density in the WT mice at 50 weeks (514.58 ± 47.43 units/μm2) (P < 0.001).

      Evaluation of EMT in Lacrimal Glands of Sod1−/− and WT Mice

      To further study the processes involved in lacrimal gland fibrosis, we decided to investigate the presence of EMT in the lacrimal gland. Lacrimal gland specimens were immunostained with epithelial and mesenchymal markers, namely, E-cadherin and α-SMA. Type I collagen was expressed in basement membranes of acinar cells in both Sod1−/− and WT mice (Figure 6, A–D). In eyes of 50-week-old Sod1−/− mice, disruption of basement membrane was observed (Figure 6D). α-SMA immunostaining was observed in the periacinar areas of the epithelial cells in all specimens (Figure 6, E–H). The number of α-SMA–positive cells was significantly higher in the 50-week-old Sod1−/− mice compared with the WT mice. On the other hand, positive E-cadherin staining was observed in the intercellular junctions between adjacent lacrimal gland acinar cells (Figure 6, I–L), and expression was lower in the 50-week-old Sod1−/− mice compared with the WT mice (Figure 6L). To further quantify the mRNA expression levels of EMT-related markers, SYBR Green–based quantitative real-time PCR was performed. The expression of Snail, which is an inducer of EMT, was significantly higher in the 50-week-old Sod1−/− mice than in 50-week-old WT and 10-week-old Sod1−/− mice (Figure 6M). The expression of α-SMA, which is a mesenchymal cell marker, was significantly higher in the 50-week-old Sod1−/− mice than in 50-week-old WT mice (Figure 6N). The expression of E-cadherin, which is an epithelial cell marker, was significantly lower in the 50-week-old Sod1−/− mice than the 50-week-old WT mice, the 10-week-old Sod1−/− mice, and the 10-week-old WT mice (Figure 6O). The expression level of the α-SMA/E-cadherin ratio was significantly higher in the 50-week-old Sod1−/− mice than the 50-week-old WT mice, 10-week-old Sod1−/− mice, and 10-week-old WT mice (Figure 6P).
      Figure thumbnail gr6
      Figure 6IHC and quantitative transcript evaluation of EMT in the lacrimal gland of WT and Sod1−/− mice. IHC using anti–collagen type I antibody (A–D) revealed disruption of basement membrane in 50-week-old Sod1−/− mice (D). Arrowhead showed the location of basement membrane disruption (D). IHC staining of α-SMA (E–H) in 50-week-old Sod1−/− mice (H) increased compared with 50-week-old WT mice (F). On the other hand, IHC staining of E-cadherin (I–L) in 50-week-old Sod1−/− mice (L) decreased compared with 50-week-old WT mice (J). M: Quantitative real-time PCR revealed that Snail expression in 50-week-old Sod−/− mice was higher than 50-week-old WT mice and 10-week-old Sod1−/− mice. N: α-SMA expression in 50-week-old Sod1−/− mice was higher than 50-week-old WT mice. O: E-cadherin expression in 50-week-old Sod−/− mice was lower than in 50-week-old WT mice, 10-week-old WT mice, and 10-week-old Sod1−/− mice. P: The α-SMA/E-cadherin ratio in 50-week-old Sod−/− mice was higher than in 50-week-old WT mice, 10-week-old Sod1−/− mice, and 10-week-old WT mice. *P < 0.05.

      Ultrastructural Evidence for EMT in the Lacrimal Glands

      Electron microscopy observation of lacrimal gland in the 50-week-old Sod1−/− mice revealed loss of polarity of acinar epithelial cells, which is feature of EMT (Figure 7). Higher magnification of electron microscopy also revealed the presence of secretory vesicles and microvilli toward the interstitial area with evidence of increased collagen lay-down (Figure 7).
      Figure thumbnail gr7
      Figure 7Electron microscopy of lacrimal gland in 50-week-old Sod1−/− mice. Note the loss of polarity of the acinar epithelial cell (star) with the microvilli (arrowhead) and secretary vesicles facing the mesenchymal area, which has abundant collagen fibers (arrow). Right panel is an enlargement of the boxed region of the left panel.

      Lacrimal Gland Secretory Functions Decrease Overtime in the Sod1−/− Mice, Leading to Ocular Surface Disease

      We measured aqueous tear production with the cotton thread test and divided the values by the respective mouse weights at 10 and 50 weeks. Weight-adjusted aqueous tear production measurements were significantly lower in the Sod1−/− (n = 17) mice compared with the age- and sex-matched WT (n = 14) mice at 10 weeks and 50 weeks (10-week-old Sod1−/− mice: 0.094 ± 0.077 μL/g; 50-week-old Sod1−/− mice: 0.050 ± 0.035 μL/g; 10-week-old WT mice: 0.175 ± 0.112 μL/g; and 50-week-old WT mice: 0.168 ± 0.089 μl/g) as shown in Figure 8A. A significant decrease of tear production from 10 to 50 weeks was also observed in the Sod1−/− mice (P = 0.026) (Figure 8A). On stimulation with pilocarpine, the tear secretion tended to decrease from 10 to 50 weeks in the Sod1−/− mice with a tendency to increase in the WT mice without statistical significance. However, pilocarpine-stimulated tear secretion was significantly lower (P = 0.0364) in the Sod1−/− mice at 50 weeks (0.034 ± 0.009 μL/g) compared with the WT mice (0.079 ± 0.010 μL/g) (Figure 8B). Not only the aqueous tear but also the total protein secretion measured at 50 weeks was significantly less in the Sod1−/− mice (0.920 ± 0.968 μg/mL/g/min) compared with the WT mice (3. 433 ± 2.467 μg/mL/g/min) (P = 0.024) (Figure 8C). Cotton thread test measurements revealed mean tear quantity values of 0.083 ± 0.067 mm/g and 0.124 ± 0.065 mm/g in the Sod1−/− mice and WT mice, respectively. We also found that 87.5% of the Sod1−/− mice and 5.9% of the WT mice at 50 weeks were below the cutoff value. In addition, 5.4% of the SOD1 knockout mice and 2.7% of the WT mice at 10 weeks had dry eye disease (data not shown).
      Figure thumbnail gr8
      Figure 8Changes in lacrimal gland secretory functions and corneal epithelial damage over time in the Sod1−/− and WT mice. A: Weight-adjusted aqueous tear production measurements were significantly lower in the Sod1−/− mice compared with the WT mice at 10 weeks and 50 weeks. A significant timewise decrease of tear production from 10 to 50 weeks was also observed in the Sod1−/− mice (P = 0.026). B: There is significantly lower tear production with pilocarpine stimulation in the Sod1−/− mice at 50 weeks. C: At 50 weeks the amount of protein produced, after carbachol stimulation, by the Sod1−/− mouse group was lower compared with the WT group. D: There is marked timewise accumulation of secretory vesicles in the lacrimal glands of the Sod1−/− mice. E: There is significant accumulation of secretory vesicles in the acinar epithelial cells from 10 weeks to 50 weeks in the Sod1−/− mice (P = 0.030). The number of secretory vesicles did not change significantly in the WT mice from 10 weeks to 50 weeks (P = 0.076). The differences in the number of secretory vesicles/area between the Sod1−/− and WT mice at 10 weeks were statistically significant (P = 0.006); the mean number of secretory vesicles was considerably higher in the Sod1−/− mice at 50 weeks than the WT mice at 50 weeks (P = 0.003). F: Changes in corneal epithelial damage scores assessed by fluorescein staining in the Sod1−/− and WT mice. A statistically significant timewise increase in the fluorescein staining score was observed in the Sod1−/− mice. Note the significantly higher scores in the Sod1−/− mice compared with WT mice at 50 weeks. G: Representative photomicrographs of fluorescein staining test in the 50-week-old mice. Note the extensive corneal epithelial damage in the Sod1−/− mouse compared with the WT mouse at 50 weeks. Error bars indicate SD from at least five independent samples per group of three separate experiments.
      We observed, by transmission electron microscopy examination, that the secretory vesicles in the lacrimal gland acinar cells appeared as gray-black, electron-dense, round-oval bodies. We noted a relative accumulation of secretory vesicles in the acinar epithelia in Sod1−/− mice from 10 to 50 weeks (Figure 8D). After quantifying the density of secretory vesicles, we noted a significant accumulation of secretory vesicles in the acinar epithelial cells from 10 weeks (558.14 ± 90.04 vesicles per frame) to 50 weeks (709.80 ± 91.25 vesicles per frame) in the Sod1−/− mice (P = 0.03). The number of secretory vesicles did not change significantly in the WT mice from 10 weeks (284 ± 90.82 vesicles per frame) to 50 weeks (460.60 ± 125.46 vesicles per frame) as shown in Figure 8E (P = 0.076). The differences in the number of secretory vesicles per area between the Sod1−/− mice and the WT mice at 10 weeks were statistically significant (P = 0.006). The mean number of secretory vesicles was also significantly higher in the Sod1−/− mice at 50 weeks than the WT mice at 50 weeks (P = 0.003) (Figure 8E).
      Decreased tear output has been shown to be associated with establishment of a dry eye ocular surface milieu, leading to ocular surface epithelial damage.
      • Pflugfelder S.C.
      • Jones D.
      • Ji Z.
      • Afonso A.
      • Monroy D.
      Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren's syndrome keratoconjunctivitis sicca.
      The mean fluorescein staining score in the Sod1−/− mice was significantly higher (P = 0.001) than the WT mice at 10 (2 ± 1 points) and 50 weeks (2.21 ± 1.42 points). The mean fluorescein score also showed a significant increase (P = 0.026) from 10 (4.3 ± 1.06 points) to 50 weeks (5.5 ± 1.76 points) in the Sod1−/− mice (Figure 8F). Representative corneal fluorescein stainings at 50 weeks are shown in Figure 8G. Whereas corneal epithelium from the WT mice displayed no or minimal punctate staining, the corneal epithelium in all Sod1−/− mice had marked corneal epithelial damage.

      Evidence for Presence of Age-Related Increase of Oxidative Stress and Morphologic Alterations in Human Lacrimal Glands

      Human samples were studied under institutional review board permission at Keio University School of Medicine. H&E and Mallory staining revealed acinar unit atrophy; interstitial, periacinar, and periductal fibrosis; and cystic duct dilatation with inflammatory cells in the lacrimal gland specimens from older individuals, which were not observed in the younger individuals (see Supplemental Figure S1 at http://ajp.amjpathol.org). Staining of the lacrimal gland specimens in the older individuals with anti–4-HNE antibodies showed marked staining of acinar units, indicating increased lipid oxidative damage compared with the scanty staining observed in the younger group of individuals. There was also comparably more and prominent staining for 8-OHdG, indicating extensive DNA damage in the lacrimal gland specimens of the older individuals compared with the younger individuals. Lacrimal gland specimens from older individuals also showed marked infiltration with CD45-positive inflammatory cells compared with the younger individuals.

      Discussion

      Previous experimental animal studies proposed that Sod1−/− caused an elevated oxidative stress status, resulting in various aging phenotypes, such as muscle
      • Muller F.L.
      • Song W.
      • Liu Y.
      • Chaudhuri A.
      • Pieke-Dahl S.
      • Strong R.
      • Huang T.T.
      • Epstein C.J.
      • Roberts 2nd, L.J.
      • Csete M.
      • Faulkner J.A.
      • Van Remmen H.
      Absence of CuZn superoxide dismutase leads to elevated oxidative stress and acceleration of age-dependent skeletal muscle atrophy.
      and skin atrophy,
      • Murakami K.
      • Inagaki J.
      • Saito M.
      • Ikeda Y.
      • Tsuda C.
      • Noda Y.
      • Kawakami S.
      • Shirasawa T.
      • Shimizu T.
      Skin atrophy in cytoplasmic SOD-deficient mice and its complete recovery using a vitamin C derivative.
      bone weakness,
      • Nojiri H.
      • Saita Y.
      • Morikawa D.
      • Kobayashi K.
      • Tsuda C.
      • Miyazaki T.
      • Saito M.
      • Marumo K.
      • Yonezawa I.
      • Kaneko K.
      • Shirasawa T.
      • Shimizu T.
      Cytoplasmic superoxide causes bone fragility due to low turnover osteoporosis and impaired collagen cross-linking.
      fat liver deposits, hepatic carcinoma,
      • Elchuri S.
      • Oberley T.D.
      • Qi W.
      • Eisenstein R.S.
      • Jackson Roberts L.
      • Van Remmen H.
      • Epstein C.J.
      • Huang T.T.
      CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life.
      and hemolytic anemia.
      • Iuchi Y.
      • Okada F.
      • Onuma K.
      • Onoda T.
      • Asao H.
      • Kobayashi M.
      • Fujii J.
      Elevated oxidative stress in erythrocytes due to a SOD1 deficiency causes anaemia and triggers autoantibody production.
      • Iuchi Y.
      • Okada F.
      • Takamiya R.
      • Kibe N.
      • Tsunoda S.
      • Nakajima O.
      • Toyoda K.
      • Nagae R.
      • Suematsu M.
      • Soga T.
      • Uchida K.
      • Fujii J.
      Rescue of anaemia and autoimmune responses in SOD1-deficient mice by transgenic expression of human SOD1 in erythrocytes.
      In humans, oxidative stress has been reported to be involved in many systemic diseases, including Parkinson's disease,
      • Schapira A.H.
      • Tolosa E.
      Molecular and clinical prodrome of Parkinson disease: implications for treatment.
      Alzheimer's disease,
      • Higgins G.C.
      • Beart P.M.
      • Shin Y.S.
      • Chen M.J.
      • Cheung N.S.
      • Nagley P.
      Oxidative stress: emerging mitochondrial and cellular themes and variations in neuronal injury.
      • Du H.
      • Guo L.
      • Fang F.
      • Chen D.
      • Sosunov A.A.
      • McKhann G.M.
      • Yan Y.
      • Wang C.
      • Zhang H.
      • Molkentin J.D.
      • Gunn-Moore F.J.
      • Vonsattel J.P.
      • Arancio O.
      • Chen J.X.
      • Yan S.D.
      Cyclophilin D deficiency attenuates mitochondrial and neuronal perturbation and ameliorates learning and memory in Alzheimer's disease.
      • Reddy P.H.
      Amyloid precursor protein-mediated free radicals and oxidative damage: implications for the development and progression of Alzheimer's disease.
      amyotrophic lateral sclerosis,
      • Deng H.X.
      • Shi Y.
      • Furukawa Y.
      • Zhai H.
      • Fu R.
      • Liu E.
      • Gorrie G.H.
      • Khan M.S.
      • Hung W.Y.
      • Bigio E.H.
      • Lukas T.
      • Dal Canto M.C.
      • O'Halloran T.V.
      • Siddique T.
      Conversion to the amyotrophic lateral sclerosis phenotype is associated with intermolecular linked insoluble aggregates of SOD1 in mitochondria.
      cardiovascular diseases,
      • Milei J.
      • Forcada P.
      • Fraga C.G.
      • Grana D.R.
      • Iannelli G.
      • Chiariello M.
      • Tritto I.
      • Ambrosio G.
      Relationship between oxidative stress, lipid peroxidation, and ultrastructural damage in patients with coronary artery disease undergoing cardioplegic arrest/reperfusion.
      • Nojiri H.
      • Shimizu T.
      • Funakoshi M.
      • Yamaguchi O.
      • Zhou H.
      • Kawakami S.
      • Ohta Y.
      • Sami M.
      • Tachibana T.
      • Ishikawa H.
      • Kurosawa H.
      • Kahn R.C.
      • Otsu K.
      • Shirasawa T.
      Oxidative stress causes heart failure with impaired mitochondrial respiration.
      cancer,
      • Elchuri S.
      • Oberley T.D.
      • Qi W.
      • Eisenstein R.S.
      • Jackson Roberts L.
      • Van Remmen H.
      • Epstein C.J.
      • Huang T.T.
      CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life.
      • Reuter S.
      • Gupta S.C.
      • Chaturvedi M.M.
      • Aggarwal B.B.
      Oxidative stress, inflammation, and cancer: how are they linked?.
      • Pavlides S.
      • Tsirigos A.
      • Migneco G.
      • Whitaker-Menezes D.
      • Chiavarina B.
      • Flomenberg N.
      • Frank P.G.
      • Casimiro M.C.
      • Wang C.
      • Pestell R.G.
      • Martinez-Outschoorn U.E.
      • Howell A.
      • Sotgia F.
      • Lisanti M.P.
      The autophagic tumor stroma model of cancer: role of oxidative stress and ketone production in fueling tumor cell metabolism.
      and ischemic disorders due to oxygen reperfusion injury followed by hypoxia.
      • Chong Z.Z.
      • Shang Y.C.
      • Hou J.
      • Maiese K.
      Wnt1 neuroprotection translates into improved neurological function during oxidant stress and cerebral ischemia through AKT1 and mitochondrial apoptotic pathways.
      • Ying W.
      • Xiong Z.G.
      Oxidative stress and NAD+ in ischemic brain injury: current advances and future perspectives.
      Oxygen free radicals and antioxidant systems have been demonstrated to be potentially important in the pathogenesis of ocular diseases, such as cataract,
      • Spector A.
      Oxidative stress-induced cataract: mechanism of action.
      uveitis,
      • Gritz D.C.
      • Montes C.
      • Atalla L.R.
      • Wu G.S.
      • Sevanian A.
      • Rao N.A.
      Histochemical localization of superoxide production in experimental autoimmune uveitis.
      retinopathy of prematurity,
      • Niesman M.R.
      • Johnson K.A.
      • Penn J.S.
      Therapeutic effect of liposomal superoxide dismutase in an animal model of retinopathy of prematurity.
      AMD,
      • Winkler B.S.
      • Boulton M.E.
      • Gottsch J.D.
      • Sternberg P.
      Oxidative damage and age-related macular degeneration.
      keratitis,
      • Alio J.L.
      • Artola A.
      • Serra A.
      • Ayala M.J.
      • Mulet M.E.
      Effect of topical antioxidant therapy on experimental infectious keratitis.
      keratoconus, and bullous keratopathy.
      • Behndig A.
      • Karlsson K.
      • Johansson B.O.
      • Brannstrom T.
      • Marklund S.L.
      Superoxide dismutase isoenzymes in the normal and diseased human cornea.
      The role and relation of oxidative stress in the pathogenesis of dry eye disease have not been investigated in an aging animal model or in humans before.
      The Sod1−/− mouse has been shown by us to be a good model for studying retinal oxidative stress changes, which were found to be strongly related to the morphologic and functional retinal alterations similar to human AMD.
      • Imamura Y.
      • Noda S.
      • Hashizume K.
      • Shinoda K.
      • Yamaguchi M.
      • Uchiyama S.
      • Shimizu T.
      • Mizushima Y.
      • Shirasawa T.
      • Tsubota K.
      Drusen, choroidal neovascularization, and retinal pigment epithelium dysfunction in SOD1-deficient mice: a model of age-related macular degeneration.
      In this study, we investigated whether histopathologic alterations existed in the lacrimal glands of the Sod1−/− mice and whether these changes translated into functional glandular disturbances, causing dry eye disease. Because the amount and activity of Sod1 are the highest among the three isozymes in humans, it seemed reasonable to hypothesize that the lack of Sod1 would accelerate oxidative stress and age-related pathologic changes in the lacrimal glands of the Sod1−/− mice.
      • Behndig A.
      • Svensson B.
      • Marklund S.L.
      • Karlsson K.
      Superoxide dismutase isoenzymes in the human eye.
      We observed extensive lipid and DNA oxidative stress damage in the lacrimal gland acinar epithelia, which appeared to increase with aging from 10 to 50 weeks in both the knockout and WT mice. The DNA damage seemed to be more extensive in the old Sod1−/− mice compared with the old WT mice. Elevation of serum 8-OHdG provided additional evidence on general cellular DNA damage in the Sod1−/− mice. Oxidative stress-related cellular DNA damage has previously been demonstrated in heart, brain, muscles, liver, red blood cells, and other organs in several age-related diseases, including cardiovascular disorders, neurodegenerative diseases, and cancer.
      • Shiihara T.
      • Kato M.
      • Ichiyama T.
      • Takahashi Y.
      • Tanuma N.
      • Miyata R.
      • Hayasaka K.
      Acute encephalopathy with refractory status epilepticus: bilateral mesial temporal and claustral lesions, associated with a peripheral marker of oxidative DNA damage.
      • Elchuri S.
      • Oberley T.D.
      • Qi W.
      • Eisenstein R.S.
      • Jackson Roberts L.
      • Van Remmen H.
      • Epstein C.J.
      • Huang T.T.
      CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life.
      • Higgins G.C.
      • Beart P.M.
      • Shin Y.S.
      • Chen M.J.
      • Cheung N.S.
      • Nagley P.
      Oxidative stress: emerging mitochondrial and cellular themes and variations in neuronal injury.
      • Milei J.
      • Forcada P.
      • Fraga C.G.
      • Grana D.R.
      • Iannelli G.
      • Chiariello M.
      • Tritto I.
      • Ambrosio G.
      Relationship between oxidative stress, lipid peroxidation, and ultrastructural damage in patients with coronary artery disease undergoing cardioplegic arrest/reperfusion.
      • Nojiri H.
      • Shimizu T.
      • Funakoshi M.
      • Yamaguchi O.
      • Zhou H.
      • Kawakami S.
      • Ohta Y.
      • Sami M.
      • Tachibana T.
      • Ishikawa H.
      • Kurosawa H.
      • Kahn R.C.
      • Otsu K.
      • Shirasawa T.
      Oxidative stress causes heart failure with impaired mitochondrial respiration.
      • Uchiyama S.
      • Shimizu T.
      • Shirasawa T.
      CuZn-SOD deficiency causes ApoB degradation and induces hepatic lipid accumulation by impaired lipoprotein secretion in mice.
      • Barber S.C.
      • Mead R.J.
      • Shaw P.J.
      Oxidative stress in ALS: a mechanism of neurodegeneration and a therapeutic target.
      Our observations suggested an accelerated oxidative lipid and DNA damage in the lacrimal glands of Sod1−/− mice compared with WT mice, also strengthening our belief that these changes might have very well resulted from accumulation of reactive oxygen species in the lacrimal gland cellular architecture, especially in mitochondria. Accumulation of reactive oxygen species has been shown and linked to mitochondrial alterations in humans and animal models of age-related diseases
      • Du H.
      • Guo L.
      • Fang F.
      • Chen D.
      • Sosunov A.A.
      • McKhann G.M.
      • Yan Y.
      • Wang C.
      • Zhang H.
      • Molkentin J.D.
      • Gunn-Moore F.J.
      • Vonsattel J.P.
      • Arancio O.
      • Chen J.X.
      • Yan S.D.
      Cyclophilin D deficiency attenuates mitochondrial and neuronal perturbation and ameliorates learning and memory in Alzheimer's disease.
      • Deng H.X.
      • Shi Y.
      • Furukawa Y.
      • Zhai H.
      • Fu R.
      • Liu E.
      • Gorrie G.H.
      • Khan M.S.
      • Hung W.Y.
      • Bigio E.H.
      • Lukas T.
      • Dal Canto M.C.
      • O'Halloran T.V.
      • Siddique T.
      Conversion to the amyotrophic lateral sclerosis phenotype is associated with intermolecular linked insoluble aggregates of SOD1 in mitochondria.
      • Sturtz L.A.
      • Diekert K.
      • Jensen L.T.
      • Lill R.
      • Culotta V.C.
      A fraction of yeast Cu,Zn-superoxide dismutase and its metallochaperone CCS, localize to the intermembrane space of mitochondria: a physiological role for SOD1 in guarding against mitochondrial oxidative damage.
      • Balaban R.S.
      • Nemoto S.
      • Finkel T.
      Mitochondria, oxidants, and aging.
      • Borthwick G.M.
      • Johnson M.A.
      • Ince P.G.
      • Shaw P.J.
      • Turnbull D.M.
      Mitochondrial enzyme activity in amyotrophic lateral sclerosis: implications for the role of mitochondria in neuronal cell death.
      • Kuwahara H.
      • Horie T.
      • Ishikawa S.
      • Tsuda C.
      • Kawakami S.
      • Noda Y.
      • Kaneko T.
      • Tahara S.
      • Tachibana T.
      • Okabe M.
      • Melki J.
      • Takano R.
      • Toda T.
      • Morikawa D.
      • Nojiri H.
      • Kurosawa H.
      • Shirasawa T.
      • Shimizu T.
      Oxidative stress in skeletal muscle causes severe disturbance of exercise activity without muscle atrophy.
      with striking disturbances in the mitochondrial architecture, including mitochondrial swelling, rupture of membranes, and disruption of cristae changes, which were also observed in our Sod1−/− mice.
      Such alterations in the mitochondrial cytoskeleton have also been linked to activation of apoptotic signals, initiating cell death.
      • Chwa M.
      • Atilano S.R.
      • Reddy V.
      • Jordan N.
      • Kim D.W.
      • Kenney M.C.
      Increased stress-induced generation of reactive oxygen species and apoptosis in human keratoconus fibroblasts.
      • Fujimura M.
      • Morita-Fujimura Y.
      • Noshita N.
      • Sugawara T.
      • Kawase M.
      • Chan P.H.
      The cytosolic antioxidant copper/zinc-superoxide dismutase prevents the early release of mitochondrial cytochrome c in ischemic brain after transient focal cerebral ischemia in mice.
      • Li Q.
      • Sato E.F.
      • Zhu X.
      • Inoue M.
      A simultaneous release of SOD1 with cytochrome c regulates mitochondria-dependent apoptosis.
      • Wallace D.C.
      Mitochondrial diseases in man and mouse.
      We showed an increase in the process of apoptotic cell death over time in the lacrimal glands of the Sod1−/− and WT mice by confirming increased TUNEL and caspase-3 staining with a comparatively greater extent of staining in the old Sod1−/− compared with old WT mice. Fragmentation of nuclei and vacuolar changes in the lacrimal gland acinar epithelia provided further ultrastructural evidence of the presence of apoptosis as a possible mechanism of cell death in this study. This observation differs from that of Hashizume et al,
      • Hashizume K.
      • Hirasawa M.
      • Imamura Y.
      • Noda S.
      • Shimizu T.
      • Shinoda K.
      • Kurihara T.
      • Noda K.
      • Ozawa Y.
      • Ishida S.
      • Miyake Y.
      • Shirasawa T.
      • Tsubota K.
      Retinal dysfunction and progressive retinal cell death in SOD1-deficient mice.
      who found both apoptosis and necrosis in the retina of the Sod1−/− mice. We believe this difference in cell death mechanisms is attributable to light exposure protected ocular anatomical location of the lacrimal gland.
      We think increased caspase-3 staining overtime in our knockout mice is an important observation because even a small amount of caspase-3 activation has been shown to be sufficient to initiate genomic DNA breakdown, leading to apoptotic cell death.
      • Methot N.
      • Huang J.
      • Coulombe N.
      • Vaillancourt J.P.
      • Rasper D.
      • Tam J.
      • Han Y.
      • Colucci J.
      • Zamboni R.
      • Xanthoudakis S.
      • Toulmond S.
      • Nicholson D.W.
      • Roy S.
      Differential efficacy of caspase inhibitors on apoptosis markers during sepsis in rats and implication for fractional inhibition requirements for therapeutics.
      Nonapoptotic functions of caspase-3 include induction of inflammation through lymphocyte proliferation and antigen presentation.
      • Perfettini J.L.
      • Kroemer G.
      Caspase activation is not death.
      • Newton K.
      • Strasser A.
      Caspases signal not only apoptosis but also antigen-induced activation in cells of the immune system.
      We noted an altered “inflammation status” in the lacrimal gland tissue with significant increases in the lacrimal gland inflammatory cell infiltrate densities in both Sod1−/− and WT mice overtime, with the difference becoming more significant in the old knockout than the old WT mice. These observations were consistent with previous studies that showed increased focal infiltrates in lacrimal glands with a variety of inflammatory cells with aging.
      • Williams R.M.
      • Singh J.
      • Sharkey K.A.
      Innervation and mast cells of the rat exorbital lacrimal gland: the effects of age.
      • Obata H.
      • Yamamoto S.
      • Horiuchi H.
      • Machinami R.
      Histopathologic study of human lacrimal gland Statistical analysis with special reference to aging.
      • Draper C.E.
      • Adeghate E.
      • Lawrence P.A.
      • Pallot D.J.
      • Garner A.
      • Singh J.
      Age-related changes in morphology and secretory responses of male rat lacrimal gland.
      • Adeghate E.
      • Draper C.E.
      • Singh J.
      Effects of ageing on changes in morphology of the rat lacrimal gland.
      • Obata H.
      Anatomy and histopathology of the human lacrimal gland.
      • Damato B.E.
      • Allan D.
      • Murray S.B.
      • Lee W.R.
      Senile atrophy of the human lacrimal gland: the contribution of chronic inflammatory disease.
      In this study, we observed that the inflammatory cells were predominantly CD4+ T cells at 50 weeks in the Sod1−/− mice. We previously reported that the conjunctival and lacrimal gland tissues of the Sod1−/− mice also became simultaneously infiltrated with CD45 and CD4+ cells from 30 weeks and predominate the lacrimal gland and conjunctival tissues densely at 50 weeks (without evidence of corneal infiltration), with a simultaneous decrease in goblet cell density, Muc5ac mRNA expressions in RT-PCR, and a decrease in tear quantity from approximately 30 weeks becoming significant at 50 weeks (unpublished data). The lacrimal/conjunctival or the corneal tissues of the Sod1−/− mice lacked any marked infiltration at 10 weeks, which excludes the possibility of an inflammatory process being the cause of corneal staining observed in the mice at that age. The few inflammatory cells observed were cells tracking or patrolling the lacrimal gland tissues.
      Inflammatory cells have been reported to release several cytokines that play an important role by initiating or further adding to the process of apoptotic cell death.
      • Tapinos N.I.
      • Polihronis M.
      • Tzioufas A.G.
      • Skopouli F.N.
      Immunopathology of Sjögren's syndrome.
      • Manganelli P.
      • Fietta P.
      Apoptosis and Sjögren syndrome.
      • Gyrd-Hansen M.
      • Meier P.
      IAPs: from caspase inhibitors to modulators of NF-kappaB, inflammation and cancer.
      Likewise, lacrimal gland epithelial cells in an inflamed environment have been shown to express cytokines in dry eye disease and with aging.
      • Krabbe K.S.
      • Pedersen M.
      • Bruunsgaard H.
      Inflammatory mediators in the elderly.
      This study noted significant increases in two cytokines in the old knockout mice compared with the old WT mice: TNF-α and IL-6. TNF-α has indeed been demonstrated in increased amounts in the lacrimal glands of old but not young mice.
      • Zoukhri D.
      Effect of inflammation on lacrimal gland function.
      Increased TNF-α and IL-6 concentrations have also been shown in dry eye syndromes in previous studies.
      • Pflugfelder S.C.
      • Jones D.
      • Ji Z.
      • Afonso A.
      • Monroy D.
      Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren's syndrome keratoconjunctivitis sicca.
      • Stern M.E.
      • Pflugfelder S.C.
      Inflammation in dry eye.
      • Zoukhri D.
      Effect of inflammation on lacrimal gland function.
      • Fox R.I.
      • Kang H.I.
      • Ando D.
      • Abrams J.
      • Pisa E.
      Cytokine mRNA expression in salivary gland biopsies of Sjögren's syndrome.
      • Narayanan S.
      • Miller W.L.
      • McDermott A.M.
      Conjunctival cytokine expression in symptomatic moderate dry eye subjects.
      • Tishler M.
      • Yaron I.
      • Geyer O.
      • Shirazi I.
      • Naftaliev E.
      • Yaron M.
      Elevated tear interleukin-6 levels in patients with Sjögren syndrome.
      The reported roles for TNF-α include induction of inflammation and cell death, and those for IL-6 include induction of inflammation and fibrosis.
      • Krabbe K.S.
      • Pedersen M.
      • Bruunsgaard H.
      Inflammatory mediators in the elderly.
      • Jenny N.S.
      • Tracy R.P.
      • Ogg M.S.
      • Luong le A.
      • Kuller L.H.
      • Arnold A.M.
      • Sharrett A.R.
      • Humphries S.E.
      In the elderly, interleukin-6 plasma levels and the −174G>C polymorphism are associated with the development of cardiovascular disease.
      • Bruunsgaard H.
      • Benfield T.L.
      • Andersen-Ranberg K.
      • Hjelmborg J.B.
      • Pedersen A.N.
      • Schroll M.
      • Pedersen B.K.
      • Jeune B.
      The tumor necrosis factor alpha −308G>A polymorphism is associated with dementia in the oldest old.
      • Bruunsgaard H.
      • Ladelund S.
      • Pedersen A.N.
      • Schroll M.
      • Jorgensen T.
      • Pedersen B.K.
      Predicting death from tumour necrosis factor-alpha and interleukin-6 in 80-year-old people.
      • Bruunsgaard H.
      • Pedersen B.K.
      Age-related inflammatory cytokines and disease.
      The cytokine alterations observed in this study go along well and are consistent with increased inflammatory cell density in our knockout mice model with aging. Again, consistent with the cytokine alterations, we observed an exaggerated fibrosis of the interstitium in the lacrimal glands of the old Sod1−/− mice, which was also comparatively more extensive than the lacrimal glands of the old WT mice.
      To extensively study the mechanisms involved in the process of fibrosis, we decided to investigate the changes in EMT markers in both WT and Sod1−/− mice. EMT plays a crucial role not only in physiologic conditions, such as embryonic development or tissue remodeling, but also in pathologic conditions, such as cancer and organ fibrosis.
      • Thiery J.P.
      Epithelial-mesenchymal transitions in tumour progression.
      Pathologic EMT has been reported to be induced by inflammatory cytokines, reactive oxygen species, hypoxia, UV irradiation, and nicotine.
      • Radisky D.C.
      • Levy D.D.
      • Littlepage L.E.
      • Liu H.
      • Nelson C.M.
      • Fata J.E.
      • Leake D.
      • Godden E.L.
      • Albertson D.G.
      • Nieto M.A.
      • Werb Z.
      • Bissell M.J.
      Rac1b and reactive oxygen species mediate MMP-3-induced EMT and genomic instability.
      • Dasgupta P.
      • Rizwani W.
      • Pillai S.
      • Kinkade R.
      • Kovacs M.
      • Rastogi S.
      • Banerjee S.
      • Carless M.
      • Kim E.
      • Coppola D.
      • Haura E.
      • Chellappan S.
      Nicotine induces cell proliferation, invasion and epithelial-mesenchymal transition in a variety of human cancer cell lines.
      EMT-inducing inflammatory cytokines include transforming growth factor β, TNF-α, and IL-6,
      • Sullivan N.J.
      • Sasser A.K.
      • Axel A.E.
      • Vesuna F.
      • Raman V.
      • Ramirez N.
      • Oberyszyn T.M.
      • Hall B.M.
      Interleukin-6 induces an epithelial-mesenchymal transition phenotype in human breast cancer cells.
      • Asiedu M.K.
      • Ingle J.N.
      • Behrens M.D.
      • Radisky D.C.
      • Knutson K.L.
      TGF{beta}/TNF{alpha}-mediated epithelial-mesenchymal transition generates breast cancer stem cells with a claudin-low phenotype.
      the last two of which were significantly increased in tears and serum of the 50-week-old Sod1−/− mice. We believe that these inflammatory changes invited EMT with increased collagen lay down, fibrosis, and loss of glandular acinar units in due course. A previous report also showed that the EMT in lacrimal gland was caused by human ocular chronic graft-versus-host disease.
      • Ogawa Y.
      • Shimmura S.
      • Kawakita T.
      • Yoshida S.
      • Kawakami Y.
      • Tsubota K.
      Epithelial mesenchymal transition in human ocular chronic graft-versus-host disease.
      Draper et al found increased inflammatory cell infiltration, acinar atrophy, and fibrosis among age-related alterations in lacrimal glands of rats.
      • Draper C.E.
      • Adeghate E.
      • Lawrence P.A.
      • Pallot D.J.
      • Garner A.
      • Singh J.
      Age-related changes in morphology and secretory responses of male rat lacrimal gland.
      In the human lacrimal glands, Damato et al and Obata et al described atrophy of secretory acini, periductal fibrosis, and increased inflammatory cell infiltration with aging,
      • Obata H.
      • Yamamoto S.
      • Horiuchi H.
      • Machinami R.
      Histopathologic study of human lacrimal gland Statistical analysis with special reference to aging.
      • Obata H.
      Anatomy and histopathology of the human lacrimal gland.
      • Damato B.E.
      • Allan D.
      • Murray S.B.
      • Lee W.R.
      Senile atrophy of the human lacrimal gland: the contribution of chronic inflammatory disease.
      similar to our observations, which included interlobular fibrosis, cystic dilatation of ducts, atrophy of secretory acini, and inflammatory cell infiltration and were more prominent and extensive in the knockout mice in this study. Attempts to quantify these phenotypic alterations in the lacrimal gland acinar units revealed significant decreases in the secretory acinar unit density in the Sod1−/− mice, a parameter that we thought would reflect the process of acinar atrophy. Apoptosis of acinar and ductal epithelia of the lacrimal glands along with glandular atrophy have been previously proposed as a possible mechanism for the impairment of glandular secretory function.
      • Tsubota K.
      • Fujita H.
      • Tsuzaka K.
      • Takeuchi T.
      Quantitative analysis of lacrimal gland function, apoptotic figures: Fas and Fas ligand expression of lacrimal glands in dry eye patients.
      • Mariette X.
      Pathophysiology of Sjögren's syndrome [in French].
      A striking ultrastructural observation was related to the extensive accumulation of secretory vesicles in the lacrimal gland acinar epithelia in the Sod1−/− mice overtime compared with the WT mice. These observations suggest that the lacrimal glands may be unable to secrete tears in the presence of marked mitochondrial alterations in the Sod1−/− mice because mitochondria are the cellular powerhouses important for normal tear secretions.
      • Wallace D.C.
      • Fan W.
      Energetics, epigenetics, mitochondrial genetics.
      • Wallace D.C.
      Mitochondrial DNA mutations in diseases of energy metabolism.
      Whereas the mitochondria in the lacrimal glands of the Sod1−/− mice showed striking ultrastructural alterations, which might lead to decreased tear production, further evidence from future studies simultaneously looking into lacrimal gland ATP levels, mitochondrial membrane potentials, and Ca++ currents across lacrimal gland acinar epithelial membranes may provide essential proof of whether the mitochondrial dysfunction in the presence of phenotypic mitochondrial alterations is linked to tear production decrease or not. Surprisingly, we found a significant decrease in the weight-adjusted aqueous tear production, pilocarpine-stimulated tear output, and total protein secretion capacity of the lacrimal gland in the old Sod1−/− mice compared with the old WT mice.
      Decreased aqueous tear and protein output by the lacrimal gland and increased corneal epithelial damage are universally well-known features of the dry eye disease in animals and humans.
      • Goto E.
      • Dogru M.
      • Kojima T.
      • Tsubota K.
      Computer-synthesis of an interference color chart of human tear lipid layer, by a colorimetric approach.
      • Nakamura S.
      • Shibuya M.
      • Nakashima H.
      • Hisamura R.
      • Masuda N.
      • Imagawa T.
      • Uehara M.
      • Tsubota K.
      Involvement of oxidative stress on corneal epithelial alterations in a blink-suppressed dry eye.
      • Wakamatsu T.H.
      • Sato E.A.
      • Matsumoto Y.
      • Ibrahim O.M.
      • Dogru M.
      • Kaido M.
      • Ishida R.
      • Tsubota K.
      Conjunctival in vivo confocal scanning laser microscopy in patients with Sjögren's syndrome.
      The higher corneal epithelial damage observed in the Sod1−/− mice reflects both the detrimental effects of decreased tear production on the ocular surface and possible oxidative stress damage on cell membrane lipids. Sod1 is an abundant Cu- and Zn-containing protein present in cytosol,
      • Fujimura M.
      • Morita-Fujimura Y.
      • Noshita N.
      • Sugawara T.
      • Kawase M.
      • Chan P.H.
      The cytosolic antioxidant copper/zinc-superoxide dismutase prevents the early release of mitochondrial cytochrome c in ischemic brain after transient focal cerebral ischemia in mice.
      nucleus, peroxisomes, and mitochondrial intermembrane space.
      • Sturtz L.A.
      • Diekert K.
      • Jensen L.T.
      • Lill R.
      • Culotta V.C.
      A fraction of yeast Cu,Zn-superoxide dismutase and its metallochaperone CCS, localize to the intermembrane space of mitochondria: a physiological role for SOD1 in guarding against mitochondrial oxidative damage.
      • Okado-Matsumoto A.
      • Fridovich I.
      Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria.
      Its primary function is to act as an antioxidant enzyme, lowering the steady-state concentrations of superoxide.
      • Valentine J.S.
      • Doucette P.A.
      • Zittin Potter S.
      Copper-zinc superoxide dismutase and amyotrophic lateral sclerosis.
      Our results suggest that oxidative stress is not merely an associated phenomenon but may be an integral and primary cause of age-related dry eye disease in the Sod1−/− mice model. Adding further to our surprise were the similar observations in young and old human lacrimal gland specimens showing extensive lipid and DNA oxidation, inflammatory cell infiltration, fibrosis, and cystic duct dilatation in the aged individuals compared with the young individuals. Whereas the lacrimal gland samples from the human young and old individuals showed striking differences in relation to increased staining for oxidative stress markers and increased fibrosis and glandular atrophy, which were more prominent in the old individuals, tear function differences still need to be proven, although previous reports indicated a decrease in tear secretion with aging.
      • Henderson J.W.
      • Prough W.A.
      Influence of age and sex on flow of tears.
      • Norn M.S.
      Tear secretion in normal eyes. Estimated by a new method: the lacrimal streak dilution test.
      • McGill J.I.
      • Liakos G.M.
      • Goulding N.
      • Seal D.V.
      Normal tear protein profiles and age-related changes.
      Future studies looking into differences among reflex tearing, total tear protein secretion, and histopathologic differences of lacrimal gland samples obtained for diagnostic purposes in young and old individuals may increase our understanding of whether the Sod1−/− mice are relevant to the human disease or may be useful to identify novel therapies for age-related dry eye disease.
      We were unable to disclose when exactly the sequence of mechanistic events resulted in the phenotype observed in the lacrimal glands of the SOD1 knockout mice, which possibly led to dry eye and ocular surface disease. Relevant lacrimal gland pathophysiological and tear function examinations in the Sod1−/− mice performed more frequently in future studies will provide useful information.
      In conclusion, we demonstrated that the lack of Sod1 led to increased oxidative lipid and DNA damage, increased CD4+ T-cell inflammation, and EMT in the lacrimal glands of the current mouse model, interfering with glandular secretory functions, which resulted in dry eyes and translated into an ocular surface disease.

      Acknowledgments

      We thank Dr. Yutaka Imamura for advice on experimental design and help with subsequent analysis, Yasumasa Sasaki and Samantha Koto Ward for their initial experimental assistance during the early stages of this work, and Yusuke Ozawa (Tokyo Metropolitan Institute of Gerontology) for his logistic support in maintaining the knockout mice.

      Supplementary data

      • Supplemental Figure S1

        Age-related oxidative stress and morphologic alterations in representative human lacrimal glands. Samples from representative young (15-year-old girl, 17-year-old boy, and 44-year-old man) and old individuals (68-year-old man, 75-year-old woman, and 87-year-old woman) were stained by H&E and Mallory staining and by IHC for 8-OHdG, 4-HNE, and CD45. H&E and Mallory staining revealed acinar unit atrophy; interstitial, periacinar, and periductal fibrosis; and cystic duct dilatation with inflammatory cells in the postmortem human lacrimal gland specimens in the old individuals but not in the young individuals. Extensive IHC staining of oxidative stress markers (4-HNE and 8-OHdG) was observed in the lacrimal gland specimens of the old compared with the young individuals.

      References

        • Droge W.
        Free radicals in the physiological control of cell function.
        Physiol Rev. 2002; 82: 47-95
        • Crapo J.D.
        • Oury T.
        • Rabouille C.
        • Slot J.W.
        • Chang L.Y.
        Copper,zinc superoxide dismutase is primarily a cytosolic protein in human cells.
        Proc Natl Acad Sci U S A. 1992; 89: 10405-10409
        • Fridovich I.
        Superoxide anion radical (O2-.), superoxide dismutases, and related matters.
        J Biol Chem. 1997; 272: 18515-18517
        • Imamura Y.
        • Noda S.
        • Hashizume K.
        • Shinoda K.
        • Yamaguchi M.
        • Uchiyama S.
        • Shimizu T.
        • Mizushima Y.
        • Shirasawa T.
        • Tsubota K.
        Drusen, choroidal neovascularization, and retinal pigment epithelium dysfunction in SOD1-deficient mice: a model of age-related macular degeneration.
        Proc Natl Acad Sci U S A. 2006; 103: 11282-11287
        • Friedman D.S.
        • O'Colmain B.J.
        • Munoz B.
        • Tomany S.C.
        • McCarty C.
        • de Jong P.T.
        • Nemesure B.
        • Mitchell P.
        • Kempen J.
        Prevalence of age-related macular degeneration in the United States.
        Arch Ophthalmol. 2004; 122: 564-572
        • Smith J.A.
        • Albeitz J.
        • Begley C.
        • Caffery B.
        • Nichols K.
        • Schaumberg D.
        • Schein O.
        The epidemiology of dry eye disease: report of the Epidemiology Subcommittee of the International Dry Eye WorkShop.
        Ocul Surf. 2007; 5: 93-107
        • Pflugfelder S.C.
        • Jones D.
        • Ji Z.
        • Afonso A.
        • Monroy D.
        Altered cytokine balance in the tear fluid and conjunctiva of patients with Sjögren's syndrome keratoconjunctivitis sicca.
        Curr Eye Res. 1999; 19: 201-211
        • Stern M.E.
        • Pflugfelder S.C.
        Inflammation in dry eye.
        Ocul Surf. 2004; 2: 124-130
        • Barabino S.
        • Chen W.
        • Dana M.R.
        Tear film and ocular surface tests in animal models of dry eye: uses and limitations.
        Exp Eye Res. 2004; 79: 613-621
        • Suwan-apichon O.
        • Rizen M.
        • Rangsin R.
        • Herretes S.
        • Reyes J.M.
        • Lekhanont K.
        • Chuck R.S.
        Botulinum toxin B-induced mouse model of keratoconjunctivitis sicca.
        Invest Ophthalmol Vis Sci. 2006; 47: 133-139
        • Zoukhri D.
        Effect of inflammation on lacrimal gland function.
        Exp Eye Res. 2006; 82: 885-898
        • Niederkorn J.Y.
        • Stern M.E.
        • Pflugfelder S.C.
        • De Paiva C.S.
        • Corrales R.M.
        • Gao J.
        • Siemasko K.
        Desiccating stress induces T cell-mediated Sjögren's syndrome-like lacrimal keratoconjunctivitis.
        J Immunol. 2006; 176: 3950-3957
        • Song X.J.
        • Li D.Q.
        • Farley W.
        • Luo L.H.
        • Heuckeroth R.O.
        • Milbrandt J.
        • Pflugfelder S.C.
        Neurturin-deficient mice develop dry eye and keratoconjunctivitis sicca.
        Invest Ophthalmol Vis Sci. 2003; 44: 4223-4229
        • Ikegami T.
        • Suzuki Y.
        • Shimizu T.
        • Isono K.
        • Koseki H.
        • Shirasawa T.
        Model mice for tissue-specific deletion of the manganese superoxide dismutase (MnSOD) gene.
        Biochem Biophys Res Commun. 2002; 296: 729-736
        • Dursun D.
        • Wang M.
        • Monroy D.
        • Li D.Q.
        • Lokeshwar B.L.
        • Stern M.E.
        • Pflugfelder S.C.
        A mouse model of keratoconjunctivitis sicca.
        Invest Ophthalmol Vis Sci. 2002; 43: 632-638
        • Botelho S.Y.
        • Hisada M.
        • Fuenmayor N.
        Functional innervation of the lacrimal gland in the cat: origin of secretomotor fibers in the lacrimal nerve.
        Arch Ophthalmol. 1966; 76: 581-588
        • Ruskell G.L.
        The distribution of autonomic post-ganglionic nerve fibres to the lacrimal gland in monkeys.
        J Anat. 1971; 109: 229-242
        • Walcott B.
        • Claros N.
        • Patel A.
        • Brink P.R.
        Age-related decrease in innervation density of the lacrimal gland in mouse models of Sjögren's syndrome.
        Adv Exp Med Biol. 1998; 438: 917-923
        • Dotti G.
        • Savoldo B.
        • Takahashi S.
        • Goltsova T.
        • Brown M.
        • Rill D.
        • Rooney C.
        • Brenner M.
        Adenovector-induced expression of human-CD40-ligand (hCD40L) by multiple myeloma cells: a model for immunotherapy.
        Exp Hematol. 2001; 29: 952-961
        • Anderson G.G.
        Tissue processing, microtomy and paraffin sections.
        in: Bancroft J.D. Churchill–Livingstone, Edinburgh1996: 47-68
        • Hopwood J.
        Fixation and fixtative.
        in: Bancroft J.D. Churchill–Livingstone, Edinburgh1996: 23-46
        • Zeisberg E.M.
        • Tarnavski O.
        • Zeisberg M.
        • Dorfman A.L.
        • McMullen J.R.
        • Gustafsson E.
        • Chandraker A.
        • Yuan X.
        • Pu W.T.
        • Roberts A.B.
        • Neilson E.G.
        • Sayegh M.H.
        • Izumo S.
        • Kalluri R.
        Endothelial-to-mesenchymal transition contributes to cardiac fibrosis.
        Nat Med. 2007; 13: 952-961
        • Zeisberg M.
        • Kalluri R.
        Fibroblasts emerge via epithelial-mesenchymal transition in chronic kidney fibrosis.
        Front Biosci. 2008; 13: 6991-6998
        • Kojima T.
        • Chang J.H.
        • Azar D.T.
        Proangiogenic role of ephrinB1/EphB1 in basic fibroblast growth factor-induced corneal angiogenesis.
        Am J Pathol. 2007; 170: 764-773
        • Shiihara T.
        • Kato M.
        • Ichiyama T.
        • Takahashi Y.
        • Tanuma N.
        • Miyata R.
        • Hayasaka K.
        Acute encephalopathy with refractory status epilepticus: bilateral mesial temporal and claustral lesions, associated with a peripheral marker of oxidative DNA damage.
        J Neurol Sci. 2006; 250: 159-161
        • Dalle-Donne I.
        • Rossi R.
        • Colombo R.
        • Giustarini D.
        • Milzani A.
        Biomarkers of oxidative damage in human disease.
        Clin Chem. 2006; 52: 601-623
        • Wallace D.C.
        • Fan W.
        Energetics, epigenetics, mitochondrial genetics.
        Mitochondrion. 2009; 10: 12-31
        • Hensley K.
        • Robinson K.A.
        • Gabbita S.P.
        • Salsman S.
        • Floyd R.A.
        Reactive oxygen species, cell signaling, and cell injury.
        Free Radic Biol Med. 2000; 28: 1456-1462
        • Halliday G.M.
        Inflammation, gene mutation and photoimmunosuppression in response to UVR-induced oxidative damage contributes to photocarcinogenesis.
        Mutat Res. 2005; 571: 107-120
        • Dahl M.
        • Bauer A.K.
        • Arredouani M.
        • Soininen R.
        • Tryggvason K.
        • Kleeberger S.R.
        • Kobzik L.
        Protection against inhaled oxidants through scavenging of oxidized lipids by macrophage receptors MARCO and SR-AI/II.
        J Clin Invest. 2007; 117: 757-764
        • Pulido R.
        • Cebrian M.
        • Acevedo A.
        • de Landazuri M.O.
        • Sanchez-Madrid F.
        Comparative biochemical and tissue distribution study of four distinct CD45 antigen specificities.
        J Immunol. 1988; 140: 3851-3857
        • Tsubota K.
        • Fujita H.
        • Tadano K.
        • Onoda N.
        • Tsuzaka K.
        • Takeuchi T.
        Abnormal expression and function of Fas ligand of lacrimal glands and peripheral blood in Sjögren's syndrome patients with enlarged exocrine glands.
        Clin Exp Immunol. 2002; 129: 177-182
        • Tsubota K.
        • Fujita H.
        • Tsuzaka K.
        • Takeuchi T.
        Quantitative analysis of lacrimal gland function, apoptotic figures: Fas and Fas ligand expression of lacrimal glands in dry eye patients.
        Exp Eye Res. 2003; 76: 233-240
        • Wyllie A.H.
        Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation.
        Nature. 1980; 284: 555-556
        • Nicholson D.W.
        • Ali A.
        • Thornberry N.A.
        • Vaillancourt J.P.
        • Ding C.K.
        • Gallant M.
        • Gareau Y.
        • Griffin P.R.
        • Labelle M.
        • Lazebnik Y.A.
        • et al.
        Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis.
        Nature. 1995; 376: 37-43
        • Muller F.L.
        • Song W.
        • Liu Y.
        • Chaudhuri A.
        • Pieke-Dahl S.
        • Strong R.
        • Huang T.T.
        • Epstein C.J.
        • Roberts 2nd, L.J.
        • Csete M.
        • Faulkner J.A.
        • Van Remmen H.
        Absence of CuZn superoxide dismutase leads to elevated oxidative stress and acceleration of age-dependent skeletal muscle atrophy.
        Free Radic Biol Med. 2006; 40: 1993-2004
        • Murakami K.
        • Inagaki J.
        • Saito M.
        • Ikeda Y.
        • Tsuda C.
        • Noda Y.
        • Kawakami S.
        • Shirasawa T.
        • Shimizu T.
        Skin atrophy in cytoplasmic SOD-deficient mice and its complete recovery using a vitamin C derivative.
        Biochem Biophys Res Commun. 2009; 382: 457-461
        • Nojiri H.
        • Saita Y.
        • Morikawa D.
        • Kobayashi K.
        • Tsuda C.
        • Miyazaki T.
        • Saito M.
        • Marumo K.
        • Yonezawa I.
        • Kaneko K.
        • Shirasawa T.
        • Shimizu T.
        Cytoplasmic superoxide causes bone fragility due to low turnover osteoporosis and impaired collagen cross-linking.
        J Bone Miner Res. 2011; 26: 2682-2694
        • Elchuri S.
        • Oberley T.D.
        • Qi W.
        • Eisenstein R.S.
        • Jackson Roberts L.
        • Van Remmen H.
        • Epstein C.J.
        • Huang T.T.
        CuZnSOD deficiency leads to persistent and widespread oxidative damage and hepatocarcinogenesis later in life.
        Oncogene. 2005; 24: 367-380
        • Iuchi Y.
        • Okada F.
        • Onuma K.
        • Onoda T.
        • Asao H.
        • Kobayashi M.
        • Fujii J.
        Elevated oxidative stress in erythrocytes due to a SOD1 deficiency causes anaemia and triggers autoantibody production.
        Biochem J. 2007; 402: 219-227
        • Iuchi Y.
        • Okada F.
        • Takamiya R.
        • Kibe N.
        • Tsunoda S.
        • Nakajima O.
        • Toyoda K.
        • Nagae R.
        • Suematsu M.
        • Soga T.
        • Uchida K.
        • Fujii J.
        Rescue of anaemia and autoimmune responses in SOD1-deficient mice by transgenic expression of human SOD1 in erythrocytes.
        Biochem J. 2009; 422: 313-320
        • Schapira A.H.
        • Tolosa E.
        Molecular and clinical prodrome of Parkinson disease: implications for treatment.
        Nat Rev Neurol. 2010; 6: 309-317
        • Higgins G.C.
        • Beart P.M.
        • Shin Y.S.
        • Chen M.J.
        • Cheung N.S.
        • Nagley P.
        Oxidative stress: emerging mitochondrial and cellular themes and variations in neuronal injury.
        J Alzheimers Dis. 2010; 20: S453-S473
        • Du H.
        • Guo L.
        • Fang F.
        • Chen D.
        • Sosunov A.A.
        • McKhann G.M.
        • Yan Y.
        • Wang C.
        • Zhang H.
        • Molkentin J.D.
        • Gunn-Moore F.J.
        • Vonsattel J.P.
        • Arancio O.
        • Chen J.X.
        • Yan S.D.
        Cyclophilin D deficiency attenuates mitochondrial and neuronal perturbation and ameliorates learning and memory in Alzheimer's disease.
        Nat Med. 2008; 14: 1097-1105
        • Reddy P.H.
        Amyloid precursor protein-mediated free radicals and oxidative damage: implications for the development and progression of Alzheimer's disease.
        J Neurochem. 2006; 96: 1-13
        • Deng H.X.
        • Shi Y.
        • Furukawa Y.
        • Zhai H.
        • Fu R.
        • Liu E.
        • Gorrie G.H.
        • Khan M.S.
        • Hung W.Y.
        • Bigio E.H.
        • Lukas T.
        • Dal Canto M.C.
        • O'Halloran T.V.
        • Siddique T.
        Conversion to the amyotrophic lateral sclerosis phenotype is associated with intermolecular linked insoluble aggregates of SOD1 in mitochondria.
        Proc Natl Acad Sci U S A. 2006; 103: 7142-7147
        • Milei J.
        • Forcada P.
        • Fraga C.G.
        • Grana D.R.
        • Iannelli G.
        • Chiariello M.
        • Tritto I.
        • Ambrosio G.
        Relationship between oxidative stress, lipid peroxidation, and ultrastructural damage in patients with coronary artery disease undergoing cardioplegic arrest/reperfusion.
        Cardiovasc Res. 2007; 73: 710-719
        • Nojiri H.
        • Shimizu T.
        • Funakoshi M.
        • Yamaguchi O.
        • Zhou H.
        • Kawakami S.
        • Ohta Y.
        • Sami M.
        • Tachibana T.
        • Ishikawa H.
        • Kurosawa H.
        • Kahn R.C.
        • Otsu K.
        • Shirasawa T.
        Oxidative stress causes heart failure with impaired mitochondrial respiration.
        J Biol Chem. 2006; 281: 33789-33801
        • Reuter S.
        • Gupta S.C.
        • Chaturvedi M.M.
        • Aggarwal B.B.
        Oxidative stress, inflammation, and cancer: how are they linked?.
        Free Radic Biol Med. 2010; 49: 1603-1616
        • Pavlides S.
        • Tsirigos A.
        • Migneco G.
        • Whitaker-Menezes D.
        • Chiavarina B.
        • Flomenberg N.
        • Frank P.G.
        • Casimiro M.C.
        • Wang C.
        • Pestell R.G.
        • Martinez-Outschoorn U.E.
        • Howell A.
        • Sotgia F.
        • Lisanti M.P.
        The autophagic tumor stroma model of cancer: role of oxidative stress and ketone production in fueling tumor cell metabolism.
        Cell Cycle. 2010; 9: 3485-3505
        • Chong Z.Z.
        • Shang Y.C.
        • Hou J.
        • Maiese K.
        Wnt1 neuroprotection translates into improved neurological function during oxidant stress and cerebral ischemia through AKT1 and mitochondrial apoptotic pathways.
        Oxid Med Cell Longev. 2010; 3: 153-165
        • Ying W.
        • Xiong Z.G.
        Oxidative stress and NAD+ in ischemic brain injury: current advances and future perspectives.
        Curr Med Chem. 2010; 17: 2152-2158
        • Spector A.
        Oxidative stress-induced cataract: mechanism of action.
        FASEB J. 1995; 9: 1173-1182
        • Gritz D.C.
        • Montes C.
        • Atalla L.R.
        • Wu G.S.
        • Sevanian A.
        • Rao N.A.
        Histochemical localization of superoxide production in experimental autoimmune uveitis.
        Curr Eye Res. 1991; 10: 927-931
        • Niesman M.R.
        • Johnson K.A.
        • Penn J.S.
        Therapeutic effect of liposomal superoxide dismutase in an animal model of retinopathy of prematurity.
        Neurochem Res. 1997; 22: 597-605
        • Winkler B.S.
        • Boulton M.E.
        • Gottsch J.D.
        • Sternberg P.
        Oxidative damage and age-related macular degeneration.
        Mol Vis. 1999; 5: 32
        • Alio J.L.
        • Artola A.
        • Serra A.
        • Ayala M.J.
        • Mulet M.E.
        Effect of topical antioxidant therapy on experimental infectious keratitis.
        Cornea. 1995; 14: 175-179
        • Behndig A.
        • Karlsson K.
        • Johansson B.O.
        • Brannstrom T.
        • Marklund S.L.
        Superoxide dismutase isoenzymes in the normal and diseased human cornea.
        Invest Ophthalmol Vis Sci. 2001; 42: 2293-2296
        • Behndig A.
        • Svensson B.
        • Marklund S.L.
        • Karlsson K.
        Superoxide dismutase isoenzymes in the human eye.
        Invest Ophthalmol Vis Sci. 1998; 39: 471-475
        • Uchiyama S.
        • Shimizu T.
        • Shirasawa T.
        CuZn-SOD deficiency causes ApoB degradation and induces hepatic lipid accumulation by impaired lipoprotein secretion in mice.
        J Biol Chem. 2006; 281: 31713-31719
        • Barber S.C.
        • Mead R.J.
        • Shaw P.J.
        Oxidative stress in ALS: a mechanism of neurodegeneration and a therapeutic target.
        Biochim Biophys Acta. 2006; 1762: 1051-1067
        • Sturtz L.A.
        • Diekert K.
        • Jensen L.T.
        • Lill R.
        • Culotta V.C.
        A fraction of yeast Cu,Zn-superoxide dismutase and its metallochaperone CCS, localize to the intermembrane space of mitochondria: a physiological role for SOD1 in guarding against mitochondrial oxidative damage.
        J Biol Chem. 2001; 276: 38084-38089
        • Balaban R.S.
        • Nemoto S.
        • Finkel T.
        Mitochondria, oxidants, and aging.
        Cell. 2005; 120: 483-495
        • Borthwick G.M.
        • Johnson M.A.
        • Ince P.G.
        • Shaw P.J.
        • Turnbull D.M.
        Mitochondrial enzyme activity in amyotrophic lateral sclerosis: implications for the role of mitochondria in neuronal cell death.
        Ann Neurol. 1999; 46: 787-790
        • Kuwahara H.
        • Horie T.
        • Ishikawa S.
        • Tsuda C.
        • Kawakami S.
        • Noda Y.
        • Kaneko T.
        • Tahara S.
        • Tachibana T.
        • Okabe M.
        • Melki J.
        • Takano R.
        • Toda T.
        • Morikawa D.
        • Nojiri H.
        • Kurosawa H.
        • Shirasawa T.
        • Shimizu T.
        Oxidative stress in skeletal muscle causes severe disturbance of exercise activity without muscle atrophy.
        Free Radic Biol Med. 2010; 48: 1252-1262
        • Chwa M.
        • Atilano S.R.
        • Reddy V.
        • Jordan N.
        • Kim D.W.
        • Kenney M.C.
        Increased stress-induced generation of reactive oxygen species and apoptosis in human keratoconus fibroblasts.
        Invest Ophthalmol Vis Sci. 2006; 47: 1902-1910
        • Fujimura M.
        • Morita-Fujimura Y.
        • Noshita N.
        • Sugawara T.
        • Kawase M.
        • Chan P.H.
        The cytosolic antioxidant copper/zinc-superoxide dismutase prevents the early release of mitochondrial cytochrome c in ischemic brain after transient focal cerebral ischemia in mice.
        J Neurosci. 2000; 20: 2817-2824
        • Li Q.
        • Sato E.F.
        • Zhu X.
        • Inoue M.
        A simultaneous release of SOD1 with cytochrome c regulates mitochondria-dependent apoptosis.
        Mol Cell Biochem. 2009; 322: 151-159
        • Wallace D.C.
        Mitochondrial diseases in man and mouse.
        Science. 1999; 283: 1482-1488
        • Hashizume K.
        • Hirasawa M.
        • Imamura Y.
        • Noda S.
        • Shimizu T.
        • Shinoda K.
        • Kurihara T.
        • Noda K.
        • Ozawa Y.
        • Ishida S.
        • Miyake Y.
        • Shirasawa T.
        • Tsubota K.
        Retinal dysfunction and progressive retinal cell death in SOD1-deficient mice.
        Am J Pathol. 2008; 172: 1325-1331
        • Methot N.
        • Huang J.
        • Coulombe N.
        • Vaillancourt J.P.
        • Rasper D.
        • Tam J.
        • Han Y.
        • Colucci J.
        • Zamboni R.
        • Xanthoudakis S.
        • Toulmond S.
        • Nicholson D.W.
        • Roy S.
        Differential efficacy of caspase inhibitors on apoptosis markers during sepsis in rats and implication for fractional inhibition requirements for therapeutics.
        J Exp Med. 2004; 199: 199-207
        • Perfettini J.L.
        • Kroemer G.
        Caspase activation is not death.
        Nat Immunol. 2003; 4: 308-310
        • Newton K.
        • Strasser A.
        Caspases signal not only apoptosis but also antigen-induced activation in cells of the immune system.
        Genes Dev. 2003; 17: 819-825
        • Williams R.M.
        • Singh J.
        • Sharkey K.A.
        Innervation and mast cells of the rat exorbital lacrimal gland: the effects of age.
        J Auton Nerv Syst. 1994; 47: 95-108
        • Obata H.
        • Yamamoto S.
        • Horiuchi H.
        • Machinami R.
        Histopathologic study of human lacrimal gland.
        Ophthalmology. 1995; 102: 678-686
        • Draper C.E.
        • Adeghate E.
        • Lawrence P.A.
        • Pallot D.J.
        • Garner A.
        • Singh J.
        Age-related changes in morphology and secretory responses of male rat lacrimal gland.
        J Auton Nerv Syst. 1998; 69: 173-183
        • Adeghate E.
        • Draper C.E.
        • Singh J.
        Effects of ageing on changes in morphology of the rat lacrimal gland.
        Adv Exp Med Biol. 2002; 506: 103-107
        • Obata H.
        Anatomy and histopathology of the human lacrimal gland.
        Cornea. 2006; 25: S82-S89
        • Damato B.E.
        • Allan D.
        • Murray S.B.
        • Lee W.R.
        Senile atrophy of the human lacrimal gland: the contribution of chronic inflammatory disease.
        Br J Ophthalmol. 1984; 68: 674-680
        • Tapinos N.I.
        • Polihronis M.
        • Tzioufas A.G.
        • Skopouli F.N.
        Immunopathology of Sjögren's syndrome.
        Ann Med Interne (Paris). 1998; 149: 17-24
        • Manganelli P.
        • Fietta P.
        Apoptosis and Sjögren syndrome.
        Semin Arthritis Rheum. 2003; 33: 49-65
        • Gyrd-Hansen M.
        • Meier P.
        IAPs: from caspase inhibitors to modulators of NF-kappaB, inflammation and cancer.
        Nat Rev Cancer. 2010; 10: 561-574
        • Krabbe K.S.
        • Pedersen M.
        • Bruunsgaard H.
        Inflammatory mediators in the elderly.
        Exp Gerontol. 2004; 39: 687-699
        • Fox R.I.
        • Kang H.I.
        • Ando D.
        • Abrams J.
        • Pisa E.
        Cytokine mRNA expression in salivary gland biopsies of Sjögren's syndrome.
        J Immunol. 1994; 152: 5532-5539
        • Narayanan S.
        • Miller W.L.
        • McDermott A.M.
        Conjunctival cytokine expression in symptomatic moderate dry eye subjects.
        Invest Ophthalmol Vis Sci. 2006; 47: 2445-2450
        • Tishler M.
        • Yaron I.
        • Geyer O.
        • Shirazi I.
        • Naftaliev E.
        • Yaron M.
        Elevated tear interleukin-6 levels in patients with Sjögren syndrome.
        Ophthalmology. 1998; 105: 2327-2329
        • Jenny N.S.
        • Tracy R.P.
        • Ogg M.S.
        • Luong le A.
        • Kuller L.H.
        • Arnold A.M.
        • Sharrett A.R.
        • Humphries S.E.
        In the elderly, interleukin-6 plasma levels and the −174G>C polymorphism are associated with the development of cardiovascular disease.
        Arterioscler Thromb Vasc Biol. 2002; 22: 2066-2071
        • Bruunsgaard H.
        • Benfield T.L.
        • Andersen-Ranberg K.
        • Hjelmborg J.B.
        • Pedersen A.N.
        • Schroll M.
        • Pedersen B.K.
        • Jeune B.
        The tumor necrosis factor alpha −308G>A polymorphism is associated with dementia in the oldest old.
        J Am Geriatr Soc. 2004; 52: 1361-1366
        • Bruunsgaard H.
        • Ladelund S.
        • Pedersen A.N.
        • Schroll M.
        • Jorgensen T.
        • Pedersen B.K.
        Predicting death from tumour necrosis factor-alpha and interleukin-6 in 80-year-old people.
        Clin Exp Immunol. 2003; 132: 24-31
        • Bruunsgaard H.
        • Pedersen B.K.
        Age-related inflammatory cytokines and disease.
        Immunol Allergy Clin North Am. 2003; 23: 15-39
        • Thiery J.P.
        Epithelial-mesenchymal transitions in tumour progression.
        Nat Rev Cancer. 2002; 2: 442-454
        • Radisky D.C.
        • Levy D.D.
        • Littlepage L.E.
        • Liu H.
        • Nelson C.M.
        • Fata J.E.
        • Leake D.
        • Godden E.L.
        • Albertson D.G.
        • Nieto M.A.
        • Werb Z.
        • Bissell M.J.
        Rac1b and reactive oxygen species mediate MMP-3-induced EMT and genomic instability.
        Nature. 2005; 436: 123-127
        • Dasgupta P.
        • Rizwani W.
        • Pillai S.
        • Kinkade R.
        • Kovacs M.
        • Rastogi S.
        • Banerjee S.
        • Carless M.
        • Kim E.
        • Coppola D.
        • Haura E.
        • Chellappan S.
        Nicotine induces cell proliferation, invasion and epithelial-mesenchymal transition in a variety of human cancer cell lines.
        Int J Cancer. 2009; 124: 36-45
        • Sullivan N.J.
        • Sasser A.K.
        • Axel A.E.
        • Vesuna F.
        • Raman V.
        • Ramirez N.
        • Oberyszyn T.M.
        • Hall B.M.
        Interleukin-6 induces an epithelial-mesenchymal transition phenotype in human breast cancer cells.
        Oncogene. 2009; 28: 2940-2947
        • Asiedu M.K.
        • Ingle J.N.
        • Behrens M.D.
        • Radisky D.C.
        • Knutson K.L.
        TGF{beta}/TNF{alpha}-mediated epithelial-mesenchymal transition generates breast cancer stem cells with a claudin-low phenotype.
        Cancer Res. 2011; 71: 4707-4719
        • Ogawa Y.
        • Shimmura S.
        • Kawakita T.
        • Yoshida S.
        • Kawakami Y.
        • Tsubota K.
        Epithelial mesenchymal transition in human ocular chronic graft-versus-host disease.
        Am J Pathol. 2009; 175: 2372-2381
        • Mariette X.
        Pathophysiology of Sjögren's syndrome [in French].
        Ann Med Interne (Paris). 2003; 154: 157-168
        • Wallace D.C.
        Mitochondrial DNA mutations in diseases of energy metabolism.
        J Bioenerg Biomembr. 1994; 26: 241-250
        • Goto E.
        • Dogru M.
        • Kojima T.
        • Tsubota K.
        Computer-synthesis of an interference color chart of human tear lipid layer, by a colorimetric approach.
        Invest Ophthalmol Vis Sci. 2003; 44: 4693-4697
        • Nakamura S.
        • Shibuya M.
        • Nakashima H.
        • Hisamura R.
        • Masuda N.
        • Imagawa T.
        • Uehara M.
        • Tsubota K.
        Involvement of oxidative stress on corneal epithelial alterations in a blink-suppressed dry eye.
        Invest Ophthalmol Vis Sci. 2007; 48: 1552-1558
        • Wakamatsu T.H.
        • Sato E.A.
        • Matsumoto Y.
        • Ibrahim O.M.
        • Dogru M.
        • Kaido M.
        • Ishida R.
        • Tsubota K.
        Conjunctival in vivo confocal scanning laser microscopy in patients with Sjögren's syndrome.
        Invest Ophthalmol Vis Sci. 2010; 51: 144-150
        • Okado-Matsumoto A.
        • Fridovich I.
        Subcellular distribution of superoxide dismutases (SOD) in rat liver: Cu,Zn-SOD in mitochondria.
        J Biol Chem. 2001; 276: 38388-38393
        • Valentine J.S.
        • Doucette P.A.
        • Zittin Potter S.
        Copper-zinc superoxide dismutase and amyotrophic lateral sclerosis.
        Annu Rev Biochem. 2005; 74: 563-593
        • Henderson J.W.
        • Prough W.A.
        Influence of age and sex on flow of tears.
        Arch Ophthal. 1950; 43: 224-231
        • Norn M.S.
        Tear secretion in normal eyes. Estimated by a new method: the lacrimal streak dilution test.
        Acta Ophthalmol (Copenh). 1965; 43: 567-573
        • McGill J.I.
        • Liakos G.M.
        • Goulding N.
        • Seal D.V.
        Normal tear protein profiles and age-related changes.
        Br J Ophthalmol. 1984; 68: 316-320